Entry information : HaPrx65 (HanXRQChr09g0254591)
Entry ID 13619
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2017-12-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-08 (Christophe Dunand)
Peroxidase information: HaPrx65 (HanXRQChr09g0254591)
Name (synonym) HaPrx65 (HanXRQChr09g0254591)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx65
start..stop
S start..stop
HaPrx44 677 0 1..329 1..329
HaPrx33 673 0 1..329 21..349
HaPrx[P]64 586 0 1..329 1..327
LvPrx01 581 0 6..329 2..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 57817531..57817755 225 N° 2 57817840..57818025 186 N° 3 57818628..57818802 175 N° 4 57818884..57819287 404
join(57817531..57817755,57817840..57818025,57818628..57818802,57818884..57819287 )


exon

Literature and cross-references HaPrx65 (HanXRQChr09g0254591)
DNA ref. HanXRQ genome:   HanXRQChr03 (57817531..57819287)
Protein sequence: HaPrx65 (HanXRQChr09g0254591)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (302)
PWM (Da):   %s   35864.45 (32960.9) Transmb domain:   %s   i7-25o
PI (pH):   %s   9.08 (9.08) Peptide Signal:   %s   cut: 28 range:28-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKNSFGVFVLQIMVLALLSLHAEGQGLKVGFYEKSCPQAEKIVSTVMSDVMAVAPSLSGPLLRMHFHDCFIRGCDGSVLLDSPTRQSEKFSPPNLSLRGFNIIDKVKLALEKACPGVVSCADIVALVARDVTVATKGPYWEVETGRRDGKVSLFADPINRVTGLPPPFANITLLKQSFAMRGLNTKDLVVLSGGHTIGMSHCSSFENRLYNFTGKGDTDPSMDQNYIARLKLKCKPRDQTTLAELDPGSFKTFDDSYFRLVTKRRGLLESDAALLNDPETRAYLIQSISHGSTFFKDFGVSMVKMGRIGVLTGSQGEVRKVCTKTN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTTCCAAGAACTCATTTGGAGTTTTTGTACTTCAAATAATGGTTCTAGCACTCCTTTCTTTACATGCAGAAGGCCAGGGCTTAAAAGTAGGGTTCTATGAGAAATCATGCCCA
CAAGCCGAAAAGATCGTATCGACGGTCATGAGCGATGTTATGGCCGTGGCTCCGTCTCTTTCGGGCCCATTGTTGAGAATGCATTTCCACGACTGCTTCATTAGG
GTTTGTAACATGTTT
TTTTATAATAAGTTGTCAGTTTTCTTCAAATATTAACGTAAATGTGTTTTATGAACCTTCTAATTGTAGGGTTGTGACGGATCGGTTTTGTTGGATTCTCCAACACGACAATCCGAGAAA
TTCTCGCCCCCGAATCTCAGCCTGAGAGGGTTTAATATCATTGATAAGGTGAAGTTGGCGTTAGAAAAGGCCTGCCCTGGTGTAGTTTCTTGTGCTGACATCGTAGCCCTTGTTGCCAGA
GACGTTACTGTGGCG
GTATATTTATCTTCCTTTCAAATCTAATGTTGAAATTGGTTTGATGTGTAGGTTGTAAATGAGTTGAGCCGAACCCGAGATCGGCTTGATTAAATGGGGTGGTGG
TCCATTTGCAAAGGCAATACCTTTAAACACCTTGGGAGGGGTTGGGTTCAAGTCTTACAAACCGAGAATAAAAAGAAATTCGCCATTCAAAAAAAATTGAAGACTCATGCATAAGCTTGG
CTTGTTTCAAGTCTTATAAAGATTGAGCTCACATTATATACGATTTTTCAATATTTTTATGTATGAACTATTTTATAAAATTTATTTAAAGTTATAATTACTATATTTAACATAATACAT
GTTATTTAGTTATTTAAAAAAAACAAGTACGTAAATATGTGTTTAAATTAAGCGAAGCTCAACATTAACATCGGGCTTATTTAACTCATTTATTAAATGAGCTTATTTTTAGGCTTCTAG
TCGTTTGAGCTTTAACTCAATAGAAGCTGTTTTTCAAGTTGATCTTTAGCAATTAACAAATGAAGTTTAGAATGATTTTTTTTATTTTTTTATTAGTTATCTCATGTATTATCTTGATCA
TCCACTTTTGTTAACAGACCAAGGGACCATATTGGGAGGTCGAAACTGGCCGAAGAGATGGAAAAGTGTCTTTGTTCGCCGATCCCATAAATCGTGTGACAGGATTGCCACCACCTTTTG
