Entry information : AtaPrx11-1D
Entry ID 13521
Creation 2015-12-15 (Qiang Li)
Last sequence changes 2016-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2017-10-25 (Christophe Dunand)
Peroxidase information: AtaPrx11-1D
Name AtaPrx11-1D
Class Class III peroxidase    [Orthogroup: Prx058]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Aegilops
Organism Aegilops tauschii    [TaxId: 37682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtaPrx11-1D
start..stop
S start..stop
TaPrx11-1D 728 0 1..362 1..362
TurPrx11-A 671 0 1..362 1..361
HvPrx123 602 0 21..362 30..371
BdiPrx112 511 0 13..329 13..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 307..495 189 N° 3 1019..1699 681  
join(1..219,307..495,1019..1699)


exon

Literature and cross-references AtaPrx11-1D
Literature Jia,J. et al., International Wheat Genome Sequencing Consortium. The Aegilops tauschii draft genome sequence reveals gene repertoire for wheat adaptation. Unpublished
Protein ref. GenBank:   EMT27564.1
DNA ref. GenBank:   KD510993.1 (112925..108824) [Incorrect splicing]
Protein sequence: AtaPrx11-1D
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (336)
PWM (Da):   %s   37366.9 (34942.6)  
PI (pH):   %s   6.76 (6.76) Peptide Signal:   %s   cut: 27 range:27-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPRSAAVAVVAVAATLLALCGSTEAHAQLGAYNKTCPQAEDIVFKEMTAVLAKSPGLAGSLLRLFSVDCLLGGCEGSILLDSTANNTAEKDSPLNKGLRGYDVVDSIKAKLEAACPGVVSCADVLALAARDSVRISKGPYIPMPTGRQDGNRSSAADVAPNTPKPGANVTDLIALFARFNLTAKDLAVLSGAHTIGKAHCSAFSPRLYNFTTTNSNASDPTLDANYTGTLRGQCRAGDLATLVDLDPGSGTTFDLGYYRDVAASRGLLSTDAALLLDGDTRAYVMRQANATAPDEFFADFAASFVNMSKIGVLTHHKGEVRRQCSAVNPPSASSLAPVTMSAHAVLLASCFVSIVTMALVL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns1 and 2) and ESTs. Contains SVDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCGAGGTCAGCAGCTGTAGCGGTCGTCGCGGTGGCGGCGACGCTCCTTGCCCTGTGTGGCTCGACGGAGGCCCACGCGCAGCTCGGGGCGTACAACAAGACGTGCCCGCAGGCG
GAGGACATCGTGTTCAAGGAGATGACCGCCGTCCTCGCCAAGTCGCCCGGCCTCGCCGGCTCCCTGCTCAGGCTCTTCTCCGTCGACTGCTTGCTCGGA
GTAAGTAAAGCTCGCACAAAC
CCAGCTGTTGCTATTGATAGCTAGGCAAGTCGAGCTCACAATAGTGACTGGATTCACTGCGCGCAGGGCTGCGAGGGGTCGATTCTTCTCGACTCCACGGCCAACAACACGGCGGAGAAG
GACTCGCCGCTCAACAAGGGCCTCCGCGGCTACGACGTCGTCGACTCCATCAAGGCAAAGCTCGAGGCGGCCTGCCCCGGCGTCGTCTCCTGCGCCGACGTGCTCGCCCTCGCCGCGCGC
GACTCCGTGCGGATC
