Entry information : HaPrx32 (HanXRQChr01g0001191)
Entry ID 13553
Creation 2016-04-27 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx32 (HanXRQChr01g0001191)
Name (synonym) HaPrx32 (HanXRQChr01g0001191)
Class Class III peroxidase    [Orthogroup: Prx199]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx32
start..stop
S start..stop
LsaPrx24 505 0 8..307 1..298
LsPrx24 473 1e-169 8..290 1..281
FvPrx01 474 6e-169 22..350 18..347
PtPrx67 472 2e-168 37..350 33..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3644486..3644746 261 N° 2 3641991..3642188 198 N° 3 3640964..3641584 621  
complement(join(3640964..3641584,3641991..3642188,3644486..3644746))


exon

Literature and cross-references HaPrx32 (HanXRQChr01g0001191)
DNA ref. HanXRQ genome:   HanXRQChr01 (3644746..3640964)
Cluster/Prediction ref. HanXRQ:   HanXRQChr01g0001191
Protein sequence: HaPrx32 (HanXRQChr01g0001191)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359
PWM (Da):   %s   38945.95 Transmb domain:   %s   i7-29o
PI (pH):   %s   8.01
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASKITVMPFHTVAVSVGVLVVIMALHLQGLEAQQQPLVKGLSWKYYESSCPKLESIIRKQMEKVIKKDVGLAAALLRLHFHDCFVQGCDGSVLLDGSASGPVDSEKTAPPNLSLKGFDVIEDLRRRVHKQCGAGSVSCSDITAIVARDAIVLTGGPDYSVPLGRRDGLSFATRNATLANLPSPFVGTDSLLTSLAAKNFDATDAVALSGAHTIGVAHCPSFTRRLYPTQDATMDKTLANTLKGVCPTQNTNATTFLDLRSPNVFDNKYFVDLMNKQGILTSDQDLYTDKRTREIVKSFAVNQTLFFEKFVNVMVKMGQMQVLTGTKGEIRNTCNKRNSNELVISNIVEDHNTDGVENL*

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTAAAATTACAGTAATGCCCTTTCACACAGTTGCAGTGAGTGTGGGTGTGTTGGTGGTGATCATGGCACTGCATTTGCAGGGTTTAGAAGCACAACAACAGCCATTGGTGAAG
GGGCTTTCTTGGAAATACTATGAAAGTAGCTGTCCAAAATTGGAATCAATAATTAGGAAGCAAATGGAGAAGGTGATCAAGAAGGATGTTGGTCTTGCTGCTGCTCTCTTGAGACTTCAT
TTTCATGATTGTTTTGTTCAG
GTATAAATTAACCTTTAACTTTTAGTATTTTACTACTCAAATAAAGGTCATTGAATCTTTTAAAGCCAAGTTTAAAGTTTAGTCGCTGTGGCTTATTTT
GTCAGTTTAATTCAAAGGTTTCATTTTTCGCCTATGGGTTCAAAAAGTTTTCACCGTTGCCATTTTAATCCACTGGATTAACTTCATCCATTTTTTCTGTTAACAAGAAGGGTAATTCGG
TTATTTTCTAAGTAATTCTCTTACCTTTGGTTGTCTGGCCCCTGTGGCGTCCGGTTTCTTGAAGCGGGTTCAAAAGGCAGCACTTGCACATGCGACAGTGTCTGTAGGCCATAGTTATGT