CAAACATCACTCTTTTGAAGCAATCTTTTGCCATGAGGGGACTTAACACAAAAGACCTTGTTGTTCTATCCG
GTACGTTCATGACAGACAACGGAATTAATATTTCCTACAATGTATGTA
ATTAATATGCGTACTCTTGATCATTCTATATAGGAGGACATACCATAGGGATGTCTCATTGCTCCTCGTTCGAAAACCGGCTCTACAACTTCACTGGGAAAGGTGATACCGATCCCTCAA
TGGACCAAAACTATATTGCAAGATTAAAGTTAAAGTGCAAGCCAAGAGACCAGACCACATTAGCTGAGTTAGACCCAGGGAGCTTCAAGACATTTGATGACTCATACTTTAGACTAGTGA
CTAAGAGAAGGGGGCTTCTTGAATCAGATGCAGCCTTGCTTAATGACCCTGAGACTAGAGCGTACTTGATTCAATCTATTAGTCATGGTTCCACTTTCTTTAAGGATTTTGGTGTGTCTA
TGGTTAAAATGGGTCGTATTGGGGTTCTTACTGGTTCTCAGGGTGAAGTCAGGAAAGTTTGCACCAAAACGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTTCCAAGAACTCATTTGGAGTTTTTGTACTTCAAATAATGGTTCTAGCACTCCTTTCTTTACATGCAGAAGGCCAGGGCTTAAAAGTAGGGTTCTATGAGAAATCATGCCCA
CAAGCCGAAAAGATCGTATCGACGGTCATGAGCGATGTTATGGCCGTGGCTCCGTCTCTTTCGGGCCCATTGTTGAGAATGCATTTCCACGACTGCTTCATTAGG
GGTTGTGACGGATCG
GTTTTGTTGGATTCTCCAACACGACAATCCGAGAAATTCTCGCCCCCGAATCTCAGCCTGAGAGGGTTTAATATCATTGATAAGGTGAAGTTGGCGTTAGAAAAGGCCTGCCCTGGTGTA
GTTTCTTGTGCTGACATCGTAGCCCTTGTTGCCAGAGACGTTACTGTGGCG
ACCAAGGGACCATATTGGGAGGTCGAAACTGGCCGAAGAGATGGAAAAGTGTCTTTGTTCGCCGATCCC
ATAAATCGTGTGACAGGATTGCCACCACCTTTTGCAAACATCACTCTTTTGAAGCAATCTTTTGCCATGAGGGGACTTAACACAAAAGACCTTGTTGTTCTATCCG
GAGGACATACCATA
GGGATGTCTCATTGCTCCTCGTTCGAAAACCGGCTCTACAACTTCACTGGGAAAGGTGATACCGATCCCTCAATGGACCAAAACTATATTGCAAGATTAAAGTTAAAGTGCAAGCCAAGA
GACCAGACCACATTAGCTGAGTTAGACCCAGGGAGCTTCAAGACATTTGATGACTCATACTTTAGACTAGTGACTAAGAGAAGGGGGCTTCTTGAATCAGATGCAGCCTTGCTTAATGAC
CCTGAGACTAGAGCGTACTTGATTCAATCTATTAGTCATGGTTCCACTTTCTTTAAGGATTTTGGTGTGTCTATGGTTAAAATGGGTCGTATTGGGGTTCTTACTGGTTCTCAGGGTGAA
GTCAGGAAAGTTTGCACCAAAACGAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTT CCAAGAACTC ATTTGGAGTT TTTGTACTTC AAATAATGGT TCTAGCACTC CTTTCTTTAC ATGCAGAAGG CCAGGGCTTA AAAGTAGGGT TCTATGAGAA ATCATGCCCA  CAAGCCGAAA AGATCGTATC GACGGTCATG AGCGATGTTA TGGCCGTGGC TCCGTCTCTT TCGGGCCCAT TGTTGAGAAT GCATTTCCAC GACTGCTTCA TTAGGGGTTG TGACGGATCG  GTTTTGTTGG ATTCTCCAAC ACGACAATCC GAGAAATTCT CGCCCCCGAA TCTCAGCCTG AGAGGGTTTA ATATCATTGA TAAGGTGAAG TTGGCGTTAG AAAAGGCCTG CCCTGGTGTA  GTTTCTTGTG CTGACATCGT AGCCCTTGTT GCCAGAGACG TTACTGTGGC GACCAAGGGA CCATATTGGG AGGTCGAAAC TGGCCGAAGA GATGGAAAAG TGTCTTTGTT CGCCGATCCC  ATAAATCGTG TGACAGGATT GCCACCACCT TTTGCAAACA TCACTCTTTT GAAGCAATCT TTTGCCATGA GGGGACTTAA CACAAAAGAC CTTGTTGTTC TATCCGGAGG ACATACCATA  GGGATGTCTC ATTGCTCCTC GTTCGAAAAC CGGCTCTACA ACTTCACTGG GAAAGGTGAT ACCGATCCCT CAATGGACCA AAACTATATT GCAAGATTAA AGTTAAAGTG CAAGCCAAGA  GACCAGACCA CATTAGCTGA GTTAGACCCA GGGAGCTTCA AGACATTTGA TGACTCATAC TTTAGACTAG TGACTAAGAG AAGGGGGCTT CTTGAATCAG ATGCAGCCTT GCTTAATGAC  CCTGAGACTA GAGCGTACTT GATTCAATCT ATTAGTCATG GTTCCACTTT CTTTAAGGAT TTTGGTGTGT CTATGGTTAA AATGGGTCGT ATTGGGGTTC TTACTGGTTC TCAGGGTGAA 
GTCAGGAAAG TTTGCACCAA AACGAACTAG 

Retrieve as FASTA