Entry information : HaKat06 ( HanXRQChr12g0366381)
Entry ID 13671
Creation 2016-05-11 (Christophe Dunand)
Last sequence changes 2016-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaKat06 ( HanXRQChr12g0366381)
Name (synonym) HaKat06 ( HanXRQChr12g0366381)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaKat06
start..stop
S start..stop
HaKat01 962 0 1..492 1..492
PpeKat01 949 0 1..491 1..491
PdelKat01 947 0 1..491 1..491
PtKat01 946 0 1..491 1..491
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42730609..42730623 15 N° 2 42731551..42731647 97 N° 3 42731814..42732091 278 N° 4 42732173..42732949 777
N° 5 42733023..42733112 90 N° 6 42733283..42733350 68 N° 7 42733426..42733519 94 N° 8 42733607..42733663 57
join(42730609..42730623,42731551..42731647,42731814..42732091,42732173..42732949 ,42733023..42733112,42733283..42733350,42733426..42733519,42733607..42733663)


exon

Literature and cross-references HaKat06 ( HanXRQChr12g0366381)
DNA ref. HanXRQ genome:   HanXRQChr12 (42730609..42733663)
Cluster/Prediction ref. HanXRQ:   HanXRQChr12g0366381
Protein sequence: HaKat06 ( HanXRQChr12g0366381)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56823.13  
PI (pH):   %s   7.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSAYNAPFWTTNYGAPVYNNDSSLTVGTRGPILLEDYHFVEKLANFDRERIPERVVHARGASAKGFFEVTHDISALTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFIRDGMKFPDMVHSLKPNPKSHIQEDWRILDFFSHHPESLHMFTFLQDDVGVPQDYRHMDGSGVNTYTLINKTGKTHYVKFHWRPTCGVKCLLEDEAIKVGGMNHSHATKDLYDSIADGNYPEWKLFIQTMDPDHEDRFDFDPLDVTKTWPEDILPLQPVGRMVLNKNIDNFFAENEQLAFCPAIIVPGIYYSDDKLLQTRIFSYADTQRHRLGPNYLQLPANAPKCAHHNNHHDGFMNFMHRDEEVNYFPSRYDPVRHAEQYPIPPVMLSGKRNKCVIEKENNFKQPGERFRSWDPDRQERFIRRIVGALSDPRVTHEVCTIWVSYWSADKSLGQKIASRLNVKPSY

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTACAACAACACTCTAATGCTGTTTTTCAATGTTACATACCACTTCACCGTACGTAGTATTCAGCATCCTGTTCGATTCTTTCCTTAAGAAGAATCGTACCAACC
ACTTAGGTTATATATAATATATATGATCATCATCCTGCAATTTGTTGTGTATAATAATAAGTATATTAAAATTCATGTTTAGTTACTCTATTTCACATGATTTTGTGATTCAGTCAATCA
TTTATGTGAAAGTCTGTTGAATTATATTACCTTTGTCCTAATCATGAGATTAGTTTAACGTGAAATAGTTAATTTTGAACTCTAGTAATCGAATCCGATACATACAATACATACGCATTA
