Entry information : HaPrx116 (HannXRQChr16g0527381)
Entry ID 13577
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-29 (Christophe Dunand)
Peroxidase information: HaPrx116 (HannXRQChr16g0527381)
Name (synonym) HaPrx116 (HannXRQChr16g0527381)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx116
start..stop
S start..stop
HaPrx118 692 0 1..341 1..341
HaPrx[P]117 553 0 33..341 1..298
LsPrx20 525 0 20..306 1..286
ZePrx07 494 7e-179 85..340 1..256
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165045681..165045956 276 N° 2 165045233..165045593 361 N° 3 165044736..165045124 389  
complement(join(165044736..165045124,165045233..165045593,165045681..165045956))


exon

Literature and cross-references HaPrx116 (HannXRQChr16g0527381)
DNA ref. HanXRQ genome:   HanXRQChr16 (165045956..165044736)
Protein sequence: HaPrx116 (HannXRQChr16g0527381)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341
PWM (Da):   %s   36927.69 Transmb domain:   %s   i12-34o
PI (pH):   %s   7.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPFYLHSIFQLLIINIFFQMASPNIITAIFFLLILCVTNNTPCDAQLSSTFYDASCPNALRTIRTSIRTAISRERRMAASILRLHFHDCFVQGCDASILLDDGPSIISEKNALPNKGSVRGYEVIEAAKSEVEKLCPGVVSCADVLTVAARDASEMVGGPSWSVKLGRRDSTSASLLLAESGALPSFKASLDSLISTFGDNGLSARDMVALSGAHTIGQAQCFLFRDRIYNNGSDIDAGFASTRRRGCPINDGNGNLARLDLVTPNSFDYNYFKNLIQKKGLLESDQVLFSGGSTDNIVREYSNNPSKFKSDFAAAMVKMSEIRPLTGQEGVIRRICGALP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTTATTTGCATTCCATCTTTCAACTTCTCATCATTAACATTTTTTTTCAAATGGCTTCCCCAAATATTATTACAGCTATCTTCTTCTTACTAATTCTTTGTGTTACAAACAAT
ACACCATGTGACGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCACTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCG
ATCCTTCGTCTCCACTTCCATGACTGCTTTGTTCAG
GTACTATTTTAACCATATATATATGACCACCATAGCTGCCAGATGTAAAAAGATAATTTGTAACGAGTTATGTAACATTTAATG
CAGGGTTGTGACGCGTCTATCTTGCTAGATGATGGTCCTTCAATTATTAGTGAAAAGAATGCGTTGCCTAATAAGGGTTCGGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAG
GTTGAAAAACTGTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTGGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCGGAAGAAGAGACTCA
ACCTCGGCTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATTTCCACCTTTGGTGATAACGGGCTTAGTGCCAGGGACATGGTTGCATTA
TCAG
GTACTAATTTACTGGTTATGTAGTTTAATTAATACATCGATTAATATATATTTTATTGTATAAATTATAACAAAGTGTGAGCTAATATTGAAGATGTGATTAATGCAGGAGCTCAT
ACTATTGGACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGATATTGATGCAGGATTTGCTAGCACGCGTAGACGTGGATGCCCTATCAACGACGGCAACGGA
AATCTTGCACGACTCGATTTAGTGACTCCTAATTCGTTTGATTATAATTACTTCAAGAACTTGATACAAAAGAAGGGTCTTCTTGAATCTGACCAAGTGTTGTTCAGTGGTGGATCAACT
