Entry information : HaPrx133 (HanXRQChr17g0551261)
Entry ID 13656
Creation 2016-05-09 (Christophe Dunand)
Last sequence changes 2016-05-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx133 (HanXRQChr17g0551261)
Name (synonym) HaPrx133 (HanXRQChr17g0551261)
Class Class III peroxidase    [Orthogroup: Prx139]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx133
start..stop
S start..stop
SsqPrx01_A34-4-23 450 2e-158 167..464 29..326
SsqPrx01_OS-Bill4 449 7e-158 167..464 29..326
SsqPrx01_Ox15 448 1e-157 167..464 29..326
SsqPrx01_Ox8 447 5e-157 167..464 29..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 71288384..71289196 813 N° 2 71290021..71290183 163 N° 3 71290299..71290717 419  
join(71288384..71289196,71290021..71290183,71290299..71290717)


exon

Literature and cross-references HaPrx133 (HanXRQChr17g0551261)
DNA ref. HanXRQ genome:   HanXRQChr17 (71288384..71290717)
Protein sequence: HaPrx133 (HanXRQChr17g0551261)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   464
PWM (Da):   %s   49183.65  
PI (pH):   %s   8.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHATSILLPPPPPPTNACQPPYPPPPTPTPAYPTPPTPASTTPPISPPAPIYPPKTPPAPTTPSTPPPALTNSSTPPPAPTSPPTTPPAPTNPSTPPLAPTCPPTSPPSPTYPPTTPLAPTYPPTTPLTPTYPPTTPLAPTCPPTTPPSPTYPPTTPANRYPPRSTRVGFYKTTCPQAEAIVQSVVQSEIRSNQTYAPGILRMFFHDCFVNGCDESVLIDGSFAEKTARANSRLRGYEVIDAAKSMLETVCPGVVSCADILALAARDSVVQTGGSGWAVPTGRRDGLVSLASDAESIPGPKDSIDDQIKKFANKGLSIEDLVTLVGGHMIGTAGCVTFSDRLYNYNNTNAPDPAIDQGFLPHLQTLCPLSGDLTRRVALDTNSENNFDNSFYENIRRGRGVLESDSKLWSDPRTQKFAQPFIGASRSHGSTFNKMFAIAMVKMSKIELKTGNQGEIRRVCNRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Very long PS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGCAACGTCAATTCTCTTACCACCACCACCACCACCTACCAATGCTTGTCAACCCCCATATCCCCCGCCACCCACACCGACTCCAGCATATCCCACGCCACCCACACCGGCTTCA
ACAACTCCCCCGATCAGCCCACCGGCTCCAATATATCCCCCCAAAACCCCACCAGCTCCCACAACTCCCTCCACACCCCCACCGGCTCTGACAAATTCCTCCACACCCCCACCGGCTCCA
ACAAGTCCCCCGACAACCCCACCGGCTCCAACAAATCCCTCCACACCCCCACTGGCTCCAACATGTCCCCCAACAAGCCCACCATCTCCAACATATCCACCAACAACCCCACTGGCTCCA
ACATATCCACCGACAACCCCATTGACTCCAACATATCCACCGACAACCCCACTGGCTCCAACATGTCCCCCGACAACCCCACCATCTCCAACATATCCCCCAACAACCCCAGCCAACAGA
TATCCACCGCGCTCCACACGAGTCGGGTTCTACAAGACTACATGCCCACAAGCTGAAGCCATTGTGCAGTCTGTGGTCCAGTCTGAGATTCGATCAAACCAGACATATGCACCTGGTATA
CTACGAATGTTCTTTCACGATTGCTTTGTCAATGGTTGTGATGAATCGGTCTTAATCGATGGCTCTTTTGCGGAGAAAACCGCAAGAGCAAATTCTCGTTTGAGAGGTTATGAAGTAATA
GATGCAGCAAAGTCCATGCTAGAAACCGTCTGTCCGGGGGTGGTCTCCTGTGCAGACATTCTTGCCCTCGCTGCTCGTGATTCTGTGGTCCAG
GTAATTAACCACTAGCTTCATACATGT
TTAATTTAAGCATTATACACGGATGGTAGAAAATCTATTTAAATATGTAGTTTTCTCCTTTCGTATTGTATGTCATCAGTTTTGTTATTGGCGGTTTAGTATTATTAATATTAGAGCATC
CACAATAGGATATTATCGGTAGGGGTGTTCAAGATCGGATAATCCGGTTTTCGGATATCCGAAAATTGGATATCCGAAATTTCGGATATCCGAAAATTGGATATCCGAAATTTCGGATTC