GTTTAGCCGAGTAGGATTTGCAATTCAAAAGGGGGTGGCGGCGCAGCTTGTTGCCCGTCTACCAACCCATGATTTGTAATTTGCTCTAACCTTCTAACTAACATCTAAATATCAAAATGA
TCGAATTGCTATTCTCGATAACATAAAAAATGAATGAAGTTAACCAAGTGGACGAAAATGACAATGGTGAAAACTTTTTGGACCCGCAGGCGAAAAATGAAACATTCGGACTAAACTGTC
AAAATGGCCCAACCACAAGGACTAAAATGACATTTAACTCAAAATACAAAGTCTCCTATAAATAATAAGTCGTAAAAAGGGTATCGAATTCACTCTGATTGACCTAATTTAAGCAACATG
GAACCGTCAAATCAAACTCTACGGTATAATATTTTAGGTTTTCACTTTAGGATTTGTAGTCTGTAGATGTTAGAATTTTTGTTTATGTTATTGTGTCTTTTCTATATTTGCGTCATTCTG
TCTTTTTTTCTCGACATTGTATTATATTTTGCTTGATATTATGTTATATTTTAAGATCCATTGTGTCTCTGTACACTTCTTAGATTTAAAAGTCTGCTCGATAATTTTACTCAATAGAAT
ATATTTGATAAAAAGTTAATTTGTCACACACTTTCGAGTACAAAAATAATCAAACGAGTTGGTATACTTTTTATCTTTAAAACCACGTTGATGTAGATCTAAACTTTAATGATAACTCAT
GAACAAAAACAGGTCACCTTTGTAAGTGGAAATAATAGTAAGGAATAGGGGTGAGCAAGTTTAGGTCCGGACCAAAAATAACCGAGAACTGAACCGAAAATATACCCGACCCGAACCCAA
GTACCTAGGTATTTATATCGGTTCCAATTTTTCATATAAAATAGGGTCGGGTCGGGTCGGTTCTCGGTTCTTTTCATGGTGAAACCCGACTTGGACCTATGGACCAGAACCGACCCTATA
TTTAGGGTAGTGAATCGGTTCTGTATTTTATGTTTGATCGGTTCTCAGGTCAGGTCGGGTAATGATCGGATAGGGTCAGGTTTTTCCTTTTGCTCACCCCTAGTAAGGAAAGTTGGCCGA
TGACTCATTACACACGTTGATATAAGATTTTCTTATTTTTAATAATTAATAATTGATTTCCGCATATTTAGGGTGTAGAAAAGTTGATCCGTTTGTGAGCTACTCAAGACTGAATCACTA
AAAACACGAAAGGACCCGAGCTAAAACGAGCTTGTGCCTAAATAAAAGCTTACTTATTAAACGAGCCCAGATTTTTCGTCTAGGCTTAACTAAGCTCGCAAACCTATTATTTATAAAAAT
ATAAAAGTTTCGTTTTTATATAGTAAATATTATTATGAACAAAGTATGATAATTTATCTAAATAACATATATATTGTGTAACATATGCAAAGTAATTATTATAAATATATATAAAAATAA
CTAGATATTTATAATGAATAAAATAATAATAAATGAGTCAAGCTCTAGCTTAGAAAAAATAACGAAACAAGCTCGCTCTTTAGACATAGAGCTTGAAGCTTACCAATCTCCCATAGACTC
ACGAACTAAGCTTGGATGTAAGCGGGTCCAGGCTCATTTCAGCTCTCGACTCGTTGACACCCTTAGACTGTCGCATCTCATCATCAAGTATATATATAATGAAATGTGGGGTTTTCTTTT
GCTTAACATAATGACTAAAGGTTCCCAAGAAGAGATCCCGATAGTTAAGTGATGTACTTCACAACTAAAGAAACTGTATATGTAAATATACATATATAATCAGTGCATCAATTTAAAAAA
AAAAAAAACAAATACATTAGGGGATGATATTGTAATATGTTACTAATTAAGGAAACTTGGAAACAGGAACTGTTCCTAAGGGTCGACGCAAATTGTTATATTAGTATAATGTTTATTTTC
ATAGATTTGATGTTAGTTTAATTGTTAATATTTAACAGGGCTGTGATGGTTCGGTTTTGTTGGATGGATCAGCAAGCGGACCAGTTGATAGCGAGAAAACGGCACCACCAAACCTAAGTT
TAAAGGGTTTTGATGTCATTGAGGATCTTCGTCGTAGAGTTCACAAACAATGTGGTGCGGGTAGTGTCTCGTGTTCTGATATTACTGCTATAGTTGCGCGCGACGCTATTGTCTTG
GTAA