GACAACATAGTTAGAGAATATAGCAACAATCCTTCAAAGTTCAAGTCGGATTTTGCAGCTGCAATGGTGAAGATGAGTGAAATCAGGCCTTTAACAGGTCAAGAAGGAGTCATACGAAGA
ATTTGTGGTGCTCTTCCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTTATTTGCATTCCATCTTTCAACTTCTCATCATTAACATTTTTTTTCAAATGGCTTCCCCAAATATTATTACAGCTATCTTCTTCTTACTAATTCTTTGTGTTACAAACAAT
ACACCATGTGACGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCACTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCG
ATCCTTCGTCTCCACTTCCATGACTGCTTTGTTCAG
GGTTGTGACGCGTCTATCTTGCTAGATGATGGTCCTTCAATTATTAGTGAAAAGAATGCGTTGCCTAATAAGGGTTCGGTAAGA
GGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAAAACTGTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTGGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCA
TCATGGTCTGTGAAGCTCGGAAGAAGAGACTCAACCTCGGCTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATTTCCACCTTTGGTGAT
AACGGGCTTAGTGCCAGGGACATGGTTGCATTATCAG
GAGCTCATACTATTGGACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGATATTGATGCAGGATTT
GCTAGCACGCGTAGACGTGGATGCCCTATCAACGACGGCAACGGAAATCTTGCACGACTCGATTTAGTGACTCCTAATTCGTTTGATTATAATTACTTCAAGAACTTGATACAAAAGAAG
GGTCTTCTTGAATCTGACCAAGTGTTGTTCAGTGGTGGATCAACTGACAACATAGTTAGAGAATATAGCAACAATCCTTCAAAGTTCAAGTCGGATTTTGCAGCTGCAATGGTGAAGATG
AGTGAAATCAGGCCTTTAACAGGTCAAGAAGGAGTCATACGAAGAATTTGTGGTGCTCTTCCCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTT ATTTGCATTC CATCTTTCAA CTTCTCATCA TTAACATTTT TTTTCAAATG GCTTCCCCAA ATATTATTAC AGCTATCTTC TTCTTACTAA TTCTTTGTGT TACAAACAAT  ACACCATGTG ACGCACAGTT ATCTTCTACA TTCTATGACG CTTCATGTCC CAATGCACTA CGTACAATCA GGACATCCAT CCGAACAGCC ATATCTCGTG AGCGTCGCAT GGCAGCTTCG  ATCCTTCGTC TCCACTTCCA TGACTGCTTT GTTCAGGGTT GTGACGCGTC TATCTTGCTA GATGATGGTC CTTCAATTAT TAGTGAAAAG AATGCGTTGC CTAATAAGGG TTCGGTAAGA  GGTTATGAAG TGATAGAGGC AGCAAAATCT GAGGTTGAAA AACTGTGTCC TGGAGTTGTA TCATGTGCGG ATGTACTAAC CGTGGCTGCC CGTGATGCCT CAGAAATGGT TGGTGGTCCA  TCATGGTCTG TGAAGCTCGG AAGAAGAGAC TCAACCTCGG CTAGCCTTCT TCTAGCAGAA TCCGGTGCTC TTCCTAGTTT CAAAGCATCG CTAGACTCAC TTATTTCCAC CTTTGGTGAT  AACGGGCTTA GTGCCAGGGA CATGGTTGCA TTATCAGGAG CTCATACTAT TGGACAAGCG CAATGCTTCT TATTCCGTGA TAGGATATAC AACAACGGAT CAGATATTGA TGCAGGATTT  GCTAGCACGC GTAGACGTGG ATGCCCTATC AACGACGGCA ACGGAAATCT TGCACGACTC GATTTAGTGA CTCCTAATTC GTTTGATTAT AATTACTTCA AGAACTTGAT ACAAAAGAAG  GGTCTTCTTG AATCTGACCA AGTGTTGTTC AGTGGTGGAT CAACTGACAA CATAGTTAGA GAATATAGCA ACAATCCTTC AAAGTTCAAG TCGGATTTTG CAGCTGCAAT GGTGAAGATG 
AGTGAAATCA GGCCTTTAAC AGGTCAAGAA GGAGTCATAC GAAGAATTTG TGGTGCTCTT CCCTAG 

Retrieve as FASTA