Entry information : HaPrx31 (HanXRQChr07g0196851)
Entry ID 13551
Creation 2016-04-25 (Christophe Dunand)
Last sequence changes 2016-04-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx31 (HanXRQChr07g0196851)
Name (synonym) HaPrx31 (HanXRQChr07g0196851)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx31
start..stop
S start..stop
LperPrx22 517 0 1..322 1..322
LvPrx22-1 514 0 1..328 1..327
LsaPrx22 514 0 1..328 1..327
LsPrx22 457 7e-164 1..299 1..298
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68835261..68835473 213 N° 2 68834785..68834967 183 N° 3 68834553..68834718 166 N° 4 68833725..68834149 425
complement(join(68833725..68834149,68834553..68834718,68834785..68834967,6883526 1..68835473))


exon

Literature and cross-references HaPrx31 (HanXRQChr07g0196851)
DNA ref. HanXRQ genome:   HanXRQChr07 (68835473..68833725)
Protein sequence: HaPrx31 (HanXRQChr07g0196851)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35838.09 (33153.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.34 (6.98) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTSNNISFAWFVIISMLCLLANSQLTTDFYSKTCPNLRTIVRDQIIKVIKTEPRMAASLLRLHFHDCFVNGCDASILLDGADGEKFALPNINSARGFEVVDSIKSVVESSCSGVVSCADILAVAARYSVVFSGGRRYDVPLGRRDGLVANQTGANLMLPAPFETLGNITRKFEAVGLNITDVVILSGAHTFGKASCATFRNRLFNFSGTSAPDSTLLDSNMVSVLQNLCPVNGDGRQTTALDWNSTENFDNHYFRNLVNGRGLLESDQVLYSSDEAISTTRSLVELYSKNWQIFLDDFKHSMVKLGNIQPLTGSSGEIRKNCRVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCTCAAACAACATTAGTTTTGCATGGTTTGTAATCATCTCAATGTTGTGTTTGCTTGCAAATTCTCAACTAACAACAGATTTCTACTCAAAGACATGTCCTAATCTTCGCACC
ATCGTACGTGACCAAATTATTAAGGTGATTAAAACTGAACCAAGAATGGCAGCTTCTTTGCTTCGGCTTCACTTCCATGATTGTTTTGTAAAT
GTAAGTCCTGCTCTAACTTCTAATCAA
TAATATATATAACCTTCAAGGAGGCGGCGTTGTGGTAATTCCCTTTAATTGTTTTTTTATTAATCTCTTGAAGGTCACCTGTCCATCACAAGTTGCGTTTAACAATATGTTCTCATGGGT
TAGCAGGGTATTGGTGGGCACTTTGTTTTTGTTCTCATGGTTATATAAAATATGAAAATAAAAATAAGTACATACATACATATTTGATATCAATTATCTAGACATGCATGTGTTGCTCTA
TCATTTGCAATATTTCAAGTAATCAGGGATGTGATGCATCGATCTTACTCGATGGAGCCGACGGAGAGAAGTTTGCTTTACCAAACATCAATTCGGCTCGGGGATTTGAGGTGGTGGATT
CGATCAAAAGTGTTGTGGAAAGTTCATGCAGTGGAGTAGTTTCTTGTGCTGATATTCTGGCTGTAGCCGCTCGTTATTCAGTTGTCTTT