ATCCTCTTATACATCTTTTTTCAATGTTTTTATAAACGGATTGGCCATCAAATCATCTGTTTACTAGTTCACTAGTCATACCAGTCTTAAAAACCGGATGATGTTATAAACAATTTTAAA
TTAAATATACACGTATTAACTATACGAAACTACTTTATAAACAAAACACGAAGTTTGAAGTTGTAAATGAATCGGTAAATGAGTTCTAAAAGATTTTTTTTTCAGTCCAGTTCGTTGGTA
CATCCGGTGCAAATGGACTCAACTGAACCGGTTATGTAATGGTTTTTGTTCTGACCGATCGGTCCAAGTTTGAAAACACGGTTTTTTTTCATAGATTTAAAAGTTACTTACATGTTTATG
TACATTAATATGTATTGTTATGTTATGTTGTACTTTTATTAGACCGGCGGTCCAGACTATAGCGTTCCTCTGGGTCGAAGAGATGGACTCTCATTCGCCACAAGAAACGCAACACTTGCC
AATCTTCCATCACCGTTTGTCGGGACAGACTCGCTACTAACCTCCCTTGCCGCCAAAAACTTTGACGCCACCGATGCTGTAGCCCTATCAGGGGCCCACACCATCGGTGTCGCCCATTGC
CCATCCTTCACGCGACGACTTTATCCTACACAAGATGCGACCATGGATAAAACCCTAGCCAACACCCTCAAAGGCGTTTGCCCAACCCAAAACACGAATGCCACAACTTTCTTGGACCTT
CGCTCTCCAAACGTGTTCGATAACAAGTACTTCGTCGACCTAATGAACAAACAAGGAATCCTAACGTCTGACCAAGATCTTTACACTGACAAACGAACCCGAGAGATTGTCAAGAGCTTT
GCAGTCAACCAAACATTATTTTTCGAGAAATTCGTCAACGTAATGGTGAAGATGGGCCAAATGCAGGTTTTGACCGGCACAAAAGGTGAAATCCGCAACACTTGCAATAAGCGAAACTCA
AACGAATTAGTCATATCAAACATTGTCGAGGACCACAACACGGACGGTGTCGAGAACCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTAAAATTACAGTAATGCCCTTTCACACAGTTGCAGTGAGTGTGGGTGTGTTGGTGGTGATCATGGCACTGCATTTGCAGGGTTTAGAAGCACAACAACAGCCATTGGTGAAG
GGGCTTTCTTGGAAATACTATGAAAGTAGCTGTCCAAAATTGGAATCAATAATTAGGAAGCAAATGGAGAAGGTGATCAAGAAGGATGTTGGTCTTGCTGCTGCTCTCTTGAGACTTCAT
TTTCATGATTGTTTTGTTCAG
GGCTGTGATGGTTCGGTTTTGTTGGATGGATCAGCAAGCGGACCAGTTGATAGCGAGAAAACGGCACCACCAAACCTAAGTTTAAAGGGTTTTGATGTC
ATTGAGGATCTTCGTCGTAGAGTTCACAAACAATGTGGTGCGGGTAGTGTCTCGTGTTCTGATATTACTGCTATAGTTGCGCGCGACGCTATTGTCTTG
ACCGGCGGTCCAGACTATAGC
GTTCCTCTGGGTCGAAGAGATGGACTCTCATTCGCCACAAGAAACGCAACACTTGCCAATCTTCCATCACCGTTTGTCGGGACAGACTCGCTACTAACCTCCCTTGCCGCCAAAAACTTT
GACGCCACCGATGCTGTAGCCCTATCAGGGGCCCACACCATCGGTGTCGCCCATTGCCCATCCTTCACGCGACGACTTTATCCTACACAAGATGCGACCATGGATAAAACCCTAGCCAAC
ACCCTCAAAGGCGTTTGCCCAACCCAAAACACGAATGCCACAACTTTCTTGGACCTTCGCTCTCCAAACGTGTTCGATAACAAGTACTTCGTCGACCTAATGAACAAACAAGGAATCCTA
ACGTCTGACCAAGATCTTTACACTGACAAACGAACCCGAGAGATTGTCAAGAGCTTTGCAGTCAACCAAACATTATTTTTCGAGAAATTCGTCAACGTAATGGTGAAGATGGGCCAAATG
CAGGTTTTGACCGGCACAAAAGGTGAAATCCGCAACACTTGCAATAAGCGAAACTCAAACGAATTAGTCATATCAAACATTGTCGAGGACCACAACACGGACGGTGTCGAGAACCTCTAA

Retrieve as FASTA