Entry information : EsilCP04 ( Esi_0083_0078)
Entry ID 13405
Creation 2015-08-05 (Christophe Dunand)
Last sequence changes 2015-08-05 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-11 (Achraf Jemmat)
Peroxidase information: EsilCP04 ( Esi_0083_0078)
Name (synonym) EsilCP04 ( Esi_0083_0078)
Class Catalase peroxidase    [Orthogroup: CP002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilCP04
start..stop
S start..stop
EsilCP02 706 0 1..497 1..501
EsilCP02 91 1e-19 87..189 457..554
EsilCP01 700 0 1..497 1..501
EsilCP01 92 8e-20 87..183 457..549
VcaCP01 538 0 64..497 65..508
VcaCP01 79 0.000000000000001 88..179 465..555
VcaCP01 62 0.0000000001 308..405 609..698
PsojCP 538 0 8..497 3..495
PsojCP 82 9e-17 62..198 421..561
PsojCP 57 0.000000008 306..405 594..680
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 455580..455672 93 N° 2 454189..454396 208 N° 3 453220..453317 98 N° 4 452325..452510 186
N° 5 451673..451757 85 N° 6 451370..451489 120 N° 7 450641..450804 164 N° 8 449871..450032 162
N° 9 449191..449267 77 N° 10 448475..448778 304 N° 11 448045..448092 48  
complement(join(448045..448092,448475..448778,449191..449267,449871..450032,4506 41..450804,451370..451489,451673..451757,452325..452510,453220..453317,454189..4 54396,455580..455672))


exon

Literature and cross-references EsilCP04 ( Esi_0083_0078)
Literature Cock,J.M. et al., The Ectocarpus genome and the independent evolution of multicellularity in brown algae. Nature 465 (7298), 617-621 (2010)
Protein ref. GenBank:   CBJ27732.1 UniProtKB:   D7G7J0
DNA ref. GenBank:   FN649064.1 (455672..448045)
Protein sequence: EsilCP04 ( Esi_0083_0078)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   514 (492)
PWM (Da):   %s   55370.35 (53182.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   3.99 (3.95) Peptide Signal:   %s   cut: 23 range:23-514
