Entry information : HaPrx130 (HannXRQChr11g0322181)
Entry ID 13591
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-29 (Christophe Dunand)
Peroxidase information: HaPrx130 (HannXRQChr11g0322181)
Name (synonym) HaPrx130 (HannXRQChr11g0322181)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx130
start..stop
S start..stop
HaPrx[P]129 628 0 1..323 1..322
LsaPrx43 522 0 29..303 9..282
VvPrx64 509 0 26..320 26..319
MePrx114 504 0 26..323 23..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7516620..7516841 222 N° 2 7516930..7516974 45 N° 3 7518560..7518706 147 N° 4 7518805..7518967 163
N° 5 7519314..7519708 395  
join(7516620..7516841,7516930..7516974,7518560..7518706,7518805..7518967,7519314 ..7519708)


exon

Literature and cross-references HaPrx130 (HannXRQChr11g0322181)
DNA ref. HanXRQ genome:   HanXRQChr11 (7516620..7519708)
Protein sequence: HaPrx130 (HannXRQChr11g0322181)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323
PWM (Da):   %s   34943.89 Transmb domain:   %s   i7-26o
PI (pH):   %s   9.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKNTNMFYLIFSFIIVRLAYLNLVNTLSTNYYDQTCPNAESTITSVVKKAMLNDPTVPAALLRMHFHDCFIRGCDGSVLLNSTGKNKKAEKDGPPNISLHAFYVIDNAKKAVEALCPKTVSCADILALAARDAVTLSGGPTWVVPKGRKDGRVSKATETRQLPAPTFNISQLQQSFAQRGLSLDDLVALSGGHTLGFSHCSSFQNRIHNFNSKQSVDPTLESSFAASLKSVCPAKNTAKNAGANLDSTPTTFDNRYYKLLLQGKSIFSSDQSLVTSAKTKALVSKFASSQQEFQKAFVKSMIKMSSINGGQEVRLDCRAVN

