Entry information : HaPrx33 (HanXRQChr01g0003401)
Entry ID 13554
Creation 2016-04-27 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx33 (HanXRQChr01g0003401)
Name (synonym) HaPrx33 (HanXRQChr01g0003401)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx33
start..stop
S start..stop
HaPrx65 673 0 21..349 1..329
HaPrx44 673 0 21..349 1..329
HaPrx[P]64 580 0 21..349 1..327
LvPrx01 576 0 26..349 2..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15632686..15632970 285 N° 2 15633036..15633221 186 N° 3 15635921..15636095 175 N° 4 15636205..15636608 404
join(15632686..15632970,15633036..15633221,15635921..15636095,15636205..15636608 )


exon

Literature and cross-references HaPrx33 (HanXRQChr01g0003401)
DNA ref. HanXRQ genome:   HanXRQChr01 (15632686..15636608)
Cluster/Prediction ref. HanXRQ:   HanXRQChr01g0003401
Protein sequence: HaPrx33 (HanXRQChr01g0003401)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349
PWM (Da):   %s   38420.86 Transmb domain:   %s   i21-43o
PI (pH):   %s   9.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNSHIKKYKFTFERLIIFKMAFSKNSFGVFVLQIMVLALLSLHAEGQGLKVGFYEKSCPQAEKIVSTVMSDVMAVAPSLSGPLLRMHFHDCFIRGCDGSVLLDFPTRQSEKFSPPNLSLRGFNIIDKVKLALEKACPGVVSCADIVALVARDVTVATKGPYWEVETGRRDGKVSLFADPINRVTGLPPPFANITLLKQSFAMRGLNTKDLVVLSGGHTIGMSHCSSFENRLYNFTGKGDTDPSMDQNYIARLKLKCKPRDQTTLAELDPGSFLTFDDSYFRLVTKRRGLLESDAALLNDPETRAYLIQSISHGSTFFKDFGVSMVKMGRIGVLTGSQGEVRKVCTKTN

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAATTCACATATCAAAAAATACAAGTTTACTTTTGAAAGACTAATCATCTTCAAAATGGCCTTTTCCAAGAACTCATTTGGAGTTTTTGTACTTCAAATAATGGTTCTAGCACTC
CTCTCTTTACATGCAGAAGGCCAAGGCTTAAAAGTAGGGTTCTATGAGAAATCATGCCCACAAGCCGAAAAGATCGTATCGACGGTCATGAGCGATGTTATGGCCGTGGCCCCCTCTCTT
TCGGGCCCATTGTTGAGAATGCATTTCCACGACTGCTTCATTAGG
GTTTGTAACATTTTATTTTTTAATAAGATTTCAGTTCTCTTCAAATATTAACCTTCTAATTGTAGGGTTGTGACG
GATCGGTTTTGTTGGATTTTCCAACACGGCAATCCGAGAAATTCTCGCCCCCAAATCTCAGCCTAAGAGGGTTTAATATCATTGATAAGGTGAAGTTGGCGTTAGAAAAGGCCTGCCCTG
GTGTAGTTTCTTGTGCTGACATTGTAGCCCTTGTTGCTAGAGACGTTACTGTGGCG
GTAAATTCATCCTCCTTTCAAATCTAATGCTGAAATTGGTTTCATATATAGGCTGTTAATGAGC
TGGGCCGAACCTGAGATCGGCTTGATTAAATGGGGTGGTGGTCCATTAGCAAAGGCAAAACCTTCAGAAACATTGAGATTGGTATTGGGTTCAAGTTTCACTAACAAACGAGAATAAAAA