GTACGTCGTCTCACCCACCTACTTCCTCGAAAATATAAAATAAAACAGCTGCACCCCGGCCCTCTCTATTTAGCCATCCATTCTGCGCATCGCGATTCATGCAAA
TACATTTCTCTTTTTTTTCTCCCACATAAAACATATTTTGAAGTTCAAACCTTTGCAGCGTAGCAAAATTTTCTATCTAGAATCTAGGATAAATCTTTCAGATTTTTTTGTCAAATATAA
ATATACAAAATGTTTGACAAAAAATTCTGAAAGATTTATCATAGATTCTAGATGGAAAGCTTTGCCACGCTGCAAAGGTTTGAACTTCAAGACATCTTTTATGTGAGAGAAATAAAAAAG
AAAAATTTTCATACGGAAAGTTAGTTGTGTTGCACAAATATTAAAGCAATATTGGACAGTCAGAATACCAGGGCCGGGGTGCAGCTGTTCTAAAAATCCACGTCCCCTACTTCCTTCAGT
ATCGGTTGCATCACCGACCTTGCATTGCATTGATCTTGATCTTCTCTGTATCTGCTAGAGCAAGGGACCGTACATCCCGATGCCGACGGGGCGGCAGGACGGGAACAGGTCGTCCGCCGC
CGACGTCGCCCCCAACACCCCCAAGCCGGGCGCCAACGTCACCGACCTCATCGCCCTCTTCGCCAGGTTCAACCTCACCGCCAAGGATCTCGCCGTGCTCTCCGGCGCGCACACCATCGG
CAAGGCTCACTGCTCCGCCTTCTCCCCTCGCCTCTACAACTTCACCACCACCAACAGCAACGCCTCCGACCCCACGCTTGACGCCAACTACACGGGGACGCTCCGCGGCCAGTGCAGGGC
CGGCGACCTCGCTACCCTGGTCGACCTCGACCCTGGCAGCGGCACCACGTTCGACCTCGGGTACTACAGGGACGTCGCCGCGAGCAGGGGGCTCCTCTCCACCGACGCCGCGCTGCTCCT
CGACGGAGACACCAGGGCCTACGTGATGCGCCAGGCGAATGCCACCGCGCCCGACGAGTTCTTCGCCGATTTCGCCGCGTCCTTCGTCAACATGAGCAAGATCGGCGTGCTGACGCACCA
CAAGGGCGAGGTAAGGAGGCAGTGCTCTGCCGTCAACCCGCCGTCGGCCTCCTCCTTGGCGCCTGTCACCATGAGTGCGCACGCCGTGCTACTCGCGAGCTGTTTCGTCTCCATCGTTAC
CATGGCGCTTGTGCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCGAGGTCAGCAGCTGTAGCGGTCGTCGCGGTGGCGGCGACGCTCCTTGCCCTGTGTGGCTCGACGGAGGCCCACGCGCAGCTCGGGGCGTACAACAAGACGTGCCCGCAGGCG
GAGGACATCGTGTTCAAGGAGATGACCGCCGTCCTCGCCAAGTCGCCCGGCCTCGCCGGCTCCCTGCTCAGGCTCTTCTCCGTCGACTGCTTGCTCGGA
GGCTGCGAGGGGTCGATTCTT
CTCGACTCCACGGCCAACAACACGGCGGAGAAGGACTCGCCGCTCAACAAGGGCCTCCGCGGCTACGACGTCGTCGACTCCATCAAGGCAAAGCTCGAGGCGGCCTGCCCCGGCGTCGTC
TCCTGCGCCGACGTGCTCGCCCTCGCCGCGCGCGACTCCGTGCGGATC
AGCAAGGGACCGTACATCCCGATGCCGACGGGGCGGCAGGACGGGAACAGGTCGTCCGCCGCCGACGTCGCC
CCCAACACCCCCAAGCCGGGCGCCAACGTCACCGACCTCATCGCCCTCTTCGCCAGGTTCAACCTCACCGCCAAGGATCTCGCCGTGCTCTCCGGCGCGCACACCATCGGCAAGGCTCAC
TGCTCCGCCTTCTCCCCTCGCCTCTACAACTTCACCACCACCAACAGCAACGCCTCCGACCCCACGCTTGACGCCAACTACACGGGGACGCTCCGCGGCCAGTGCAGGGCCGGCGACCTC
GCTACCCTGGTCGACCTCGACCCTGGCAGCGGCACCACGTTCGACCTCGGGTACTACAGGGACGTCGCCGCGAGCAGGGGGCTCCTCTCCACCGACGCCGCGCTGCTCCTCGACGGAGAC
ACCAGGGCCTACGTGATGCGCCAGGCGAATGCCACCGCGCCCGACGAGTTCTTCGCCGATTTCGCCGCGTCCTTCGTCAACATGAGCAAGATCGGCGTGCTGACGCACCACAAGGGCGAG
GTAAGGAGGCAGTGCTCTGCCGTCAACCCGCCGTCGGCCTCCTCCTTGGCGCCTGTCACCATGAGTGCGCACGCCGTGCTACTCGCGAGCTGTTTCGTCTCCATCGTTACCATGGCGCTT
GTGCTCTAG

Retrieve as FASTA