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRTCNLVRLAGFALVTGIASGGCPFLSGQEDQQQLGNHIGGERLLSTDSGYEEGADYSRETYEAIKADILAVFVDSKDFWPADFGNYAPLMIRLAWHCAGSYRNSDGRGGCDGGRIRFFPEHGWADNTNLDALTLLTPIKLKHGDAISWGDLITLTGDMAISSMGGPILGFCAGRQDDSSGYDSLELGPTEEQEATAPCAVNGTCEVPLGTSTVGLIYVNPGGPMGVPEPTESAPQIREVFARMGMNDTETVALIGGGHAFGKVHGACPTGPGADPIDAPEDPWPGTCGDPDSDTFGKGDNTFTSGFEGAWTEEPVWDNHYFIDLLEYDWIQDESPAGNIQWIPVLKEDATETDVPDIIMLTSDVALLMDTEYLAIVEEFASNQEALDVAFSNAWYKLVTRDMGPYTRCVGTDVPPPQDFQLPLPDKPTDLPSSTEAKRAIGRILEADSTYASLLVTLAYQCASTFRSTDYMGGCNGARIRFPPQSEWASNAGLSPWEMEIDRFGYIQRR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACGCACGTGTAATCTGGTGCGTCTCGCCGGCTTTGCCCTGGTTACTGGGATTGCTTCCGGTGGATGCCCGTTCCTTTCAGGTCAAGAGGTGAGTGGACTGACTGCTTTGACAAAG
TTGTGCTCGCCTCTTTGTCACGAGTTCGTTTTCGATTTCCCGCAAGCAATAGACTACAGGTTGTTCCGACCCACTCATTAGAAACAGACACGTTTGTTTCTTTGAGCCAAGGCTAAAATC
CCCCGTGTTGGTTGTGTCCAAAATGATTGGAGCAGGAACAGGTTGTTCAATGTACATGTAGCATTACAGTCCATCCCTAGGTTCAGGACACCATTTTTTTTTCAGCACACTCACTCCTCC
CCCGGTTGAAAGGGCAATTTGTTTTTCACAGGCATGGTGGCTGGCAGAATGTAGAAGAAGTACATTAAGGAGAGGTGTCAACCTGAAGGACCCTTCCCCGGCGTAAAATTAAGGACACCT
GTTGAAACGAAAAACAATGGGTGACGTGAACCGAGGTGCCTGTATTGATTGATTGGAGGAGAGCCGTCGGCTTGTCCGATTGTGTTTTTTGCTGCTACTTGAAATATACTTCTTGTATAG
TGTTTTTGTCCTGAAATATTAGACTATTATGGCGACAGTCCCCCCATTTTCGTGGTGAGACGTGTACTACATTTTTTCGTACACTACAAACATTTAGGGGTACACAGGAGAGGGCTAATT
TCTTCTTGTTGTTTTTCTTTTCGTGCCCCACCTTCCTCCTGCGGTGCGTGTTGGACTATATTCTTTACCGCGAGAAGGGTCCAGTCGTCCCTTTCCCTTGTCAACAGGGCTTACGTCGAA
GTTTGGTACTCACGAGAGCTTTTCAGCCTTGTTTTCGCTCTCACCCGCAAGCGTGTAACTTTTTCTACCCATGGGGATTCGAACTCAAGACTTTGCGACTACAGTGCAGCCAGTAGCGGT
TTCGAGGTTACCACTAGACCACCGGCGCGACCGCTTAGATACATCCAAGAATCTGAGCCTGCGATATTTTACTCACGTCTGTAACACTTCCATTCCCCGACGCAGGAGTAGCACCTTCCT
CCCATGTCTCAACCAGAAGACAGATAGTGTCAAGCGAGATAAAGACCGGGCACGAGATAAAATTCATGACTGATTGCTGTGGCACTCCTTACAGAATAAGGAAGGAAGGGTGTGGCAATT
CGTACACACATTTCAAGAGAACAATAAACGACACTTTACGCCCGACTCCCTTACCATGTTTCGGCCAATTTTACAGGACCAGCAGCAACTTGGCAACCACATCGGTGGGGAACGCCTCCT
CTCCACCGACAGCGGTTATGAAGAAGGCGCCGACTACTCCCGAGAGACATATGAAGCCATCAAGGCCGACATCTTGGCTGTGTTCGTCGACTCCAAGGACTTCTGGCCGGCCGATTTCGG