TAAATTTGCCGTTCAAAAAACGAAGTAAAAAAATTGAAGACTCATGCATGAGCTTGGCTTGTTTCAAGTTTTATAAAGATTAAGCTCACCTTATATACGATTTTTCAATATTATGTATGA
GCTATTTTATAAAAAATTATTTAAAGTTATAATTACTATATTTAACATAATACATGTTATTTAGTCATTTAAAAAAACAAATATGTAAATAGGGGATGGTTCAAATGAAAACCACTTTTA
TTGTGTAAACTCGAAAACTAACTAAAAAAAGGCTAAAAAACACACAATTTTTTTTTCAATTTTTTTTATAAAAATCACTGGTTTTTATATATGAAAAAAAAAATTTGTAGTACACATGTG
TAGTATTCATGTGCACTACAAAAAAAAAAAAAAAATTTTTGAAATTTTTTTTTTTATAAAAAAACTTGCGAAAATTATTATGCAAAAAAAAAAAAAAAAAAAAAAAATTGGTATGTTTTT
TTGGCTTTTTTAGTTAGTTTTCGAGTTTTACAATAACTAGTGGTTTTTATTTGAACCTTCCCCTATGTAAATATGTGTTTAATATATTAAAGGGTAAATTACTTTTTGAGTCCCTGTGTT
TTATAAGTTTTAACCACTTGAGTTCAAAAGCAAAAAGTTTAACGACCTGAGTCCCCATAAGCATTTTCTTTAACCATTTGAGTCCAAATTTCTAACACTGTTAGAAATTTTTGGTTAAGT
ATTGTTAAATGACAAAAATACCCTTATAATTAAAAAAATAAAAAAAAATATATTTCTCTGTTCTCTTATATCCCCTCATCTCTTCATCTTCAATCCCCAAACCTAATTTCACCCCCTTTT
TATCACCCACAACTTCAATATCTGTTGCAACCAACATGGTCAAGAAATCCATGCCGTAGCTACTCCGGCAACCGTCGCAGCCCCACCACCGCCGCCGCCGACATCGCTCGCAACGTGGAT
CATCAGCAGGACGATGATGGCGGTGTTCGGTGTGCAGCAGCAATTCAATGACAGAAGCCACCAATATAGGGCGATGAACATAGGTTCGAGAGAGATGAGAGAACCGAGAATTGTCACAAA
TAGTACATCATAAGTTCTTCACCGGTGGGGTGAAACCGGAACCCAGGTGCGAACGACGTCGGCGGCGGCGGTGGTGGGGCTGCGGCGGCGATGGTGGGGCTGCTGCGGATTTTGTTGGGT
GAATGTATGGTTTTGTTCAAGAAATAGAACTCTTGTTCCCGATCATGTCTATAAATACTCATAAGAATCAAGTATAAAATAATTAATTAATAAATAAATCCCATTACTGTTCTGCTACAA
GAATCCATTAAACCATGTTAAGTAAGAATATACCCAGTTCAGATTGATGGTAAATTATCAACTCAAAATAACATGGACGCAATATGGGAAATAGAAATTCAAGATTGAATGGAAGAGCCT
ACCGATTTAGGGAATGCCCAGAAGAACAACACCGATTGTTGATATCAATTTGAAGGTTCTTGATATATACGAACAGCCTATCGATTATGTTGTTCAAGATTGTTGATATCAATTTGAAGG
TTCTTGATATATACGAACAGCCTATCGATTATGTTGTTCAAGAAAGTTAGATGTGGGTCTAAATGAACTGGGTGTGCCTGATCTTGTGAAGAATATGTGGTTTTTTTATTTTTATTTTTT
TAATTATAGGGATAATTTGGTCATTTAATAAAACTTAACAACAAAATTCTAACTAGGTTAGAAATTTGGACTCAAATGGTTAAAGAAAATGCTTATGAGTACTCAGGTCGTTAAACTTTT
TGCTTTTGGACTCAACTAGTTAAAACCAATAAAACACAGGGACTCAAAAAGTAATTTACCCTATATTAAATAAAAAAATGTTTAAGAGCATGTTTGGCTAAGCTTATTATAGTTAAAAAG
GACTTTTGAAAAAAAACTTTTGGGAAAAGGACTTTTTGAAAATGACTTTTTGAAAATGAGTTTTTAAAAAATGTGTTTGGATTAGCTTATTGATGTAAAATGACTAAAATGGACATTCTT
TTAGATGTAAGGAGGTAAAGAAGGGGTATATTGGTAATTTGTAGTTTGAAAAGTTAAAAGCTGGCAAAAAAGTCACAATATTGTGACTTCTTGAAACCTCCTTTTTCTTCTTTGCAAAAA
