Entry information : VbraAPx01
Entry ID 13536
Creation 2016-02-29 (Mbadinga)
Last sequence changes 2016-02-29 (Christophe Dunand)
Sequence status complete
Reviewer Mbadinga
Last annotation changes 2016-02-29 (Mbadinga)
Peroxidase information: VbraAPx01
Name VbraAPx01
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Alveolata; Other Alveolata; Other Alveolata; Other Alveolata
Organism Vitrella brassicaformis    [TaxId: 1169539 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VbraAPx01
start..stop
S start..stop
GtAPx02 337 8e-115 77..364 68..364
SsAPx04_AU1 336 7e-114 36..365 45..352
SmAPx04-2_36 332 2e-112 60..365 56..341
SmAPx04-1_7 331 5e-112 60..365 56..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 191770..192030 261 N° 2 191608..191713 106 N° 3 191418..191537 120 N° 4 191199..191308 110
N° 5 190836..191139 304 N° 6 190542..190738 197  
complement(join(190542..190738,190836..191139,191199..191308,191418..191537,1916 08..191713,191770..192030))


exon

Literature and cross-references VbraAPx01
Protein ref. GenBank:   CEM29166.1
DNA ref. GenBank:   CDMY01000666.1 (192030..190542)
Protein sequence: VbraAPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366
PWM (Da):   %s   39713.57  
PI (pH):   %s   4.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACVSAFSLQRITHNGPSSLRRSAQRLHPSPASPLSFSLSRADSGALLVLRAEEESKGSQAVAVKDGEGDELAVRKEELLKCRDALRDLIDETAAFGILIRAAWHDAGTYDAKKEGEWPKKGGANGSIRFPEETSHAANAGLDNAIKLLQPIKDRFQSVSWADILQMASAVAIEMAGGPKIAMQYGRVDVDSPEDCPKGNLPDGAAPFGDGAETPAQHLRNVFYRMGLDDQEIVALSGAHTVGRAWKNRSGFGRGEEGTNYTTGEHTDLRQDGKGYYGKEGGMSWTPRWLLFDNSYFTAVNADDDPELLKLQTDTCLFADEAFRPYALKYADSQEAFFADYSAAHKKLSELGSKFDPPEGITLD