ATTTTCAGCCACGTAGGTTTGGTTATTATATAGAAGAACATGAAATAGTAGCCACCTTTTTCGTGTTAGTTTCTCGGAGTACTTACCTTCTAGCTTTGTCTTTAGTAGGATTGGTTTTGT
TATTAAAAAGGGGTTGCGAAGTAGCTTGTTGCCTGTTTCCCTGTCATTTTATTGTAATTGGTGGTTTTGATTTTACCATGAAACTAACAAAAGTAGCTTATTATTCATAACTTAATTGAT
TAGCTAACATATTGAAAAACATTGAAGATTCAGAGAGCATTTGGATTAATTTTTGGACTTATTGAGCTTGAGTTCCGGTTTAAAGGATTTGGAATATGCTATTAGCTAATTATCTCAACA
CTCATGGCAGAAAACATGTAAAAAAAATGTTTTAACTCGTTCTGATTTGGATTTAACACGTTTTAGCTACACAGTAAGAACCAATGTTTAAGTCATGTCGTTTTGCAGGATACCAACTGT
GCGAAAAAAGGATTCTTTAACCTTGTTGATTAGTTGCTGTATCAGTGTTGATTAACATTTTGTTGTGTTTACTCATTGATTTAAGTTTGTTGGTTGATGCAGTACCGTCCATCAAGCGCT
TACAATGCCCCGTTTTGGACCACTAATTATGGTGCTCCGGTTTACAACAACGACTCCTCATTGACAGTTGGCACCAGAG
GTAATCTAAATTTTATATATGTTAGTTCTTCGCTATAGAAG
CCGTCACATGACTCATTTTGAACTTGAGTAGTATCACTTTTGGTGTATCATGAAACTTAGCATACTAATTGCATATAGTGCATGAAAATATCAGTAGTAATCATAGTTTATTTTGCATAT
GATAGGCCCAATCCTTCTAGAAGATTACCATTTTGTGGAGAAACTAGCTAACTTCGACCGCGAACGTATACCCGAACGCGTGGTTCATGCCAGGGGTGCTAGTGCAAAGGGCTTTTTCGA
AGTCACACACGACATTTCTGCCCTCACATGTGCCGATTTTCTTCGCGCCCCTGGTGTCCAAACACCTGTTATCGTCCGTTTCTCTACTGTTATTCACGAGCGTGGAAGTCCAGAAACTCT
CAGAGATCCTAGAGGTTTCGCAGTCAAATTCTATACCCGAGAG
GTAACAATTAACACATATATAAAACATGTTGTCAAATGTACTTTAGCATGTTTAATCTTTACCGATCTTTTATAACG
ATAGGGAAACTTCGATTTGGTGGGAAACAATTTCCCCGTGTTCTTTATTCGCGACGGGATGAAGTTTCCGGACATGGTTCATTCACTAAAACCGAATCCTAAGTCACACATTCAAGAAGA
CTGGAGAATTCTCGACTTTTTCTCGCACCATCCCGAGAGTCTACACATGTTCACATTTCTTCAAGACGACGTTGGCGTGCCGCAAGATTACCGACACATGGACGGTTCTGGTGTCAACAC
CTACACTCTGATTAACAAAACCGGGAAAACACATTACGTGAAGTTTCACTGGAGACCGACATGCGGAGTAAAATGCTTGTTGGAGGACGAAGCCATCAAGGTTGGTGGAATGAATCACAG
CCACGCAACAAAAGATCTTTACGATTCTATTGCGGATGGGAATTATCCGGAATGGAAGCTTTTCATTCAGACTATGGATCCGGATCATGAGGATAGGTTTGACTTTGACCCGCTTGATGT
GACCAAGACCTGGCCCGAGGATATCTTGCCTTTGCAGCCTGTGGGTCGTATGGTTTTGAACAAGAACATTGATAACTTCTTTGCGGAGAATGAACAACTGGCGTTTTGCCCTGCGATCAT
TGTGCCTGGGATTTATTATTCGGATGATAAGCTGCTTCAAACGCGTATCTTCTCGTATGCTGACACGCAGAGGCATCGTCTTGGACCGAACTATTTGCAGCTTCCTGCTAACGCTCCTAA
GTGTGCTCATCATAATAATCATCATGATGGATTCATGAATTTCATGCACAGGGATGAGGAG
GTATACTCTCTATTTTTTCTGAAAAAAAAAATTTTCTTTTTTATTTACTAATCTTTTCT