CAACTATGCCCCTTTGATGATTCGCCTTGCTTGGCACTGCGCCG
GTAGGGACACACATTGCGCCGTCGCGAAATCATTGGCGCCGTAGCTGTAGGGGTTCATTGTCGATCGCACGGGTAG
CCAATGATTTCCTAATGGTTAAGCTGCCGAACCAAGTGGTTAGGTTCAGAGCTCGTTGTTTGGGTGTCTCTCTCAGCACATCCGGAAAGACAATACTTGCAGGACCTCCGGTATCAGCAA
AGGTAGCCGAAACCAGAACCAAGCAAAGCGTCTCCGCTGACACCCAATCAACAGTTTGTGGTCGCTACGTTGCCTGTCACTTCACCCTAAAGAGTAGGCAATTTCTTCTTCGCCCCTACA
GTACAGTGGTACGTCACATTCCCCCAACATGTGGACGCAGGTAGCAGTGTTCTTGTGAGTAGAGTAGAGTGTTCTTGAGGACGACTGGCACTTTTCGGAGTTCGTGCACCCATCGGCGAC
CTTACGCAATACGTATGTCCGTGCACATCCCGCCGAAACATGTACCACAGCAGATGATTCGTCGCACCTATCTCTCCCTTATTTTTATTGTTCGGGGTGCACCATGCGCCCCGTCTCCGC
AAGTGACGACCACGCGCCTCAAACACAGAGACACTGGACAATTCTCCAGACACCCACGATATCACAGTTTCGGCACATCCGTTTGTGCATTCTTGGCCCCACATTTATAAGGTTGGGATG
TAACTGTATGCACACCAGGTCGTGGTTAGGCTGGCCCAGTATCATGACGCTGAACCTTTCGATCGTTCCATTTAAGTGCGCATTTCGCAGCCGTTTCCTCGAAAGTTTCCACGGAGTACA
GTCAAACGCATCCAAACCATCCACACATCTGCCGAAGGCTATCTACGGTCCGTCAATGTCTGCCTGCATTCGCAGGAAGCTACCGCAATTCCGACGGGCGAGGGGGCTGCGATGGCGGTA
GGATCCGCTTCTTCCCGGAGCACGGCTGGGCTGACAACACCAACCTGGACAAG
GTAATTACCCCTCCTTGCCTCGCAGTCGGCGAGTTGTTCCCGCGTCCTGACGTTTTAATAATGGACA
AACCCTCCCGCTCCTTTTGAAACGAACTCCTCGACATAACTGCCCTCCCCCCCCCGCGCGCGCACCCCCCTCGCTCGGTGTTTGCCATCGGGGTTGGTTTCTCGTCGCTTGGCAACGACG
TTGTAAAACAAGCCGCCCCCCCCGGTGTTTGCCATCGGGGTTGGGTTTTCGTCGCTTGGCAGCGATGTTGTCAAACAAGCCGATCACTTCGTGAGCTCGGCCACCAGGTTACCGCTTTTT
TATTGCCTTTGGCCTTTTTTGTGCGGTAACCACGAATGGTGGTCGACTAGATCATGGTGTGCGGGGTCGAGAACCCTTACTTCGACAGTGCTTTCGACTGTCTCTGGAAGTGAAAGCACC
AGAAAATAAGTCATACACAGCTGTCATCCGTACGCAAGGAAGTAAGCACAAGATGCCGAAAACCCTTAGCAGGATGCAGCGCACCCTTCATGCGACTCGCCGAATACGTCACGGCGCTTC
GCGCTTGGTGATGTGAGAGCCTGGTCCGGTGAGAACCCGGCGTGCTCCGTCCCGGCTTTGTAGGGATGCGAGGTCAATGGTCTAACGGCTACGGCATGCACGACTATGAGTATACCCCCC
CGCGCGCGCGCGCGCGTCGCCTTCGGCGGTACAAACCAACAGGCCCTGACCCTGCTGACGCCCATCAAGCTCAAGCACGGCGACGCGATCTCGTGGGGTGACCTCATCACGCTCACGGGA
GACATGGCCATCTCGAGCATGGGGGGTCCCATCCTGGGATTCTGCGCTGGTAGGCAGGATGACTCCTCCGGCTACGACAGTCTCGAACTCGGCCCGACTGAGGAGCAG
GTGCGGGGCCCG
