Entry information : EgrRboh07
Entry ID 13479
Creation 2015-12-09 (Christophe Dunand)
Last sequence changes 2016-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-12 (Achraf Jemmat)
Peroxidase information: EgrRboh07
Name EgrRboh07
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrRboh07
start..stop
S start..stop
EcamRboh07 1326 0 26..796 2..683
EguRboh07 1304 0 29..796 16..694
MtRboh06 1017 0 38..796 50..815
GmRboh13 942 0 67..796 74..800
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 433..772 340 N° 2 1797..1953 157 N° 3 2050..2098 49 N° 4 2191..2304 114
N° 5 2390..2803 414 N° 6 3003..3389 387 N° 7 3669..3764 96 N° 8 3963..4078 116
N° 9 4223..4325 103 N° 10 4400..4564 165 N° 11 4665..4796 132 N° 12 4934..5062 129
N° 13 5493..5571 79 N° 14 5848..5957 110  
join(433..772,1797..1953,2050..2098,2191..2304,2390..2803,3003..3389,3669..3764, 3963..4078,4223..4325,4400..4564,4665..4796,4934..5062,5493..5571,5848..5957)


exon

Literature and cross-references EgrRboh07
Protein ref. GenBank:   XP_010030665.1
Cluster/Prediction ref. Genebank:   104420535
Protein sequence: EgrRboh07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   796
PWM (Da):   %s   89114.22 Transmb domain:   %s   o275-294i359-378o409-431i462-484o
PI (pH):   %s   8.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSPEAHYTSSSSSSSSSSSSSSSSSSSYGASVVPVPYSPVQTDRDHRADDHDGGINGGTAAATSLAIQRLRFLDASAKHWRQVEERFDRIARDRYRNGVEPAARWSDFAFCVGIQRSTEYAQELLRALRGRDGLKSDVTKSELHYFWRRLTDPCPDSKIQIFFDLCDRNMDGIVSRRDVKVILMSAGANKVSLTGEEVDEYAALIMAAVGSGDGGYIEISQVETLLKLGLSKDSSATAPSPRLCYRGGWDSDGVVGRPMSTLEVLFRSYWRRAWIVALWLAICVALFTWKFIQYRHRTAFEVMGYCLCTAKGAAETLKFNMAVILLPVCRNTVTWLRASRRVSSIVPFNDNINFHKLIAAGIVIGVILHGGTHLACDFPRISSSDHSIFRQTIAAGFGYHQPSYLQILATTEVATGIAMVVLMAIAFSLATRWPRRQAPPLPRSVRQVTGYNTFWYSHHLFVFVYALLIVHSMFLFLTSNLIEKTTWMYIAFPVLLYTGERIFRAVRSAFYEVEILKANVYPGKVLSLTISKPEGFEYRSGMYIYIQCSRISPFEWHPFSLTSGPDEGHLSVHIRTLGDWSYQLYSLFQATVARTASYPKMYIDGPYGAASQDYVKYDVVVLVGLGIGATPFISILKDVVGCDHVDGGEVSIPKGPAKAYLYWVTRDQSSFAWFRDFIKQISKSNRKESIMEMHNFLTSMYKEEDARSVLLSTIQALSHAKSGVDFISQTPVHTHFARPNWSSIFSKLSRRHGGSQIGVFYCGPSALARELEELCTKFSTKTITRFVFHKEHY