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGCGTGTCCGCTTTCTCTCTCCAGCGTATTACACACAACGGTCCCTCATCGCTACGACGCTCGGCGCAACGATTGCATCCATCGCCGGCCAGCCCGCTGTCTTTTTCATTGAGT
AGGGCTGATAGTGGTGCCTTGCTGGTGTTGCGGGCGGAGGAAGAGAGCAAGGGCAGTCAGGCGGTGGCTGTCAAGGACGGGGAAGGCGATGAGTTGGCAGTGAGGAAAGAGGAGCTGCTC
AAGTGCCGCGACGCTTTGAGG
GTAGGTCAGTGAGTGCTGCGTGTTCAAGTGATGAATGCATCTTTGCTTCCTTGCAGGACCTCATTGACGAGACCGCTGCTTTTGGCATTCTCATCCGGG
CGGCGTGGCATGACGCAGGCACCTACGACGCCAAAAAGGAGGGCGAATGGCCGAAGAAAGGAG
GTACCCACAGACACAATGAATCTGCGTGTCCTGGCTGCATGAGCGCGAGTGTATTGG
TGGGTGTGTGCAGGTGCGAATGGCAGCATTCGTTTCCCGGAGGAGACCTCCCATGCGGCCAACGCTGGCCTCGACAACGCCATCAAGCTGCTGCAGCCAATTAAGGACAGATTCCAATCC
GTCAGCTGGGCTG
GTGTGTACGGAAGCACGCACACCACGTGTGTGTATCACGAACACAAGTGGACATCCTCGTTTCCCTTTTCGGTCGCTACCGTCGCAGTCATGTTTGTGTTGTTGCTC
AGACATTCTGCAGATGGCCTCTGCTGTGGCGATAGAGATGGCTGGCGGCCCGAAGATTGCGATGCAATACGGTAGAGTAGACGTCGACAGCCCTGAAGACTGCCCCAAAGAGGTGAGGAA
CAAGAACACACACACATCATTTTCCGCCCGATCGTCTGTGTGTTCGTGCAGGGCAACCTTCCCGACGGCGCAGCGCCGTTTGGCGATGGCGCCGAAACACCCGCCCAGCACCTGAGGAAC
GTCTTTTATCGGATGGGCCTTGATGACCAAGAGATTGTGGCGCTCAGCGGTGCTCACACCGTCGGGCGGGCGTGGAAAAACAGATCTGGCTTTGGCAGGGGCGAGGAAGGGACCAACTAC
ACCACTGGCGAGCACACAGACTTGCGACAAGACGGCAAGGGCTACTACGGGAAGGAGGGTGGCATGTCGTGGACACCGCGGTGGCTGCTCTTCGACAACTCTTACTTCACAGCAG
GTAGG
GCAGGAAGGGAGATGGATGCAAGTGGGTCGATGTGATCTCTCTCTTTCTCTTCCTCTCTCTCTGTGGATGTGTCTTCCCCTATCCCCTTCAGTGAATGCTGATGACGACCCGGAGCTGCT
CAAGCTCCAGACAGACACGTGTCTGTTCGCTGATGAGGCCTTCCGACCGTATGCGCTGAAGTACGCCGACAGCCAAGAGGCCTTCTTCGCTGACTATTCCGCCGCACACAAGAAGCTCTC
AGAGCTGGGCAGCAAGTTTGATCCTCCAGAAGGCATCACGCTGGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGCGTGTCCGCTTTCTCTCTCCAGCGTATTACACACAACGGTCCCTCATCGCTACGACGCTCGGCGCAACGATTGCATCCATCGCCGGCCAGCCCGCTGTCTTTTTCATTGAGT
AGGGCTGATAGTGGTGCCTTGCTGGTGTTGCGGGCGGAGGAAGAGAGCAAGGGCAGTCAGGCGGTGGCTGTCAAGGACGGGGAAGGCGATGAGTTGGCAGTGAGGAAAGAGGAGCTGCTC
AAGTGCCGCGACGCTTTGAGG
GACCTCATTGACGAGACCGCTGCTTTTGGCATTCTCATCCGGGCGGCGTGGCATGACGCAGGCACCTACGACGCCAAAAAGGAGGGCGAATGGCCGAAG
AAAGGAG
GTGCGAATGGCAGCATTCGTTTCCCGGAGGAGACCTCCCATGCGGCCAACGCTGGCCTCGACAACGCCATCAAGCTGCTGCAGCCAATTAAGGACAGATTCCAATCCGTCAGC
TGGGCTG
ACATTCTGCAGATGGCCTCTGCTGTGGCGATAGAGATGGCTGGCGGCCCGAAGATTGCGATGCAATACGGTAGAGTAGACGTCGACAGCCCTGAAGACTGCCCCAAAGAGGGC
AACCTTCCCGACGGCGCAGCGCCGTTTGGCGATGGCGCCGAAACACCCGCCCAGCACCTGAGGAACGTCTTTTATCGGATGGGCCTTGATGACCAAGAGATTGTGGCGCTCAGCGGTGCT
CACACCGTCGGGCGGGCGTGGAAAAACAGATCTGGCTTTGGCAGGGGCGAGGAAGGGACCAACTACACCACTGGCGAGCACACAGACTTGCGACAAGACGGCAAGGGCTACTACGGGAAG
GAGGGTGGCATGTCGTGGACACCGCGGTGGCTGCTCTTCGACAACTCTTACTTCACAGCAG
TGAATGCTGATGACGACCCGGAGCTGCTCAAGCTCCAGACAGACACGTGTCTGTTCGCT
GATGAGGCCTTCCGACCGTATGCGCTGAAGTACGCCGACAGCCAAGAGGCCTTCTTCGCTGACTATTCCGCCGCACACAAGAAGCTCTCAGAGCTGGGCAGCAAGTTTGATCCTCCAGAA
GGCATCACGCTGGACTGA

Retrieve as FASTA