GTAAGCATCATGAATATATACTTGAAAATGA
AAACCGACCCAAAAACTAACCAGAAATGTTTTCAGAGTGGAGGACGACGATATGACGTGCCACTAGGAAGAAGAGATGGACTTGTGGCAAACCAAACCGGGGCTAACCTAATGTTACCTG
CACCCTTTGAGACTCTGGGTAACATTACTCGCAAGTTTGAAGCCGTGGGCCTCAATATCACTGATGTCGTCATACTTTCAG
GTTTGATAAAAAAAAATTGTTGGATCTGATACCAAATGG
GTGTTGTTAAAGATACACTACCCCTATCAGTCTACGCTAGCCCACATGTCACATCATATGGGCCATGTGACACGGTGAAAAAAGTTCGTACATGCCATATTGGTTTGCTAGTGGTCACGT
TAAGTCTTTGTTTGTCACATCAGTCAATTTTTTATCGGTCTATATATCATATAGGTTGTATGATTGGCCCTCATACGATTAACGTGGCCATTTTTTGTTCCATGTCATACGGCCCATATG
ACCATTTTATCCATGCCATATGGGCTCGTATGACACGTGAGTGGTGTATGAATTGTTTTTTATATGTTTAGAACAAAAAGTGGTTAAATGATAAAAATCATTTTTATATTTGAACCCTGT
GTAGGTGCACATACATTTGGGAAAGCAAGTTGCGCAACATTTAGAAACAGATTATTCAACTTCTCTGGAACGAGTGCACCTGATAGTACGTTACTTGACTCGAATATGGTATCGGTTCTA
CAAAATCTGTGTCCGGTGAATGGAGATGGTAGGCAAACAACAGCTCTTGACTGGAACTCGACTGAGAATTTTGACAACCATTACTTTCGAAACTTGGTCAACGGGCGTGGACTTCTTGAA
TCTGATCAAGTGTTGTATTCGAGTGATGAGGCTATCTCAACTACACGAAGTCTTGTTGAGCTCTACAGCAAAAACTGGCAGATTTTCTTGGATGATTTTAAGCATTCCATGGTGAAACTG
GGGAATATTCAACCACTTACAGGATCTTCTGGTGAGATTAGGAAGAATTGCAGGGTTGTTAATTCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCTCAAACAACATTAGTTTTGCATGGTTTGTAATCATCTCAATGTTGTGTTTGCTTGCAAATTCTCAACTAACAACAGATTTCTACTCAAAGACATGTCCTAATCTTCGCACC
ATCGTACGTGACCAAATTATTAAGGTGATTAAAACTGAACCAAGAATGGCAGCTTCTTTGCTTCGGCTTCACTTCCATGATTGTTTTGTAAAT
GGATGTGATGCATCGATCTTACTCGAT
GGAGCCGACGGAGAGAAGTTTGCTTTACCAAACATCAATTCGGCTCGGGGATTTGAGGTGGTGGATTCGATCAAAAGTGTTGTGGAAAGTTCATGCAGTGGAGTAGTTTCTTGTGCTGAT
ATTCTGGCTGTAGCCGCTCGTTATTCAGTTGTCTTT
AGTGGAGGACGACGATATGACGTGCCACTAGGAAGAAGAGATGGACTTGTGGCAAACCAAACCGGGGCTAACCTAATGTTACCT
GCACCCTTTGAGACTCTGGGTAACATTACTCGCAAGTTTGAAGCCGTGGGCCTCAATATCACTGATGTCGTCATACTTTCAG
GTGCACATACATTTGGGAAAGCAAGTTGCGCAACATTT
AGAAACAGATTATTCAACTTCTCTGGAACGAGTGCACCTGATAGTACGTTACTTGACTCGAATATGGTATCGGTTCTACAAAATCTGTGTCCGGTGAATGGAGATGGTAGGCAAACAACA
GCTCTTGACTGGAACTCGACTGAGAATTTTGACAACCATTACTTTCGAAACTTGGTCAACGGGCGTGGACTTCTTGAATCTGATCAAGTGTTGTATTCGAGTGATGAGGCTATCTCAACT
ACACGAAGTCTTGTTGAGCTCTACAGCAAAAACTGGCAGATTTTCTTGGATGATTTTAAGCATTCCATGGTGAAACTGGGGAATATTCAACCACTTACAGGATCTTCTGGTGAGATTAGG
AAGAATTGCAGGGTTGTTAATTCATAG

Retrieve as FASTA