Retrieve as FASTA  
Remarks Complete sequence from genomic (Unplaced Scaffold, 13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCCGAGGCTCATTATACATCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCATCCTCTTCCTCCTCGTCTTCCTACGGCGCCAGCGTGGTTCCGGTCCCGTACTCTCCC
GTCCAGACGGACCGGGATCACCGTGCCGATGATCACGACGGCGGAATCAACGGCGGCACGGCGGCGGCAACTAGCCTGGCCATCCAGCGGCTGAGGTTCCTGGACGCGAGCGCCAAGCAC
TGGAGGCAGGTGGAGGAGCGGTTCGACCGGATCGCCCGGGACCGCTACCGGAATGGCGTCGAGCCGGCGGCCAGGTGGTCGGATTTCGCCTTCTGCGTCG
GTGAGTGCTCCGGAACAAAG
GCAAAACGATTAACGGTTAACGATTAACGATTTCTCGGCGATTCAATTAGAAAAATTAAATCAAAATACACATTTTTTATATTTCATTTTCGCATTTTTTGAGAGAAATTTGGATGCCAT
TGAGCGTTCAACATGCGAGGTTGTACGCGTCCATGCAAGGCGCGCTCTCGCTAACGTGCGCTCCCGCCGCTACCCGGCACGTATATGGTGCTCAATGGCTGCCACGTAAGCAGGCGCACG
TTAGCACGGAAAATGCTTTTTAGATTTCAGTTTTCATCAAAGGAAAAAAAAATAGCAAAAATACAAGAAATAAATTACAGTTTCGAACTATCGATACTTTTTATTTTGAAGCGTCTAAAA
TCATTTCGACAATTTTTTCATAACTTTTTTGTATGTTTTTCTTTCCAAATTATGCACGTGATTCACGTTTTTTTTTCTGTACATGATTCGTTTCGATAATTGTAACGGCTGGTGAGTATG
TTAATCGCAAATTATCCTAAAATTTCAAAAATATATACATATATGAAATAATCTCATTTATGCAAAAATGGAGTCTTGAAGACATGTGATATGATGAAGCGCAAATAAAGATAACAAGTC
ATTTCGATAATTTTTTAAATAATTTTTATATGTATGTCTTTTCCAAATTATTGTGATGCTTTGGTATTTAGAATTGTTCGTCAAAAAAAAAGTATGCAGGCGATTCACTTTTTGTTTTTT
TTTGTTCTGTACGTGATTCATTTCAATAACCATTACAGCTACTGAGTAATGTAGATAATAAATTGTCCTAGTCTATGCAAAAATGAAGTCTTGAAAACAAGTGATGTGACGGCGCATAAA
GAAAGAATGTCAATTACGATATTTTTCCAGAAAAAAAAAAACCCTAGAAATGTACTAAAATTGTATTATATGCACGTATATTTTCTAATTCATATGTTGAGATTTTTTATTGAAGTGCAT
GGATGAGAAAAATGTGGAAAAACTTTTGGTTTGACAATCGATAGGAATTCAACGGTCAACGGAGTACGCCCAGGAGCTGCTGCGAGCGCTGCGAGGGAGAGACGGCCTCAAATCCGACGT
CACAAAGAGCGAACTCCACTACTTCTGGCGCCGCCTCACCGACCCGTGCCCCGACTCCAAAATCCAGATCTTCTTCGACTT
GTAATCAGTTCAAATTCATCGCCATTTCCATGAATTTTT
CTGTACATTTCGATCGCGGAAAATACCCGTTTCTTCATTTTTAATTATATCGCGCAGGTGCGACCGAAATATGGATGGGATAGTTAGCCGGCGCGACGTCAAGCAGGTGCGCTGCTCCGT
TCGTTTCGCGGAAAATGAAAGATAGTTTTCTGCATGCTGCAGTCTTTCTCAAGATTTTCGAAAGTTTGATTTGGGCAGGTGATCTTGATGAGTGCTGGCGCGAACAAGGTGAGCTTGACC
GGCGAGGAGGTGGACGAGTACGCCGCGCTGATCATGGCCGCCGTCGGCTCGGGAGATGGAGGTTACATAGAG