GGATACGGATATCTAATCGGATATCCGAATATCCAATTTTTTATTTAATTTTTATTTTTTTATTATTTTTTAATATTTGGAACCAGATTTTTCGGATAGTTTCGGATATCCGAATATAAA
TTTCGGATATTTTTCGGATATTTCGGATATTTTTTCGGATATTTCGGATATTTTTCGGATACTTCGGATATTTTTCGGATATTTCGGATATTTTTTCGGATACTTCGGATATTTTTCGGA
TACCTCGGATATTTTCGGATAATCCGATTATCCGAAAATTCTCAAAATCACTATCCGAATCTGAATCCGAATTTTCGGATTATCCGATTTTCGGATATTTCGGATGGTCTTAGAATTTTT
GTTTTTCTTGTCTACACTTTATGTTATTTGTTTGTCATACTTAATTTTTTTCTGAAAAAGAGGGTTATTTTTTTTTTTTGGCTGGGATCATGTTGGGTGTTGCATCTCGGTATCATGGTG
TACATGAAAGTTTTGCCCTCATTAATTCCTTGCTATGAGTAGAATCTTACTGAGTACGTTTATTTGTATTGTTTTAGACTGGGGGAAGTGGTTGGGCAGTGCCAACAGGTCGTCGAGACG
GATTAGTTTCACTGGCATCTGATGCAGAAAGCATACCTGGTCCTAAAGACTCCATTGATGACCAAATCAAGAAGTTTGCTAACAAAGGTCTTAGCATTGAAGATCTTGTTACCCTTGTAG
GTAAGTTAAGACTAAAAGCTAGAACAATAGCCATAACGACAAATTAACATTGGAATGGATTTAGTTTCAAATGAACTAACTTGCATATTTTGCGGTTTAATTCAATGATTATCAGGAGGA
CATATGATTGGGACAGCTGGCTGTGTCACATTCAGTGACAGGCTATACAACTACAACAATACTAATGCACCCGACCCTGCTATTGACCAAGGATTCCTTCCCCATCTTCAAACCCTATGT
CCTCTTAGCGGTGATCTTACAAGGCGAGTGGCCTTGGATACAAACAGCGAAAACAATTTCGACAACTCATTCTATGAAAACATAAGGCGTGGACGAGGAGTACTTGAATCCGATTCAAAG
CTGTGGAGTGACCCACGAACACAAAAGTTTGCGCAACCGTTTATTGGAGCTAGCAGATCACATGGATCGACATTCAACAAGATGTTCGCGATAGCAATGGTGAAGATGAGTAAAATTGAG
TTAAAGACAGGTAATCAAGGAGAAATTCGTAGGGTTTGTAATAGAATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGCAACGTCAATTCTCTTACCACCACCACCACCACCTACCAATGCTTGTCAACCCCCATATCCCCCGCCACCCACACCGACTCCAGCATATCCCACGCCACCCACACCGGCTTCA
ACAACTCCCCCGATCAGCCCACCGGCTCCAATATATCCCCCCAAAACCCCACCAGCTCCCACAACTCCCTCCACACCCCCACCGGCTCTGACAAATTCCTCCACACCCCCACCGGCTCCA
ACAAGTCCCCCGACAACCCCACCGGCTCCAACAAATCCCTCCACACCCCCACTGGCTCCAACATGTCCCCCAACAAGCCCACCATCTCCAACATATCCACCAACAACCCCACTGGCTCCA
ACATATCCACCGACAACCCCATTGACTCCAACATATCCACCGACAACCCCACTGGCTCCAACATGTCCCCCGACAACCCCACCATCTCCAACATATCCCCCAACAACCCCAGCCAACAGA
TATCCACCGCGCTCCACACGAGTCGGGTTCTACAAGACTACATGCCCACAAGCTGAAGCCATTGTGCAGTCTGTGGTCCAGTCTGAGATTCGATCAAACCAGACATATGCACCTGGTATA
CTACGAATGTTCTTTCACGATTGCTTTGTCAATGGTTGTGATGAATCGGTCTTAATCGATGGCTCTTTTGCGGAGAAAACCGCAAGAGCAAATTCTCGTTTGAGAGGTTATGAAGTAATA
GATGCAGCAAAGTCCATGCTAGAAACCGTCTGTCCGGGGGTGGTCTCCTGTGCAGACATTCTTGCCCTCGCTGCTCGTGATTCTGTGGTCCAG
ACTGGGGGAAGTGGTTGGGCAGTGCCA
ACAGGTCGTCGAGACGGATTAGTTTCACTGGCATCTGATGCAGAAAGCATACCTGGTCCTAAAGACTCCATTGATGACCAAATCAAGAAGTTTGCTAACAAAGGTCTTAGCATTGAAGAT
CTTGTTACCCTTGTAG
GAGGACATATGATTGGGACAGCTGGCTGTGTCACATTCAGTGACAGGCTATACAACTACAACAATACTAATGCACCCGACCCTGCTATTGACCAAGGATTCCTT
CCCCATCTTCAAACCCTATGTCCTCTTAGCGGTGATCTTACAAGGCGAGTGGCCTTGGATACAAACAGCGAAAACAATTTCGACAACTCATTCTATGAAAACATAAGGCGTGGACGAGGA
GTACTTGAATCCGATTCAAAGCTGTGGAGTGACCCACGAACACAAAAGTTTGCGCAACCGTTTATTGGAGCTAGCAGATCACATGGATCGACATTCAACAAGATGTTCGCGATAGCAATG
GTGAAGATGAGTAAAATTGAGTTAAAGACAGGTAATCAAGGAGAAATTCGTAGGGTTTGTAATAGAATTAATTAA

Retrieve as FASTA