TGTTATTTCCCCAGGTGAATTACTTCCCTTCAAGATACGATCCCGTTCGTCATGCTGAGCAGTACCCTATTCCTCCTGTAATGCTGTCAGGAAAGCGCAATAAGGTCCGTTTAGTTATTG
TTATATATATATTTTTTTCAAAGTTTGGCTACTAAACTTTTTATGATTTATGGATCACCTAAACAGTAGGAAACTGGTTACTAATGTAAACTCTTAATAAGCAACTAACTGACGGCTAGG
ACTTAATTTACTACAAATGTGTTGTCTAATGTAGTGTGTGATCGAGAAAGAGAACAACTTCAAGCAGCCAGGAGAGAGATTTAGATCCTGGGATCCAGATAGGTATATGTTTGCTTTAAA
ATGTTTCTAACCTTAATAATCATCTAACATGGTTTTCGTTTCTGTTTTTTCTTACAGACAAGAACGATTTATCCGCAGAATTGTCGGTGCTCTGTCTGATCCGCGTGTTACCCACGAGGT
CTGCACAATTTGGGTTTCATACTGGTCTCAG
GTTTGGACCTCCTTTCCTTGCCTTCACAGTTTGACCAACAATAACGGTTAATCGATTTGACAATATTGAATGCAAATTTTTTTGCAGGC
TGACAAGTCTCTTGGGCAGAAGATAGCTTCCCGCTTGAATGTGAAGCCAAGTTAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGTACCGTCCATCAAGCGCTTACAATGCCCCGTTTTGGACCACTAATTATGGTGCTCCGGTTTACAACAACGACTCCTCATTGACAGTTGGCACCAGAGGCCCAATC
CTTCTAGAAGATTACCATTTTGTGGAGAAACTAGCTAACTTCGACCGCGAACGTATACCCGAACGCGTGGTTCATGCCAGGGGTGCTAGTGCAAAGGGCTTTTTCGAAGTCACACACGAC
ATTTCTGCCCTCACATGTGCCGATTTTCTTCGCGCCCCTGGTGTCCAAACACCTGTTATCGTCCGTTTCTCTACTGTTATTCACGAGCGTGGAAGTCCAGAAACTCTCAGAGATCCTAGA
GGTTTCGCAGTCAAATTCTATACCCGAGAG
GGAAACTTCGATTTGGTGGGAAACAATTTCCCCGTGTTCTTTATTCGCGACGGGATGAAGTTTCCGGACATGGTTCATTCACTAAAACCG
AATCCTAAGTCACACATTCAAGAAGACTGGAGAATTCTCGACTTTTTCTCGCACCATCCCGAGAGTCTACACATGTTCACATTTCTTCAAGACGACGTTGGCGTGCCGCAAGATTACCGA
CACATGGACGGTTCTGGTGTCAACACCTACACTCTGATTAACAAAACCGGGAAAACACATTACGTGAAGTTTCACTGGAGACCGACATGCGGAGTAAAATGCTTGTTGGAGGACGAAGCC
ATCAAGGTTGGTGGAATGAATCACAGCCACGCAACAAAAGATCTTTACGATTCTATTGCGGATGGGAATTATCCGGAATGGAAGCTTTTCATTCAGACTATGGATCCGGATCATGAGGAT
AGGTTTGACTTTGACCCGCTTGATGTGACCAAGACCTGGCCCGAGGATATCTTGCCTTTGCAGCCTGTGGGTCGTATGGTTTTGAACAAGAACATTGATAACTTCTTTGCGGAGAATGAA
CAACTGGCGTTTTGCCCTGCGATCATTGTGCCTGGGATTTATTATTCGGATGATAAGCTGCTTCAAACGCGTATCTTCTCGTATGCTGACACGCAGAGGCATCGTCTTGGACCGAACTAT
TTGCAGCTTCCTGCTAACGCTCCTAAGTGTGCTCATCATAATAATCATCATGATGGATTCATGAATTTCATGCACAGGGATGAGGAG
GTGAATTACTTCCCTTCAAGATACGATCCCGTT
CGTCATGCTGAGCAGTACCCTATTCCTCCTGTAATGCTGTCAGGAAAGCGCAATAAG
TGTGTGATCGAGAAAGAGAACAACTTCAAGCAGCCAGGAGAGAGATTTAGATCCTGGGATCCA
GATAG
ACAAGAACGATTTATCCGCAGAATTGTCGGTGCTCTGTCTGATCCGCGTGTTACCCACGAGGTCTGCACAATTTGGGTTTCATACTGGTCTCAGGCTGACAAGTCTCTTGGGCAG