Retrieve as FASTA  
Remarks extra intron in exon 2
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATGTTTTACCTTATTTTCAGTTTCATTATCGTTCGATTAGCCTATCTTAACTTGGTTAATACACTAAGTACTAATTACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCAATGTTGAATGACCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GTGATTATTCTTATATTT
CATTCATATGCATTTCAATGATTGTTTCATCATTTTGTTTGTTTATTGACGACTACATCGAATTTTGTAGGGATGCGATGGTTCGGTGTTGTTGAATTCAACTGGGAAAAACAAAGTGAT
AGAAACTTGAAATTGAAAACTTCGATTACTGAACGAACGATACAATTAGCCACATTCGAGATAGGCCGGATCTCCAACTTTAGAGTAAAAAACCCTAATTTTATATAAACATAAAACATC
GACCCCTAATCTAAATGAGAGATATTAATAAGATTAGAACTAACTGCCCCACTACTTGCTCCTAAAACTGTTCCCCCCAAAACTCATTCCCACTAATAATTAAACGGGTCAAATACCCAG
CTGGAGCTTCACACAAAATATGGGCCAATCCACAGGTTTGTATCAATACATCCTGTCCCAAAATCCGACTTGTCCTCAAGTCGGAAACGAGGGAACTGTTGTGCCAAGCAATAAGCCATT
CAATTATAGACCGAGGTTGAAAATCAAATTCCCAATCTTTGGTAGTCGGTGGAGAAGCTAAAGGCGTTGCGGGAACTTGAACCCTTGCGGGTTTCAGCCAGGATACATGGGAGACCAGAA
TGATGCGATAAGATCCACAAGAGCTAGATGGCAGTTTCTTAAAGATGTTGACAAGGCTGAGTTTGTGGAAAAGCGGACATTGGGGTGTAGGGTTGTGGGTATCATACTGAACGACATTTT
TAGTATAGTCTGAAATAGGTTTTGGGCTTGGGCTCCATGCAAGACTTCTGCTGCGCTTAGATGAACAGATCTGGGACTCGTTTTCTAGGGCAAGGCGAACAACATAACACTTGGTTCTAG
GTTTCTGGATAAAAACGTTAGCCTTCATCAGTTCTTCATGAAGATCATTCGGTCCTTCATCCTTCTCCACCGTGTTCTTCAAATCACTGTCCACTTCTTCACTGTAACAACTATCTTCGT
CTGATTCTTCACTGTTACAACCATCTTCAATCACCTGAGCTTTAATTTCGTCAACAACATCTCTCAAAGATGCAAGAATGCCGTCTAATCGTGCTGCAATGATTGCGAGTTGATCCGCTA
AATTCCGGGTTGTAAGCACCATTCGATTTCCCGGCAATGGAACCATTGATAGAAACTTGAAATTGAAAACTTATTACTGAACGAACGATACAATTAGCCACATTCGAGATAGGCCGGATC
TCCAACTTTAGAGTAAAAAACCCTAATTTTATATAAACATAAAACATCGACCCCTAATCTAAATGAGAGATATTAATAAGATTAGAACTAACTGCCCCACTACTTGCTCCTAAAACTGTT
CCCCCCAAAACTCATTCCCACTAATAATTAAACGGGTCAAATACCCAGCTGGAGCTTCACACAAAATATGGGCCAATCCACAGGTTTGTATGATACAAACCTGTGGATTGGCCCATATTT
TGTGTGAAGCTCCAGCTGGGTATTTGACCCGTTTAATTATTAGTGGGAATGAGTTTTGGGGGGAACAGTTTTAGGAGCAAGTAGTGGGGCAGTTAGTTCTAATCTTATTAATATCTCTCA
TTTAGATTAGGGGTCGATGTTTTATGTTTATATAAAATTAGGGTTTTTTACTCTAAAGTTGGAGATCCGGCCTATCTCGAATGTGGCTAATTGTATCGTTCGTTCAGTAATCGAAGTTTT
CAATTTCAAGTTTCTATCACAAAGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAAACTGTAT
CTTGTGCAGATATCTTAGCATTAGCAGCAAGGGATGCAGTCACTTTG
GTCAGTAAAGCATCTTCTTCTTTTCATACCTTAAAGTTTTCAATTTCTAGATCTTTTGAGGTTATGATTGATT
CAAGTTTTAACTTGTTTGAATCTAGTCTGGAGGGCCAACATGGGTGGTGCCGAAAGGAAGAAAAGATGGAAGAGTTTCGAAAGCAACTGAAACACGACAATTACCAGCTCCAACATTTAA
TATTTCTCAATTGCAACAAAGTTTTGCTCAGAGAGGTCTTTCCTTAGACGATTTAGTTGCCCTTTCAG
GTAATTAACCAAATCCTGGATGTTAAAGATTTCCATAATCCAATAACCAATG
ATTTCAACGTGTTCATTTACTTAGAATGTTGTAATCTCCAGGTTTTTAAGGACATTTTTAATCAAACTAACAAGAAGTTTCGTTTTCTAGTCATAAATTTTGTTGTAATTTGAATTTATA
GATATTATATTATGTTTTAGAGATTTACACTAGACAGTTAGTGTCTTAGTGACTATTTTGTTTCTTTATCGACACTTTTTATATGTGTGTCACCCTAAATGACATTATTTTGTAGTACTC
TAGACACTTTTATGGAAAACTAAACAAGGATTATTAATTACGCTCAATGTGTAGGAGGACATACACTTGGATTCTCTCATTGCTCATCCTTTCAGAACAGGATACACAACTTTAATTCAA
AGCAAAGTGTCGACCCAACATTGGAATCGTCATTTGCAGCCAGTTTAAAAAGTGTATGCCCAGCAAAGAACACAGCGAAAAATGCTGGTGCCAATCTTGATTCGACTCCCACGACTTTTG
ACAATAGATACTATAAGTTACTTCTCCAAGGGAAGAGTATTTTCTCTTCTGATCAGTCGTTGGTCACATCAGCAAAGACCAAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGT
TCCAGAAAGCATTTGTTAAATCCATGATTAAGATGAGTAGCATTAATGGTGGGCAAGAGGTTAGGCTCGATTGTAGAGCAGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCAAGAACACCAACATGTTTTACCTTATTTTCAGTTTCATTATCGTTCGATTAGCCTATCTTAACTTGGTTAATACACTAAGTACTAATTACTATGATCAAACATGCCCCAAT
GCTGAATCAACCATTACAAGTGTTGTCAAGAAAGCAATGTTGAATGACCCAACAGTTCCTGCTGCACTTCTAAGAATGCATTTCCATGATTGCTTCATTAGG
GGATGCGATGGTTCGGTG
TTGTTGAATTCAACTGGGAAAAACAAA
AAAGCTGAGAAAGATGGACCTCCAAACATATCTTTGCATGCATTTTATGTTATTGATAATGCCAAGAAAGCAGTAGAGGCTTTATGTCCTAAA
ACTGTATCTTGTGCAGATATCTTAGCATTAGCAGCAAGGGATGCAGTCACTTTG
TCTGGAGGGCCAACATGGGTGGTGCCGAAAGGAAGAAAAGATGGAAGAGTTTCGAAAGCAACTGAA
ACACGACAATTACCAGCTCCAACATTTAATATTTCTCAATTGCAACAAAGTTTTGCTCAGAGAGGTCTTTCCTTAGACGATTTAGTTGCCCTTTCAG
GAGGACATACACTTGGATTCTCT
CATTGCTCATCCTTTCAGAACAGGATACACAACTTTAATTCAAAGCAAAGTGTCGACCCAACATTGGAATCGTCATTTGCAGCCAGTTTAAAAAGTGTATGCCCAGCAAAGAACACAGCG
AAAAATGCTGGTGCCAATCTTGATTCGACTCCCACGACTTTTGACAATAGATACTATAAGTTACTTCTCCAAGGGAAGAGTATTTTCTCTTCTGATCAGTCGTTGGTCACATCAGCAAAG
ACCAAAGCATTGGTCTCAAAGTTTGCTAGCTCACAACAAGAGTTCCAGAAAGCATTTGTTAAATCCATGATTAAGATGAGTAGCATTAATGGTGGGCAAGAGGTTAGGCTCGATTGTAGA
GCAGTAAACTAA

Retrieve as FASTA