Entry information : HaPrx30 (HanXRQChr16g0501451)
Entry ID 13550
Creation 2016-04-25 (Christophe Dunand)
Last sequence changes 2016-04-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx30 (HanXRQChr16g0501451)
Name (synonym) HaPrx30 (HanXRQChr16g0501451)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx30
start..stop
S start..stop
LsaPrx30 524 0 79..387 49..357
HaPrx02 516 0 26..387 1..356
VvPrx89 513 0 29..387 6..352
GmPrx296 510 0 36..387 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13996947..13997339 393 N° 2 13997444..13997635 192 N° 3 13997735..13997900 166 N° 4 13998218..13998630 413
join(13996947..13997339,13997444..13997635,13997735..13997900,13998218..13998630 )


exon

Literature and cross-references HaPrx30 (HanXRQChr16g0501451)
DNA ref. HanXRQ genome:   HanXRQChr16 (13996947..13998630)
Protein sequence: HaPrx30 (HanXRQChr16g0501451)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   387
PWM (Da):   %s   41618.2 Transmb domain:   %s   i27-49o
PI (pH):   %s   4.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLTLYKDQFLACSIPCNLFSQVGSSMASLLYTTLMLIALISSPAICLAFPGFSFGWGVGSGSGGGEGSFGSSGDEPFGGGQGYPGLFPEFYSLSCPQANDIVMSVLESAIAKDPRMAASLLRLHFHDCFVQGCDASVLLDDSAMFASEKNSGPNSNSIRGFEVIDEIKSKLEEACPETVSCADILALAARGSTVLSGGPNWELPLGRRDAMQASLNGANNNLPPPNSTIQNLITLFRRQGLDEVDLVSLSGAHSIGMARCTSFKQRLYNQDGNNQPDSTLEMTYYNDLKTVCPQTGGDDNISPLDFESPARFDNTYFKLIMRGKGLLTSDQVLLTGNVEETMFLVKAFTEDDALFFDQFARSMVKMGNINPLIGYNGEVRKNCRMAN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAACTCTTTATAAAGACCAGTTTCTTGCATGCTCCATACCATGCAATCTTTTCTCACAAGTTGGTTCATCAATGGCCTCTCTTCTCTACACTACCTTAATGCTAATAGCTTTGATC
TCTTCCCCCGCGATATGCCTTGCTTTTCCGGGGTTCAGCTTTGGATGGGGTGTTGGCAGTGGTAGTGGCGGTGGAGAAGGGTCTTTTGGTAGCAGTGGAGATGAGCCTTTTGGCGGCGGC
CAAGGGTATCCTGGTCTTTTCCCAGAATTTTACAGTTTGTCATGTCCTCAAGCTAATGACATTGTCATGTCAGTTCTTGAGAGTGCCATTGCTAAAGATCCAAGGATGGCTGCTTCTTTA
CTAAGGCTTCATTTTCATGATTGCTTTGTTCAG
GTAATTAGTGACTACATTAGTTTATTCATGACACATTATGTTACACATTGATTTATATGGAATTTGGATTAATTTGTGAAACTGATA
GGTTTGTTTCATCTCAGGGATGTGACGCATCTGTCTTGTTGGATGATAGTGCAATGTTTGCAAGCGAAAAGAACTCCGGGCCTAATAGTAATTCGATCAGAGGATTTGAAGTGATCGATG
AGATCAAGTCTAAATTAGAGGAAGCATGTCCTGAGACGGTTTCTTGTGCTGACATTCTTGCCCTTGCGGCTCGAGGTTCCACTGTTCTA
GTAAGCAAAATAACTTCATGTCGTTCTATAA
GTCTAGGTGTTCGATAAACACAAATGATCTGATTAACAAATAAATATTTGCCTGTGATAACATTGTAGAGTGGTGGACCGAACTGGGAATTGCCATTAGGAAGGAGAGATGCAATGCAAG
CAAGTCTAAACGGCGCGAACAACAATCTTCCTCCACCAAACTCCACCATTCAAAACCTTATCACACTTTTCCGGCGACAAGGCCTTGATGAAGTTGACTTGGTCTCTCTTTCTG
GTTAGT
TATAAATCTCATGTCACAACAAAAATATATATATGAAATGAGGAAGGTTAACGTACATTACGGGTTAACGTACGTCACGTACGACAGGTAATTACGCCCATTCATTTTAAAATCACGCAC
GTTATAACTCAAAAATCCAAAATCACGCATGTTGAAACACAATAATCACGCATATTGAAAACATTTATCACGCACGTTGTCGTACGTGAAGTACGTTAAGCTGTAATGTACGATATACTT
TTTCTATATGAAATATTCCCTGATAATTATACAAAGGCATAATAATAGTAATATATTATGCTTTCTTGTAGGAGCTCATAGCATAGGAATGGCTAGATGCACTTCATTTAAGCAAAGGCT