GTGATGATGCCTTCGACGAGAGGAATGAAATGGTGGCAAAAGCTCAAC
GTTGCCTGACTGATGTCATGACATGTTCACTGTGCAGATATCTCAAGTGGAGACGCTGCTGAAGCTCGGGTTGTCGAAGGACTCTTCCGCCACTGCCCCGTCGCCGAGGCTGTGCTACCG
CGGGGGCTGGGACTCGGATGGGGTGGTCGGGCGGCCCATGTCGACGCTGGAGGTCTTGTTCCGGAGCTACTGGCGACGGGCGTGGATCGTGGCCCTCTGGCTGGCGATTTGCGTCGCGCT
GTTCACGTGGAAGTTCATTCAGTATAGGCATAGGACGGCGTTCGAGGTCATGGGCTACTGCCTTTGCACCGCCAAAGGGGCTGCCGAGACCCTCAAGTTCAACATGGCCGTGATTCTCCT
CCCCGTCTGCCGGAACACGGTCACGTGGCTCCGCGCCAGCCGCCGGGTCAGCTCGATCGTCCCCTTCAACGATAACATCAACTTTCACAAG
GTAGAAGAGGAGTGCATAGTGATTCATGC
AATATTCTCAACATTCTGGCATCATGTACTAGCAGCATGACTGATTCCTATCAAATAAGAACCAAGTTTCGGCTCGAGATTTAGAAAACTGGTTGATTTCATAGTGTCGAGCAACGGTCA
TCTCCTGTCTGATGCAACTGTAAACACCCGAATTCATTTCTCTATGACAGTTGATCGCAGCTGGGATCGTGATCGGGGTGATCCTCCATGGCGGCACCCACCTGGCGTGCGACTTCCCTC
GGATCAGTAGCTCGGATCACTCGATCTTCCGCCAGACGATTGCCGCAGGGTTCGGCTACCATCAGCCATCGTATCTCCAGATCCTGGCCACGACGGAGGTGGCAACAGGGATCGCAATGG
TGGTCCTTATGGCAATCGCGTTCTCCCTCGCGACAAGGTGGCCAAGGCGCCAGGCCCCGCCACTGCCCCGGTCAGTCCGGCAGGTCACGGGGTACAACACCTTCTGGTACTCACACCACC
TCTTCGTCTTCGTGTACGCACTGTTGATCGTGCACTCCATGTTCCTCTTCCTGACCAGCAACCTAATAGAAAAGACG
GTAGGTCGCTCGGACTTTTAGATTCGTACAGAATAGTGCTGAT
CCGATGTCGTTGTCTCGACAAACGTATGGATTTTTCACAACTTCACTGGAGTTCTTGCTTAGAAATTATAAGCAGTTCTCAGCATGCATCACAATTCCCACAAGAAATGCAAGAAATTTG
GAGAGCTGCAATTTTCTTCTAATATAATCTGCAATTCCAAGATTCGATTCAATGAGAATGTACATCTTTTCTAACGTCGTCACTGATTCATGCATAATGCCGTTCTGGTTGCACAGACAT
GGATGTATATCGCCTTTCCAGTGCTGCTGTACACGGGAGAGAGGATCTTTCGGGCTGTCAGATCGGCATTTTATGAGGTGGAGATACTGAAG
GTATGTCAAGTCATTTACCATGCTGCGA
AAATGGTTTACCAGACTTGTACAGATCATATCGAAATCATGTTCAGTCGGGTCTGGAATGTCCTGTGGCCAGCCGACTCTCATGGAATATGTTTTCCTGTGAAACAAACGACCCTCATGT
GGTATTGTTCTGATCATGTAAACAGATAACTGCTGTATTTTCTCATGTAGGCAAATGTGTATCCAGGAAAGGTTTTGTCCCTGACAATTAGCAAGCCCGAAGGCTTTGAGTACAGAAGTG
GAATGTATATATACATTCAATGCTCTCGAATATCACCCTTCGAATG
GTATTCTGCATGCCTTCTTTCTTTTCAAACTGGTCGTCGCCTTGTCCCTTCCAAACTGTGACAGCTATGAGATT
ATCGTGACGCTCTCCTCGTACTTTTGCCTGTTTAAAACGACCGTGCTTTCGGTTCTATGTTGATGTCCAGGCACCCGTTTTCATTGACTTCTGGACCAGATGAAGGTCACTTGAGTGTGC
ACATTAGGACACTTGGAGACTGGAGTTATCAATTATACAGTCTCTTCCAAGAG