AAGATAGCTTCCCGCTTGAATGTGAAGCCAAGTTAC

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACAAAATAT ATAACCCCAA ACCACCTCTA AACATTAAAA CTCTCTCAAC ATCCCAACCA AAAAGTAGTC TTCTCCACAA GTAACCTGCA AATCAATGGA TCCTTACAAG TACCGTCCAT  CAAGCGCTTA CAATGCCCCG TTTTGGACCA CTAATTATGG TGCTCCGGTT TACAACAACG ACTCCTCATT GACAGTTGGC ACCAGAGGCC CAATCCTTCT AGAAGATTAC CATTTTGTGG  AGAAACTAGC TAACTTCGAC CGCGAACGTA TACCCGAACG CGTGGTTCAT GCCAGGGGTG CTAGTGCAAA GGGCTTTTTC GAAGTCACAC ACGACATTTC TGCCCTCACA TGTGCCGATT  TTCTTCGCGC CCCTGGTGTC CAAACACCTG TTATCGTCCG TTTCTCTACT GTTATTCACG AGCGTGGAAG TCCAGAAACT CTCAGAGATC CTAGAGGTTT CGCAGTCAAA TTCTATACCC  GAGAGGGAAA CTTCGATTTG GTGGGAAACA ATTTCCCCGT GTTCTTTATT CGCGACGGGA TGAAGTTTCC GGACATGGTT CATTCACTAA AACCGAATCC TAAGTCACAC ATTCAAGAAG  ACTGGAGAAT TCTCGACTTT TTCTCGCACC ATCCCGAGAG TCTACACATG TTCACATTTC TTCAAGACGA CGTTGGCGTG CCGCAAGATT ACCGACACAT GGACGGTTCT GGTGTCAACA  CCTACACTCT GATTAACAAA ACCGGGAAAA CACATTACGT GAAGTTTCAC TGGAGACCGA CATGCGGAGT AAAATGCTTG TTGGAGGACG AAGCCATCAA GGTTGGTGGA ATGAATCACA  GCCACGCAAC AAAAGATCTT TACGATTCTA TTGCGGATGG GAATTATCCG GAATGGAAGC TTTTCATTCA GACTATGGAT CCGGATCATG AGGATAGGTT TGACTTTGAC CCGCTTGATG  TGACCAAGAC CTGGCCCGAG GATATCTTGC CTTTGCAGCC TGTGGGTCGT ATGGTTTTGA ACAAGAACAT TGATAACTTC TTTGCGGAGA ATGAACAACT GGCGTTTTGC CCTGCGATCA  TTGTGCCTGG GATTTATTAT TCGGATGATA AGCTGCTTCA AACGCGTATC TTCTCGTATG CTGACACGCA GAGGCATCGT CTTGGACCGA ACTATTTGCA GCTTCCTGCT AACGCTCCTA  AGTGTGCTCA TCATAATAAT CATCATGATG GATTCATGAA TTTCATGCAC AGGGATGAGG AGGTGAATTA CTTCCCTTCA AGATACGATC CCGTTCGTCA TGCTGAGCAG TACCCTATTC  CTCCTGTAAT GCTGTCAGGA AAGCGCAATA AGTGTGTGAT CGAGAAAGAG AACAACTTCA AGCAGCCAGG AGAGAGATTT AGATCCTGGG ATCCAGATAG ACAAGAACGA TTTATCCGCA  GAATTGTCGG TGCTCTGTCT GATCCGCGTG TTACCCACGA GGTCTGCACA ATTTGGGTTT CATACTGGTC TCAGGCTGAC AAGTCTCTTG GGCAGAAGAT AGCTTCCCGC TTGAATGTGA  AGCCAAGTTA CTAAAGAGTA AGATCCGAAT AACATGTTAA CAAATCCGTC AGGTTGTGGT ATGCAAAGTA GTTTAGACTA GTCGTGTGAG TCGGTTATGC TATCGAATCT GGTGTTAAAA  GTTGTTAAGT CTTTTCTTTG GTTGTAGTAA TGTTGAATAG CTTATGTGAT AATGTTCTTG ACATGCCAAC TTTTGATGTA GTTCTAAGGT ATAACTTGGG GACGGTAATA TTACAAGTAA 
TGAAAAG 

Retrieve as FASTA