ATACAATCAAGATGGAAACAATCAACCGGATTCAACTCTGGAGATGACCTACTACAATGACTTAAAAACAGTTTGCCCACAAACCGGCGGCGATGACAACATTTCTCCTCTAGATTTTGA
ATCTCCTGCAAGATTTGATAACACATATTTCAAGCTCATAATGCGGGGAAAAGGACTTTTAACTTCTGATCAAGTTCTTTTGACAGGGAATGTTGAAGAAACTATGTTTCTGGTTAAGGC
ATTCACAGAGGATGATGCTCTCTTCTTTGACCAGTTTGCTAGGTCAATGGTTAAAATGGGAAATATCAATCCCCTCATTGGTTATAACGGCGAAGTGAGGAAGAACTGTCGAATGGCTAA
CTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAACTCTTTATAAAGACCAGTTTCTTGCATGCTCCATACCATGCAATCTTTTCTCACAAGTTGGTTCATCAATGGCCTCTCTTCTCTACACTACCTTAATGCTAATAGCTTTGATC
TCTTCCCCCGCGATATGCCTTGCTTTTCCGGGGTTCAGCTTTGGATGGGGTGTTGGCAGTGGTAGTGGCGGTGGAGAAGGGTCTTTTGGTAGCAGTGGAGATGAGCCTTTTGGCGGCGGC
CAAGGGTATCCTGGTCTTTTCCCAGAATTTTACAGTTTGTCATGTCCTCAAGCTAATGACATTGTCATGTCAGTTCTTGAGAGTGCCATTGCTAAAGATCCAAGGATGGCTGCTTCTTTA
CTAAGGCTTCATTTTCATGATTGCTTTGTTCAG
GGATGTGACGCATCTGTCTTGTTGGATGATAGTGCAATGTTTGCAAGCGAAAAGAACTCCGGGCCTAATAGTAATTCGATCAGAGGA
TTTGAAGTGATCGATGAGATCAAGTCTAAATTAGAGGAAGCATGTCCTGAGACGGTTTCTTGTGCTGACATTCTTGCCCTTGCGGCTCGAGGTTCCACTGTTCTA
AGTGGTGGACCGAAC
TGGGAATTGCCATTAGGAAGGAGAGATGCAATGCAAGCAAGTCTAAACGGCGCGAACAACAATCTTCCTCCACCAAACTCCACCATTCAAAACCTTATCACACTTTTCCGGCGACAAGGC
CTTGATGAAGTTGACTTGGTCTCTCTTTCTG
GAGCTCATAGCATAGGAATGGCTAGATGCACTTCATTTAAGCAAAGGCTATACAATCAAGATGGAAACAATCAACCGGATTCAACTCTG
GAGATGACCTACTACAATGACTTAAAAACAGTTTGCCCACAAACCGGCGGCGATGACAACATTTCTCCTCTAGATTTTGAATCTCCTGCAAGATTTGATAACACATATTTCAAGCTCATA
ATGCGGGGAAAAGGACTTTTAACTTCTGATCAAGTTCTTTTGACAGGGAATGTTGAAGAAACTATGTTTCTGGTTAAGGCATTCACAGAGGATGATGCTCTCTTCTTTGACCAGTTTGCT
AGGTCAATGGTTAAAATGGGAAATATCAATCCCCTCATTGGTTATAACGGCGAAGTGAGGAAGAACTGTCGAATGGCTAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAACTC TTTATAAAGA CCAGTTTCTT GCATGCTCCA TACCATGCAA TCTTTTCTCA CAAGTTGGTT CATCAATGGC CTCTCTTCTC TACACTACCT TAATGCTAAT AGCTTTGATC  TCTTCCCCCG CGATATGCCT TGCTTTTCCG GGGTTCAGCT TTGGATGGGG TGTTGGCAGT GGTAGTGGCG GTGGAGAAGG GTCTTTTGGT AGCAGTGGAG ATGAGCCTTT TGGCGGCGGC  CAAGGGTATC CTGGTCTTTT CCCAGAATTT TACAGTTTGT CATGTCCTCA AGCTAATGAC ATTGTCATGT CAGTTCTTGA GAGTGCCATT GCTAAAGATC CAAGGATGGC TGCTTCTTTA  CTAAGGCTTC ATTTTCATGA TTGCTTTGTT CAGGGATGTG ACGCATCTGT CTTGTTGGAT GATAGTGCAA TGTTTGCAAG CGAAAAGAAC TCCGGGCCTA ATAGTAATTC GATCAGAGGA  TTTGAAGTGA TCGATGAGAT CAAGTCTAAA TTAGAGGAAG CATGTCCTGA GACGGTTTCT TGTGCTGACA TTCTTGCCCT TGCGGCTCGA GGTTCCACTG TTCTAAGTGG TGGACCGAAC  TGGGAATTGC CATTAGGAAG GAGAGATGCA ATGCAAGCAA GTCTAAACGG CGCGAACAAC AATCTTCCTC CACCAAACTC CACCATTCAA AACCTTATCA CACTTTTCCG GCGACAAGGC  CTTGATGAAG TTGACTTGGT CTCTCTTTCT GGAGCTCATA GCATAGGAAT GGCTAGATGC ACTTCATTTA AGCAAAGGCT ATACAATCAA GATGGAAACA ATCAACCGGA TTCAACTCTG  GAGATGACCT ACTACAATGA CTTAAAAACA GTTTGCCCAC AAACCGGCGG CGATGACAAC ATTTCTCCTC TAGATTTTGA ATCTCCTGCA AGATTTGATA ACACATATTT CAAGCTCATA  ATGCGGGGAA AAGGACTTTT AACTTCTGAT CAAGTTCTTT TGACAGGGAA TGTTGAAGAA ACTATGTTTC TGGTTAAGGC ATTCACAGAG GATGATGCTC TCTTCTTTGA CCAGTTTGCT 
AGGTCAATGG TTAAAATGGG AAATATCAAT CCCCTCATTG GTTATAACGG CGAAGTGAGG AAGAACTGTC GAATGGCTAA CTAA 

Retrieve as FASTA