ATACGGGGGGGCGTCCCGAATTTCCGTTCTTCGGAAAACGCCGTACCGTTGAACCGTGGTCATCGGTTTCAGCCGATTGATTTCGGTGCCGATGTTGGAGACTGCAGTGCGCGTCGACTT
GGGATTAGAACGTTTCGTCCGTGACCACCATTGTCGGCCTCTTTCGCTCCCATCGTTGCAGCTGACTCGGCCGTCTGGTTTTCATGGGACCAGCTTAACCTAATTATTCATGTTCGATAT
TTTGGACCAGGAGAAGGTTTTTCGTTTGGTCGATATATCGAGAGGAGTCAAAACGGTTGGTGCTCCACGTACACACTGTTTGACGCAGGGTTGTTTGCCGAAACTCGTACCACTGCGAAC
CGATGTCGTCTTCTGGTCGTCTGCTGCGCAAGAACCAAGCTGAAACAATCTGCGGGCGGTGTGAATAAGATAATCTGAATTCGACAGGAGGTCGACAATGCGTTCGATTCTTGATCGTGA
CAACAAGAACAACCAGTATCGACATCGGTATGGTGGCAACTAACATTCGAAAATTGTGAAAACCACCTTGAGCAGGAGGCGACTGCTCCTTGCGCCGTGAACGGAACGTGCGAGGTTCCT
CTTGGAACCAGCACGGTGGGGCTCATCTACGTCAACCCAG
GTGTGAATAATCTGCTGCTGCCCGAAAAAAAAAACTCAATTGTGAACCATCAGTTGTGCGCCACTACCGGCAATCCTTGG
ATCGTGAAACGTGAACTATTGTGCACCGATAATAGTACTGTTTTGCACAACAGCAAACGTTGACCCGGAGAACCGCAAAACCGTGCTCGTTACCGTTATCCAGGCGGGCCGATGGGTGTC
CCTGAGCCTACGGAAAGTGCACCCCAGATCCGTGAAGTTTTCGCGCGGATGGGTATGAACGACACCGAGACCGTGGCTCTCATCGGCGGAGGGCACGCGTTCG
GCAAGTTCCGCTGGCCC
TCTTCGTAGGGTAGATCTAGGCTCGAATCGGCATTTCCTGTATAGGTCATCTTGCCCCCAATAGCTTCGGTAGAATGCGTTGTAGGCCCATGTCTTCTCCCGATGTTTCCTCTCGCTACG
TCCCTACGATGGTCGGCTCCCTGCCTGCCTCTGATATGACGTTGCCGACGGGATTATTCAACGGAGAAACGGCACCGACGCATGAGGACGTTGAAGGCGAATTTTGCAACATGTTGAAAA
TGATGTTCCTACTGACGCATTATTGGCAACCGTGCCCCACCGCCCCTCCCCGCACATGACGTCTTCAACCTTTCCGTCGATGGTTCGTTTTCAGATGTGAATTCCCGTTTCTCTATAGGG
AATTTCGATCAAGCACGCTTTTCTCCGGTCTACAACACTATGCCGCTCTTGTGGGATGGCCACATAAATGCTCGTCTCCCTAGCAACACGGTCTCCCTCGCGCCGTCTCTCCCCTCATCT
AAGCGACCGCCACCGCGATAACCTGCTTGCCCCCACGTACGCTGGTCATCCCCGCTCGATGTCTACAGGAAAGGTTCACGGGGCATGCCCTACCGGTCCTGGCGCGGACCCCATCGACGC
CCCCGAAGACCCCTGGCCGGGAACGTGCGGGGACCCCGATTCCGACACCTTCGGGAAAGGCGATAACACCTTCACCTCAGGCTTTGAGGGAGCATGGACTGAGGAGCCCACG
GTACGTCG
TGTGCGGTTGCGATGCTGTACCGGTCGTTTGACGACATATGAGGGGCTGGGCAAACGCCTCCCTCCGCACCCCGACCTTGAAGACCGAGGTCGGAGGAAGTAATGTTCAAGGACTGGCAA
CGACTATGTTGAAGCGGCACAGCAGTGTTCATTTCTCAAGGCTACGTGTTTCCAGGGTGCCATGTCCTAGCGGCCTTTTGGACTGATCATTGACGTCTGGAAAATGGAAAGAGTCCGCTG
ATTAACGGTTCGTGCGAATAAAAACATGTCTCCAGCAGTATGGTAGAGCTGCCTTTGCTATCGAAAATCCGACTGCACGTGGGGGCTTCATGCTACAATGTACTCGTCAGAAGCGCGCAT