GTAAGGAACAAAAAGGACTCGAATCGATACTCCTCAGAAACCGGGAATCCAAATCTCTGTTGTTTTC
TATGCAGGCAACTGTGGCAAGAACAGCTAGCTATCCCAAAATGTACATCGACGGGCCTTACGGTGCAGCCTCTCAGGACTATGTCAAGTACGACGTCGTGGTTCTGGTTGGCCTCGGAAT
AGGAGCAACGCCATTTATCAGCATTCTTAAGGATGTCGTCGGTTGCGATCAT
GTAAGTTTCTAGGTTACACCTCCCTTGCATTGTTGAATAAGATATTCAATATGCTTTATTTAACCCTG
TGCTGACACAAGGTAAATGCTCGATTTACCAGGTGGATGGCGGAGAAGTCAGCATTCCGAAGGGTCCAGCGAAAGCCTATCTGTACTGGGTTACGAGGGATCAGAGCTCCTTTGCCTGGT
TCAGGGATTTCATCAAGCAGATATCGAAGAGCAACCGGAAAGAG
GTTACTGATTGATTCTTACGGCAGCAAGCAAAACCTGAAAATGTCTTCAAGAAAATGAAGTTGACATGAGTCTTTA
TAGGCACTGATTTGATATTTGCTTGTACTTTAAAACCAAATTAGTTGTTGTTCCTTTTCAGTCGATTATGGAGATGCACAACTTCCTGACCTCGATGTACAAGGAGGAGGATGCGCGGTC
GGTGTTACTAAGCACCATTCAAGCTCTGTCTCATGCCAAGAGTGGCGTCGACTTCATCTCTCAGACCCCG
GTTAGTCGTTCGATTATACTCCACATCTCCGCGTCTGATTTCTGCGTGGC
AACAGCTTCCAGCTTGTCCATAAAACTTTAAGATCTTGTTCTTGATTAAAAAGATGTGAAGTAGGGCAGTTAGAAGCCCGATCGATGATCATGGTCATGAACTTTTTAGCAATCTCACTT
GGCGGTTCGTCTTTACTTGTCATCATGCTAAAACCATATGTCCTTTCCGGAGTTGTGTTTGCATGTCTTAAAAGTACAGTCTTCCCATTAACAATGCACTCGGCATGCAGTTATGACGTA
AATCTTCTTGCCATCCCTGCAAATCGATTAGCACGAATGATTATGACGAAAGCATTCAAATTCAGTTCAACCACTCGTGAATTCATGAGAATACCTCTCGCTACAAGATCGGTTGATCTA
ACTTCTAATGTCATTTTCAGGTGCATACTCATTTTGCCAGACCAAATTGGTCCAGCATTTTCTCCAAGTTGTCCCGAAGGCACGGCGGTTCCCAGATTGGTGAGACTTCGGCAAACCCCG
TGACAACAGTACATCTTTATCATTTGCTTTCGGCATGCTTCTGTGATTCCTCTATTAGAAGGCATTCTACGGCATACAATTCACGGGGTCCTGATCGAACTTTAGCGCCATTGGTTGACA
AACCATTTGCAAATAATTCATGATGCGTCCGTGTTAAAATCAAATTAGCTAGTGATCTCAAAAGGCGCTTGTGGGACGGATTGTTTTTTTCTCCTCGATAGGGTTATATCTGAATCTCCG
GCTTATGATTTGCAGGGGTGTTCTATTGTGGTCCTTCAGCATTAGCAAGAGAATTGGAGGAGTTGTGCACCAAATTCTCCACCAAAACCATCACAAGATTTGTGTTCCATAAGGAGCATT
ATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTCCCGAGGCTCATTATACATCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCATCCTCTTCCTCCTCGTCTTCCTACGGCGCCAGCGTGGTTCCGGTCCCGTACTCTCCC
GTCCAGACGGACCGGGATCACCGTGCCGATGATCACGACGGCGGAATCAACGGCGGCACGGCGGCGGCAACTAGCCTGGCCATCCAGCGGCTGAGGTTCCTGGACGCGAGCGCCAAGCAC
TGGAGGCAGGTGGAGGAGCGGTTCGACCGGATCGCCCGGGACCGCTACCGGAATGGCGTCGAGCCGGCGGCCAGGTGGTCGGATTTCGCCTTCTGCGTCG
GAATTCAACGGTCAACGGAG