GTCATTTCTAAAAGGACTTTTGGCTTAACCAAACACAAAAACAACTTATTGGCTTTTTGATAAGTCAATAAGCCAATAAGTTGTTTTGAAAAGCTTAGCCAAACATGCCCTAAATTAGGG
CCTCGTTTAGGTTGCGTACTTGAACTTTGTAAGCGAAGCTCAACATTAACATCGGGCTCATTTAACTCATTTATTAAGTGAGCTTATTTTTATGCTTCTACTGGTTTAAGCTTTAACTCA
ATAGAAGCTGTTTTTCAAGTTGATCTTTAGCAATTAGTAAGTGAAGTTTAGAATGAATTTTACTTTTCTATTACTTATCTTACGTATTATCTTGATCATCCACTTTTGTTAACAGACCAA
GGGACCATATTGGGAGGTCGAAACTGGCCGAAGAGATGGAAAAGTGTCTTTGTTCGCTGATCCCATAAACCGTGTGACAGGATTGCCACCACCTTTTGCAAACATCACTCTTTTGAAGCA
ATCTTTCGCCATGAGGGGACTTAATACAAAAGACCTTGTTGTTCTATCCG
GTACGTTCATGACAATGTAATTAATATTTTCTACAAAGTTAGCAGCATTGAAGTGAACAATTTCACAATG
TATGTAATTAATATGTGTACTCTTGATCATTCTATACAGGAGGACATACCATAGGGATGTCTCATTGCTCCTCGTTCGAAAACAGGCTCTACAACTTCACTGGGAAAGGTGATACCGATC
CCTCAATGGACCAAAACTATATTGCAAGACTAAAGTTAAAGTGCAAGCCAAGAGACCAAACCACATTAGCTGAGTTGGACCCAGGGAGCTTCTTGACATTTGATGACTCATACTTCAGAC
TAGTGACTAAGAGAAGGGGGCTTCTTGAATCAGATGCAGCCTTGCTTAACGACCCTGAGACTAGAGCGTACTTGATTCAATCTATTAGTCATGGTTCCACTTTCTTCAAGGATTTTGGTG
TGTCTATGGTTAAAATGGGTCGTATTGGGGTTCTTACTGGTTCTCAGGGCGAGGTCAGGAAAGTTTGCACCAAAACGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAATTCACATATCAAAAAATACAAGTTTACTTTTGAAAGACTAATCATCTTCAAAATGGCCTTTTCCAAGAACTCATTTGGAGTTTTTGTACTTCAAATAATGGTTCTAGCACTC
CTCTCTTTACATGCAGAAGGCCAAGGCTTAAAAGTAGGGTTCTATGAGAAATCATGCCCACAAGCCGAAAAGATCGTATCGACGGTCATGAGCGATGTTATGGCCGTGGCCCCCTCTCTT
TCGGGCCCATTGTTGAGAATGCATTTCCACGACTGCTTCATTAGG
GGTTGTGACGGATCGGTTTTGTTGGATTTTCCAACACGGCAATCCGAGAAATTCTCGCCCCCAAATCTCAGCCTA
AGAGGGTTTAATATCATTGATAAGGTGAAGTTGGCGTTAGAAAAGGCCTGCCCTGGTGTAGTTTCTTGTGCTGACATTGTAGCCCTTGTTGCTAGAGACGTTACTGTGGCG
ACCAAGGGA
CCATATTGGGAGGTCGAAACTGGCCGAAGAGATGGAAAAGTGTCTTTGTTCGCTGATCCCATAAACCGTGTGACAGGATTGCCACCACCTTTTGCAAACATCACTCTTTTGAAGCAATCT
TTCGCCATGAGGGGACTTAATACAAAAGACCTTGTTGTTCTATCCG
GAGGACATACCATAGGGATGTCTCATTGCTCCTCGTTCGAAAACAGGCTCTACAACTTCACTGGGAAAGGTGAT
ACCGATCCCTCAATGGACCAAAACTATATTGCAAGACTAAAGTTAAAGTGCAAGCCAAGAGACCAAACCACATTAGCTGAGTTGGACCCAGGGAGCTTCTTGACATTTGATGACTCATAC
TTCAGACTAGTGACTAAGAGAAGGGGGCTTCTTGAATCAGATGCAGCCTTGCTTAACGACCCTGAGACTAGAGCGTACTTGATTCAATCTATTAGTCATGGTTCCACTTTCTTCAAGGAT
TTTGGTGTGTCTATGGTTAAAATGGGTCGTATTGGGGTTCTTACTGGTTCTCAGGGCGAGGTCAGGAAAGTTTGCACCAAAACGAATTAG

Retrieve as FASTA