GGTGTATCTCTGCTAGTTTGATGTACGGGTGCTACTTTTTTCGTATTCAATGACAAGCGCGCACGTGCACATCTGGCCTGACCTCAGTGAATTGCATGGTTGGTTTCCCTCTATGGAGTT
GTTCCCAGCCTACAGTGGACACAACATCTGATTCTGATGCTATTGTCGTTCCTGATCCTACCACTCAGCCGTCTGGATTTCCTTTCGCATATTCTTTCCGCTTTTTGCCGAATATTGAAG

GTATGGGACAACCATTACTTCATCGACCTCCTCGAGTATGATTGGATTCAAGACGAGAGCCCCGCCGGCAACATCCAGTGGATTCCCGTGCTGAAAGAAGACGCCACTGAAACTGACGTT
CCCGACATTATCATGCTAACTTCGGACGTCGCCCTGTTGATG
GTGAGGACAAGAGATATTGGACACCAGCTGCCACTCATCTCTGATGGCTGCCCGGTAATTTGTCGGTGGTAAAGACCC
CGACGTGAACTAATCAGGAAGGACCCAACCCATCACCATCCAAAGCGTTCTGGTACATGGCACCTTGGTTCGACGCTCGCGTCTGTTCGTTGAGTATACACCACTTCAAACTGGTTCCAG
TGCCTCCTTGATCGACAGGCGTTGTGTCGACCATGTCCCGAAAGAAAGAATCACGTCCATATCCGCAACGTGTGGTAGTCAGTTGCATAGCTTGTCTGGGTCTAGTTCCTTGTTCTCCTA
TCCGGACCCTGCCGCGAAGCCAACCGTGGCCCAAATTGTCAGCAAACAGGCAACGTGTCGTGGTGGGGACCTAACAGTAGCTCCCACCGCCCGCCGGTTGTTCTAACCTTGCACGCATCC
GGCACGGCGTACCGACGAAACGGTGCGAGCGGGCAGTGGCTTGCGCAAGATATCACTGTAGCTCTTGCTCAAAATAGAATTACGGCTGTATTCGTTGTGACAATGTGGTTGCCCGCGCAA
AGACACCCTTCTGTTGCCCTAAACAACCTTCGTGTGCCACTGCAGGACACCGAGTACCTCGCTATCGTGGAAGAGTTCGCCTCCAACCAAGAAGCCCTGGATGTCGCCTTCTCCAACGCC
TG
GTAAGGCCCACACGGAGACTCGAGTAGTACAGGGCACCAGAAATAGTGTAACTTGAGCAAACCGGACACATGTAGACCGATCACCCCGAGCTCCGTCTTCCGCTCTTCTAAGAAGAGA
CGCAGTGCACTTAAAAGAAACTTCAACAAGAAATTTTGTCTGCGGGTACGATTTACACAACCATGCGCGTAACCTAGCGTGAGACGGTGTGGTAGACGGCAGCCCAACTAGAGTAGGCGC
AGTTACGCCGAAACGGGTATTTCTACCTTGTGCCCTACCATGTGTTCGACCCCTCCGTCCGACGAGTGACTTCCCACCGGCAGTTAACCGAGCCGTTGGTGAAATACGACAGCTACCGCC
GCGCTTGCTAGTTTACTTGTGGGTCTGGTCTTCGTTTCAACGTCCCCTCGACAGGTACAAACTCGTCACTCGCGACATGGGCCCGTACACGCGTTGCGTCGGGACCGACGTCCCTCCCCC
GCAAGATTTCCAACTCCCGCTCCCCGACAAGCCGACGGACCTCCCGAGTTCCACGGAGGCCAAGCGAGCGATCGGCCGAATCCTGGAGGCGGATTCAACGTACGCGTCCCTGCTCGTGAC
CCTGGCCTACCAGTGCGCGTCTACCTTCCGGTCTACGGACTACATGGGGGGCTGTAACGGTGCCAGGATCAGGTTCCCGCCTCAGAGCGAGTGGGCTAGCAACGCGGGCTTGAGCACG
GT
GAGCTTGTGTCACTGGCCCCGTTCGTAAGAGTGTCGTGCGTTGTTGGGCGATGTTGTGTCCTTCTCTGCTTTATTGAGTGCCGGGAAGTTGTATTGAAACCGCATGTGACTTGGTCCTCT