TACGCCCAGGAGCTGCTGCGAGCGCTGCGAGGGAGAGACGGCCTCAAATCCGACGTCACAAAGAGCGAACTCCACTACTTCTGGCGCCGCCTCACCGACCCGTGCCCCGACTCCAAAATC
CAGATCTTCTTCGACTT
GTGCGACCGAAATATGGATGGGATAGTTAGCCGGCGCGACGTCAAGCAGGTGATCTTGATGAGTGCTGGCGCGAACAAGGTGAGCTTGACCGGCGAGGAGGTG
GACGAGTACGCCGCGCTGATCATGGCCGCCGTCGGCTCGGGAGATGGAGGTTACATAGAG
ATATCTCAAGTGGAGACGCTGCTGAAGCTCGGGTTGTCGAAGGACTCTTCCGCCACTGCC
CCGTCGCCGAGGCTGTGCTACCGCGGGGGCTGGGACTCGGATGGGGTGGTCGGGCGGCCCATGTCGACGCTGGAGGTCTTGTTCCGGAGCTACTGGCGACGGGCGTGGATCGTGGCCCTC
TGGCTGGCGATTTGCGTCGCGCTGTTCACGTGGAAGTTCATTCAGTATAGGCATAGGACGGCGTTCGAGGTCATGGGCTACTGCCTTTGCACCGCCAAAGGGGCTGCCGAGACCCTCAAG
TTCAACATGGCCGTGATTCTCCTCCCCGTCTGCCGGAACACGGTCACGTGGCTCCGCGCCAGCCGCCGGGTCAGCTCGATCGTCCCCTTCAACGATAACATCAACTTTCACAAG
TTGATC
GCAGCTGGGATCGTGATCGGGGTGATCCTCCATGGCGGCACCCACCTGGCGTGCGACTTCCCTCGGATCAGTAGCTCGGATCACTCGATCTTCCGCCAGACGATTGCCGCAGGGTTCGGC
TACCATCAGCCATCGTATCTCCAGATCCTGGCCACGACGGAGGTGGCAACAGGGATCGCAATGGTGGTCCTTATGGCAATCGCGTTCTCCCTCGCGACAAGGTGGCCAAGGCGCCAGGCC
CCGCCACTGCCCCGGTCAGTCCGGCAGGTCACGGGGTACAACACCTTCTGGTACTCACACCACCTCTTCGTCTTCGTGTACGCACTGTTGATCGTGCACTCCATGTTCCTCTTCCTGACC
AGCAACCTAATAGAAAAGACG
ACATGGATGTATATCGCCTTTCCAGTGCTGCTGTACACGGGAGAGAGGATCTTTCGGGCTGTCAGATCGGCATTTTATGAGGTGGAGATACTGAAGGCA
AATGTGTATCCAGGAAAGGTTTTGTCCCTGACAATTAGCAAGCCCGAAGGCTTTGAGTACAGAAGTGGAATGTATATATACATTCAATGCTCTCGAATATCACCCTTCGAATG
GCACCCG
TTTTCATTGACTTCTGGACCAGATGAAGGTCACTTGAGTGTGCACATTAGGACACTTGGAGACTGGAGTTATCAATTATACAGTCTCTTCCAAGAG
GCAACTGTGGCAAGAACAGCTAGC
TATCCCAAAATGTACATCGACGGGCCTTACGGTGCAGCCTCTCAGGACTATGTCAAGTACGACGTCGTGGTTCTGGTTGGCCTCGGAATAGGAGCAACGCCATTTATCAGCATTCTTAAG
GATGTCGTCGGTTGCGATCAT
GTGGATGGCGGAGAAGTCAGCATTCCGAAGGGTCCAGCGAAAGCCTATCTGTACTGGGTTACGAGGGATCAGAGCTCCTTTGCCTGGTTCAGGGATTTC
ATCAAGCAGATATCGAAGAGCAACCGGAAAGAG
TCGATTATGGAGATGCACAACTTCCTGACCTCGATGTACAAGGAGGAGGATGCGCGGTCGGTGTTACTAAGCACCATTCAAGCTCTG
TCTCATGCCAAGAGTGGCGTCGACTTCATCTCTCAGACCCCG
GTGCATACTCATTTTGCCAGACCAAATTGGTCCAGCATTTTCTCCAAGTTGTCCCGAAGGCACGGCGGTTCCCAGATT
G
GGGTGTTCTATTGTGGTCCTTCAGCATTAGCAAGAGAATTGGAGGAGTTGTGCACCAAATTCTCCACCAAAACCATCACAAGATTTGTGTTCCATAAGGAGCATTATTGA

Retrieve as FASTA