Entry information : HaPrx118 (HanXRQChr16g0527441)
Entry ID 13579
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx118 (HanXRQChr16g0527441)
Name (synonym) HaPrx118 (HanXRQChr16g0527441)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx118
start..stop
S start..stop
HaPrx116 692 0 1..341 1..341
HaPrx[P]117 557 0 33..341 1..298
LsPrx20 531 0 20..306 1..286
ZePrx07 498 3e-180 85..340 1..256
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165124428..165124703 276 N° 2 165123980..165124340 361 N° 3 165123483..165123871 389  
complement(join(165123483..165123871,165123980..165124340,165124428..165124703))


exon

Literature and cross-references HaPrx118 (HanXRQChr16g0527441)
DNA ref. HanXRQ genome:   HanXRQChr16 (165124703..165123483)
Protein sequence: HaPrx118 (HanXRQChr16g0527441)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341
PWM (Da):   %s   36827.62 Transmb domain:   %s   i12-34o
PI (pH):   %s   7.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPFYLHSIFQLLIINIFFQMASPNIITAIFFLLILCVTNNTPCDAQLSSTFYDASCPNALRTIRTSIRTAISRERRMAASILRLHFHDCFVQGCDASILLDDGPSIISEKNALPNKGSVRGYEVIEAAKSEVEKLCPGVVSCADVLTVAARDASEMVGGPSWSVKLGRRDSTSASLLLAESGALPSFKASLDSLISTFGDNGLSARDMVALSGAHTIGQAQCFLFRDRIYNNGSDIDAGFASTRRRGCPVNDGNGNLAPLDLVTPNSFDYNYFKNLIQKKGLLESDQVLFSGGSTDSIVREYSNNPSKFKSDFAAAMVKMSEIRPLTGQEGVIRRICGALP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTTATTTGCATTCCATCTTTCAACTTCTCATCATTAACATTTTTTTTCAAATGGCTTCCCCAAATATTATTACAGCTATCTTCTTCTTACTAATTCTTTGTGTTACAAACAAT
ACACCATGTGACGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCACTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCG
ATCCTTCGTCTCCACTTCCATGACTGCTTTGTTCAG
GTACTATTTTAACCATATATATATGACCACCGTAGCTTCCAGATGTAAAAGGATAATTTGTAACGAGTTATGTATCATTTAATG
CAGGGTTGTGACGCGTCTATCTTGCTAGACGACGGTCCTTCAATCATAAGTGAAAAGAATGCGTTGCCTAATAAGGGTTCGGTAAGAGGTTATGAAGTGATAGAGGCAGCAAAATCTGAG
GTTGAAAAACTCTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTGGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCATCATGGTCTGTGAAGCTCGGAAGAAGAGACTCA
ACCTCGGCTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATTTCCACCTTCGGTGATAACGGGCTTAGTGCCCGGGACATGGTTGCATTA
TCAG
GTACTAATTTACTGGTTATGTAGTTTAATTAATACATCGATTAATATATATTTTATTGTATAAATTATAACAAAGTGTGAGCTAATATTGAAGATGTGGTTAATGCAGGAGCTCAT
ACTATTGGACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGATATTGATGCAGGATTTGCTAGCACGCGTAGACGTGGATGCCCTGTCAACGACGGCAACGGA
AATCTTGCACCACTCGATTTAGTGACACCTAATTCGTTTGATTATAATTACTTCAAGAACTTGATACAAAAGAAGGGTCTTCTTGAGTCTGATCAAGTGTTGTTTAGCGGAGGATCAACA
GACAGCATTGTTAGAGAATATAGCAATAATCCTTCAAAGTTCAAGTCGGATTTTGCAGCTGCAATGGTAAAGATGAGTGAAATCAGGCCTTTAACAGGTCAAGAAGGAGTCATACGAAGA
ATTTGTGGTGCTCTTCCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTTATTTGCATTCCATCTTTCAACTTCTCATCATTAACATTTTTTTTCAAATGGCTTCCCCAAATATTATTACAGCTATCTTCTTCTTACTAATTCTTTGTGTTACAAACAAT
ACACCATGTGACGCACAGTTATCTTCTACATTCTATGACGCTTCATGTCCCAATGCACTACGTACAATCAGGACATCCATCCGAACAGCCATATCTCGTGAGCGTCGCATGGCAGCTTCG
ATCCTTCGTCTCCACTTCCATGACTGCTTTGTTCAG
GGTTGTGACGCGTCTATCTTGCTAGACGACGGTCCTTCAATCATAAGTGAAAAGAATGCGTTGCCTAATAAGGGTTCGGTAAGA
GGTTATGAAGTGATAGAGGCAGCAAAATCTGAGGTTGAAAAACTCTGTCCTGGAGTTGTATCATGTGCGGATGTACTAACCGTGGCTGCCCGTGATGCCTCAGAAATGGTTGGTGGTCCA
TCATGGTCTGTGAAGCTCGGAAGAAGAGACTCAACCTCGGCTAGCCTTCTTCTAGCAGAATCCGGTGCTCTTCCTAGTTTCAAAGCATCGCTAGACTCACTTATTTCCACCTTCGGTGAT
AACGGGCTTAGTGCCCGGGACATGGTTGCATTATCAG
GAGCTCATACTATTGGACAAGCGCAATGCTTCTTATTCCGTGATAGGATATACAACAACGGATCAGATATTGATGCAGGATTT
GCTAGCACGCGTAGACGTGGATGCCCTGTCAACGACGGCAACGGAAATCTTGCACCACTCGATTTAGTGACACCTAATTCGTTTGATTATAATTACTTCAAGAACTTGATACAAAAGAAG
GGTCTTCTTGAGTCTGATCAAGTGTTGTTTAGCGGAGGATCAACAGACAGCATTGTTAGAGAATATAGCAATAATCCTTCAAAGTTCAAGTCGGATTTTGCAGCTGCAATGGTAAAGATG
AGTGAAATCAGGCCTTTAACAGGTCAAGAAGGAGTCATACGAAGAATTTGTGGTGCTCTTCCCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTTTT ATTTGCATTC CATCTTTCAA CTTCTCATCA TTAACATTTT TTTTCAAATG GCTTCCCCAA ATATTATTAC AGCTATCTTC TTCTTACTAA TTCTTTGTGT TACAAACAAT  ACACCATGTG ACGCACAGTT ATCTTCTACA TTCTATGACG CTTCATGTCC CAATGCACTA CGTACAATCA GGACATCCAT CCGAACAGCC ATATCTCGTG AGCGTCGCAT GGCAGCTTCG  ATCCTTCGTC TCCACTTCCA TGACTGCTTT GTTCAGGGTT GTGACGCGTC TATCTTGCTA GACGACGGTC CTTCAATCAT AAGTGAAAAG AATGCGTTGC CTAATAAGGG TTCGGTAAGA  GGTTATGAAG TGATAGAGGC AGCAAAATCT GAGGTTGAAA AACTCTGTCC TGGAGTTGTA TCATGTGCGG ATGTACTAAC CGTGGCTGCC CGTGATGCCT CAGAAATGGT TGGTGGTCCA  TCATGGTCTG TGAAGCTCGG AAGAAGAGAC TCAACCTCGG CTAGCCTTCT TCTAGCAGAA TCCGGTGCTC TTCCTAGTTT CAAAGCATCG CTAGACTCAC TTATTTCCAC CTTCGGTGAT  AACGGGCTTA GTGCCCGGGA CATGGTTGCA TTATCAGGAG CTCATACTAT TGGACAAGCG CAATGCTTCT TATTCCGTGA TAGGATATAC AACAACGGAT CAGATATTGA TGCAGGATTT  GCTAGCACGC GTAGACGTGG ATGCCCTGTC AACGACGGCA ACGGAAATCT TGCACCACTC GATTTAGTGA CACCTAATTC GTTTGATTAT AATTACTTCA AGAACTTGAT ACAAAAGAAG  GGTCTTCTTG AGTCTGATCA AGTGTTGTTT AGCGGAGGAT CAACAGACAG CATTGTTAGA GAATATAGCA ATAATCCTTC AAAGTTCAAG TCGGATTTTG CAGCTGCAAT GGTAAAGATG  AGTGAAATCA GGCCTTTAAC AGGTCAAGAA GGAGTCATAC GAAGAATTTG TGGTGCTCTT CCCTAGTTAT TTTGAATGTC ATCTAAATCT TTGTTCGATT ACTTGGAAAT TACACTGTTT  GTAATCATAT CTTGATTCCT TTATTTATTT TTTTAATCTT CAACTGTAAA GAAAAGGACC TTCAATAGTC CATTACACTA TTTGTATTGT TAGCTTCGTG TTAAAGAGAA ATTTGTTTTT 
CAATGAATAA GAAGTGTGGG TTTCATTGT 

Retrieve as FASTA