GAGCGAGGATGGCTTTGTCCCGCAGTGGTTAAGGAGGTACTACCGTAGGTTGCGAGTCAGCGCACCGGAGTGCGAAAACATTTCAAAGCGAAATTTCTCCACAACCAGGAGGATACCACT
GTCGAACAGGGCGGTTTTGGAATATCTCGTCGAGAGCTTTCCTGAGAAGTATCAGTTGGCGCTCGCACTTTCCTGGTTGTGGAGAAAATACTCTTTGAAAATCGCACCCCTGTTCGCTGA
CTCGCAACCTTACGGTACAGCCCTGGGAGATGGAGATTGATCGCTTTGGATACATCCAAAGGCGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACGCACGTGTAATCTGGTGCGTCTCGCCGGCTTTGCCCTGGTTACTGGGATTGCTTCCGGTGGATGCCCGTTCCTTTCAGGTCAAGAGGACCAGCAGCAACTTGGCAACCACATC
GGTGGGGAACGCCTCCTCTCCACCGACAGCGGTTATGAAGAAGGCGCCGACTACTCCCGAGAGACATATGAAGCCATCAAGGCCGACATCTTGGCTGTGTTCGTCGACTCCAAGGACTTC
TGGCCGGCCGATTTCGGCAACTATGCCCCTTTGATGATTCGCCTTGCTTGGCACTGCGCCG
GAAGCTACCGCAATTCCGACGGGCGAGGGGGCTGCGATGGCGGTAGGATCCGCTTCTTC
CCGGAGCACGGCTGGGCTGACAACACCAACCTGGACAAG
GCCCTGACCCTGCTGACGCCCATCAAGCTCAAGCACGGCGACGCGATCTCGTGGGGTGACCTCATCACGCTCACGGGAGAC
ATGGCCATCTCGAGCATGGGGGGTCCCATCCTGGGATTCTGCGCTGGTAGGCAGGATGACTCCTCCGGCTACGACAGTCTCGAACTCGGCCCGACTGAGGAGCAG
GAGGCGACTGCTCCT
TGCGCCGTGAACGGAACGTGCGAGGTTCCTCTTGGAACCAGCACGGTGGGGCTCATCTACGTCAACCCAG
GCGGGCCGATGGGTGTCCCTGAGCCTACGGAAAGTGCACCCCAGATCCGT
GAAGTTTTCGCGCGGATGGGTATGAACGACACCGAGACCGTGGCTCTCATCGGCGGAGGGCACGCGTTCG
GAAAGGTTCACGGGGCATGCCCTACCGGTCCTGGCGCGGACCCCATCGAC
GCCCCCGAAGACCCCTGGCCGGGAACGTGCGGGGACCCCGATTCCGACACCTTCGGGAAAGGCGATAACACCTTCACCTCAGGCTTTGAGGGAGCATGGACTGAGGAGCCCACG
GTATGG
GACAACCATTACTTCATCGACCTCCTCGAGTATGATTGGATTCAAGACGAGAGCCCCGCCGGCAACATCCAGTGGATTCCCGTGCTGAAAGAAGACGCCACTGAAACTGACGTTCCCGAC
ATTATCATGCTAACTTCGGACGTCGCCCTGTTGATG
GACACCGAGTACCTCGCTATCGTGGAAGAGTTCGCCTCCAACCAAGAAGCCCTGGATGTCGCCTTCTCCAACGCCTGGTACAAA
CTCGTCACTCGCGACATGGGCCCGTACACGCGTTGCGTCGGGACCGACGTCCCTCCCCCGCAAGATTTCCAACTCCCGCTCCCCGACAAGCCGACGGACCTCCCGAGTTCCACGGAGGCC
AAGCGAGCGATCGGCCGAATCCTGGAGGCGGATTCAACGTACGCGTCCCTGCTCGTGACCCTGGCCTACCAGTGCGCGTCTACCTTCCGGTCTACGGACTACATGGGGGGCTGTAACGGT
GCCAGGATCAGGTTCCCGCCTCAGAGCGAGTGGGCTAGCAACGCGGGCTTGAGCACG
CCCTGGGAGATGGAGATTGATCGCTTTGGATACATCCAAAGGCGCTAG

Retrieve as FASTA