Entry information : HaPrx[P]121 (HanXRQChr16g0528221)
Entry ID 13582
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-12-08 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2017-12-08 (Christophe Dunand)
Peroxidase information: HaPrx[P]121 (HanXRQChr16g0528221)
Name (synonym) HaPrx[P]121 (HanXRQChr16g0528221)
Class Class III peroxidase     [Orthogroup: Prx014]*
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx[P]121
start..stop
S start..stop
LsaPrx20 215 1e-71 1..138 54..192
PtPrx23 176 7e-56 1..138 51..192
SbaPrx02 176 7e-56 1..138 54..195
ZePrx15 175 1e-55 1..138 56..193
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 168235419..168235484 66 N° 2 168235096..168235278 183 N° 3 168234832..168234996 165  
complement(join(168234832..168234996,168235096..168235278,168235419..168235484))


exon

Literature and cross-references HaPrx[P]121 (HanXRQChr16g0528221)
DNA ref. HanXRQ genome:   HanXRQChr16 (168235484..168234832)
Protein sequence: HaPrx[P]121 (HanXRQChr16g0528221)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   137
PWM (Da):   %s   14472.39  
PI (pH):   %s   6.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
VSRQRRMAALIIRLHFHDYFVQGCDASILLSDPATTERTALSNTGVGGYEVIDAAKSAVENICPGIVSCADIPAVAARDTSVAVGGPSWSVRLGRRDSTRANRALADGLPRADLDLPSLVRDFDAKGLNERDMVA*SG

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGTCTCGTCAACGTCGCATGGCTGCCCTTATTATCCGCCTTCATTTTCATGATTATTTCGTTCAGGTTCGTTCAATATGTTCCCTTTCGATGCTTGACCATCGGGCCCCACTACGACAT
ACGTGTCAAATGTGTTTCACACTTATATATAAACATCTTAAATATATTAAACTAGTTGCACTTATGTAAAAACATAAAATTTGCAGGGTTGTGATGCATCCATTTTACTAAGCGATCCCG
CCACAACTGAGAGGACAGCATTGTCCAATACCGGGGTTGGAGGCTATGAAGTTATAGATGCAGCAAAATCTGCTGTTGAAAACATTTGTCCGGGGATAGTTTCATGTGCGGATATACCTG
CTGTCGCAGCGCGTGATACTTCTGTTGCG
GTAACATATGTTCTAACTATATGATTTTTTTTTAATATGAAATTAGAGTCATGCATATCTTTGTATTGACCAGTTATGAATAATTTGAAAA
ATATTCAGGTGGGTGGTCCTTCATGGTCAGTAAGACTTGGCAGAAGAGACTCTACTAGAGCGAACCGAGCGCTAGCTGATGGTCTTCCACGAGCCGATCTTGATCTACCATCACTAGTTA
GAGATTTTGATGCAAAGGGTCTGAATGAAAGAGACATGGTTGCTTAATCTGGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGTCTCGTCAACGTCGCATGGCTGCCCTTATTATCCGCCTTCATTTTCATGATTATTTCGTTCAGGGTTGTGATGCATCCATTTTACTAAGCGATCCCGCCACAACTGAGAGGACAGCA
TTGTCCAATACCGGGGTTGGAGGCTATGAAGTTATAGATGCAGCAAAATCTGCTGTTGAAAACATTTGTCCGGGGATAGTTTCATGTGCGGATATACCTGCTGTCGCAGCGCGTGATACT
TCTGTTGCG
GTGGGTGGTCCTTCATGGTCAGTAAGACTTGGCAGAAGAGACTCTACTAGAGCGAACCGAGCGCTAGCTGATGGTCTTCCACGAGCCGATCTTGATCTACCATCACTAGTT
AGAGATTTTGATGCAAAGGGTCTGAATGAAAGAGACATGGTTGCTTAATCTGGT

Retrieve as FASTA