Entry information : RfCcP01 ( RFI_09656)
Entry ID 13421
Creation 2015-08-11 (Christophe Dunand)
Last sequence changes 2015-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-09 (Achraf Jemmat)
Peroxidase information: RfCcP01 ( RFI_09656)
Name (synonym) RfCcP01 ( RFI_09656)
Class Cytochrome C peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Foraminifera Reticulomyxidae Reticulomyxa
Organism Reticulomyxa filosa    [TaxId: 46433 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RfCcP01
start..stop
S start..stop
PsuCcP02 180 5e-55 25..291 9..275
ArubCcP01 177 3e-54 49..292 6..249
GinCcP01 178 4e-53 11..289 87..365
CtheCcP01 177 4e-53 25..299 76..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 453..703 251 N° 2 775..1056 282 N° 3 1175..1676 502  
join(453..703,775..1056,1175..1676)


exon

Literature and cross-references RfCcP01 ( RFI_09656)
Literature Glockner,G. et al., The Genome of the Foraminiferan Reticulomyxa filosa. Curr. Biol. (2013) In press
Protein ref. GenBank:   ETO27475.1
DNA ref. GenBank:   ASPP01007234.1 (453..1676)
Protein sequence: RfCcP01 ( RFI_09656)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   38998.25  
PI (pH):   %s   4.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVGALLGVGGLYWYLREDEKEQTTIDPNVLDYELLRSEIRSILYHESFDDGCCAPLLLRLAFNQCATYSKYDGLGGMNGASLRFDPERSYPHNRGLDRAMKLLESIKRKYPKISYSDLWVLASYVAIEEMGGPYIEFRGGRKDCKPPTENNLGLALEEQRFPEWDAGGTRLLDWFDRMGLSDREGTCLMGGHSCGRLHAANSGIEGTWLDAQILTNDYFKNIVFLPYLYERRGREHYYDPAHPEVVLLPIEGSFKYCARVMRWAEFYAYADLHVWLEDFGAVWKKVTENGCLLDDDDPDAPLPSIETATFLGLSSPKTQQEIEALSLLNTDNQEKKSPPPKLK

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGTGGGCGCACTCTTAGGTGTCGGTGGATTGTATTGGTATTTGCGTGAAGACGAAAAAGAGCAAACGACAATCGATCCAAATGTATTAGACTATGAATTATTGAGAAGTGAAATT
CGTTCCATCCTATATCATGAATCATTCGACGATGGTTGTTGTGCACCGTTGCTATTGCGTTTGGCATTTAATCAATGTGCGACTTACAGTAAATACGATGGCTTAGGAGGGATGAATGGC
GCATCACTTCG
GTTAATTTTTTTTTTTTTTTTTTTTAGAAAAAAAAAACTTTTTTATTAAATTGCATTAAAACAATTTTTAGATTCGACCCTGAGCGTTCATATCCACACAATCGAGGAT
TGGACCGGGCCATGAAATTGTTAGAAAGCATCAAAAGGAAATATCCGAAAATTTCTTACAGTGATTTGTGGGTTTTGGCTTCTTATGTCGCCATCGAAGAAATGGGAGGTCCTTACATTG
AATTTCGTGGAGGACGCAAAGACTGCAAACCTCCAACGGAAAATAATTTGGGTCTAGCTCTGGAGGAACAAAGATTTCCAGAATGGGATGCTGGGGGCACGAGATTACTTGATTGGTTTG
ACAG
GTTACAATCTTCGTTGTTTGCACATATGTTCCCATCCATGCTTTCATTACTAGACAAACAACGTCCTTTTTTTTTTTTGCTTTGTTTTTTTTTTCTCTTCTTTCTTTTGCAATAAA
AGAATGGGACTGAGCGATAGAGAGGGAACGTGCCTTATGGGAGGACACAGTTGTGGACGTTTGCATGCAGCAAACAGTGGCATTGAAGGCACGTGGTTAGATGCCCAAATATTGACTAAT
GACTACTTCAAAAATATTGTCTTTTTACCTTATTTGTACGAACGACGTGGACGAGAACATTACTACGATCCAGCTCATCCTGAAGTTGTCTTATTGCCCATTGAAGGATCTTTCAAATAT
TGTGCTCGAGTTATGCGCTGGGCTGAATTTTATGCTTACGCCGATTTGCATGTGTGGCTCGAAGACTTTGGTGCGGTATGGAAAAAAGTCACTGAAAACGGCTGTCTCCTTGACGACGAT
GATCCTGATGCTCCTCTACCTTCTATTGAAACAGCTACCTTTTTGGGTCTTTCTTCTCCCAAGACTCAACAAGAAATTGAAGCTTTGTCTTTACTCAACACTGACAACCAAGAAAAAAAA
TCGCCACCACCTAAATTAAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGTGGGCGCACTCTTAGGTGTCGGTGGATTGTATTGGTATTTGCGTGAAGACGAAAAAGAGCAAACGACAATCGATCCAAATGTATTAGACTATGAATTATTGAGAAGTGAAATT
CGTTCCATCCTATATCATGAATCATTCGACGATGGTTGTTGTGCACCGTTGCTATTGCGTTTGGCATTTAATCAATGTGCGACTTACAGTAAATACGATGGCTTAGGAGGGATGAATGGC
GCATCACTTCG
ATTCGACCCTGAGCGTTCATATCCACACAATCGAGGATTGGACCGGGCCATGAAATTGTTAGAAAGCATCAAAAGGAAATATCCGAAAATTTCTTACAGTGATTTGTGG
GTTTTGGCTTCTTATGTCGCCATCGAAGAAATGGGAGGTCCTTACATTGAATTTCGTGGAGGACGCAAAGACTGCAAACCTCCAACGGAAAATAATTTGGGTCTAGCTCTGGAGGAACAA
AGATTTCCAGAATGGGATGCTGGGGGCACGAGATTACTTGATTGGTTTGACAG
AATGGGACTGAGCGATAGAGAGGGAACGTGCCTTATGGGAGGACACAGTTGTGGACGTTTGCATGCA
GCAAACAGTGGCATTGAAGGCACGTGGTTAGATGCCCAAATATTGACTAATGACTACTTCAAAAATATTGTCTTTTTACCTTATTTGTACGAACGACGTGGACGAGAACATTACTACGAT
CCAGCTCATCCTGAAGTTGTCTTATTGCCCATTGAAGGATCTTTCAAATATTGTGCTCGAGTTATGCGCTGGGCTGAATTTTATGCTTACGCCGATTTGCATGTGTGGCTCGAAGACTTT
GGTGCGGTATGGAAAAAAGTCACTGAAAACGGCTGTCTCCTTGACGACGATGATCCTGATGCTCCTCTACCTTCTATTGAAACAGCTACCTTTTTGGGTCTTTCTTCTCCCAAGACTCAA
CAAGAAATTGAAGCTTTGTCTTTACTCAACACTGACAACCAAGAAAAAAAATCGCCACCACCTAAATTAAAATAA

Retrieve as FASTA