Entry information : HaPrx37 ( HanXRQChr10g0301631)
Entry ID 13559
Creation 2016-04-27 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx37 ( HanXRQChr10g0301631)
Name (synonym) HaPrx37 ( HanXRQChr10g0301631)
Class Class III peroxidase    [Orthogroup: Prx104]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx37
start..stop
S start..stop
HaPrx12 593 0 1..334 1..330
HaPrx20 571 0 1..334 1..330
HaPrx21 539 0 1..334 43..376
HaPrx[P]76 528 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 164915079..164915501 423 N° 2 164915604..164915766 163 N° 3 164915863..164916281 419  
join(164915079..164915501,164915604..164915766,164915863..164916281)


exon

Literature and cross-references HaPrx37 ( HanXRQChr10g0301631)
DNA ref. HanXRQ genome:   HanXRQChr10 (164915079..164916281)
EST ref. GenBank:   DY925610.1
Cluster/Prediction ref. HanXRQ:   HanXRQChr10g0301631
Protein sequence: HaPrx37 ( HanXRQChr10g0301631)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (310)
PWM (Da):   %s   35540.33 (33020.9)  
PI (pH):   %s   9.27 (9.28) Peptide Signal:   %s   cut: 25 range:25-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEVSSLSKTLILLGLLLATHTNLALVQGYQGGGGGTRVGFYKSTCPGVESIVQSAVESAVQANPTIAPGLLRMFFHDCFINGCDASILINGPSTEKSAGPNAFLRGFEVIDAAKSKLEKACPGVVSCSDILALAARDSVVLTGGHSWKVPLGRRDGLVSRGSDTANLPAFNDSISVQIKKFADKGLDIQDLVTLVGGHTIGTAACAVFSYRLYNFNNTNRPDPDINPSFLPQLRALCPNGGNALRRVALDTGSVNSFGGSFYANLKYGRGVIESDAKLWSDPTTQRFVQRFLGYRGRHGLIFDVEFGRAMVKMGNVEVKNGKRGEIRRVCTAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTTTCTTCCCTTAGCAAAACACTTATCTTGTTGGGTCTCCTGTTAGCCACACACACAAACTTGGCACTAGTCCAAGGCTATCAGGGTGGCGGTGGAGGCACTCGAGTTGGCTTC
TACAAGTCCACCTGCCCTGGGGTGGAGTCCATAGTCCAATCTGCGGTTGAGTCTGCGGTACAAGCGAACCCAACAATCGCACCTGGTTTACTAAGGATGTTCTTCCATGATTGCTTTATC
AATGGTTGTGATGCATCTATACTAATTAACGGACCCTCAACTGAGAAGTCAGCAGGCCCAAACGCTTTCTTGAGAGGCTTTGAAGTTATTGATGCTGCAAAGTCCAAGCTTGAAAAGGCC
TGCCCAGGAGTGGTCTCTTGCTCGGATATTCTTGCCCTTGCTGCCCGTGATTCTGTGGTCCTA
GTAATCACATGCTTTCTTACATTTGTTCTAGTTTAAGAAAATATAGTTAACTGCTTA
TTTTTGGTGTTTTATCGTTAATTTTCACTGGATGACATATTGCAGACCGGTGGGCATAGTTGGAAGGTGCCATTAGGACGTAGAGACGGATTGGTTTCTCGAGGTTCTGATACGGCAAAC
TTGCCCGCTTTTAACGACTCTATAAGTGTCCAAATCAAAAAGTTTGCGGATAAAGGTCTTGACATTCAAGATCTTGTTACTCTTGTTG
GTAAGTAGAGCAAAATAATATTGCTACATGTA
ATTCAAGGATGATGTTTCAACATCAATAATCATAAGTTAAACTGTGTAACTCTTTGTATATCAGGTGGACACACAATTGGAACAGCAGCTTGTGCAGTATTCAGCTATAGATTATACAAC
TTCAACAATACCAATAGGCCCGACCCTGATATTAACCCATCATTCCTACCACAGCTACGAGCACTTTGCCCTAATGGTGGTAATGCGTTGAGGCGTGTGGCGCTTGATACAGGTAGTGTT
AATAGCTTTGGCGGGTCCTTTTACGCTAACTTAAAGTATGGACGCGGAGTTATTGAATCAGATGCTAAGTTATGGAGTGATCCAACAACACAAAGGTTTGTACAACGGTTCCTGGGATAC
AGGGGGCGACATGGATTGATATTCGATGTTGAGTTTGGAAGAGCCATGGTGAAGATGGGTAATGTTGAGGTGAAGAATGGAAAACGAGGTGAAATTCGTAGAGTTTGTACGGCAATCAAT
TGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTTTCTTCCCTTAGCAAAACACTTATCTTGTTGGGTCTCCTGTTAGCCACACACACAAACTTGGCACTAGTCCAAGGCTATCAGGGTGGCGGTGGAGGCACTCGAGTTGGCTTC
TACAAGTCCACCTGCCCTGGGGTGGAGTCCATAGTCCAATCTGCGGTTGAGTCTGCGGTACAAGCGAACCCAACAATCGCACCTGGTTTACTAAGGATGTTCTTCCATGATTGCTTTATC
AATGGTTGTGATGCATCTATACTAATTAACGGACCCTCAACTGAGAAGTCAGCAGGCCCAAACGCTTTCTTGAGAGGCTTTGAAGTTATTGATGCTGCAAAGTCCAAGCTTGAAAAGGCC
TGCCCAGGAGTGGTCTCTTGCTCGGATATTCTTGCCCTTGCTGCCCGTGATTCTGTGGTCCTA
ACCGGTGGGCATAGTTGGAAGGTGCCATTAGGACGTAGAGACGGATTGGTTTCTCGA
GGTTCTGATACGGCAAACTTGCCCGCTTTTAACGACTCTATAAGTGTCCAAATCAAAAAGTTTGCGGATAAAGGTCTTGACATTCAAGATCTTGTTACTCTTGTTG
GTGGACACACAATT
GGAACAGCAGCTTGTGCAGTATTCAGCTATAGATTATACAACTTCAACAATACCAATAGGCCCGACCCTGATATTAACCCATCATTCCTACCACAGCTACGAGCACTTTGCCCTAATGGT
GGTAATGCGTTGAGGCGTGTGGCGCTTGATACAGGTAGTGTTAATAGCTTTGGCGGGTCCTTTTACGCTAACTTAAAGTATGGACGCGGAGTTATTGAATCAGATGCTAAGTTATGGAGT
GATCCAACAACACAAAGGTTTGTACAACGGTTCCTGGGATACAGGGGGCGACATGGATTGATATTCGATGTTGAGTTTGGAAGAGCCATGGTGAAGATGGGTAATGTTGAGGTGAAGAAT
GGAAAACGAGGTGAAATTCGTAGAGTTTGTACGGCAATCAATTGA

Retrieve as FASTA