Entry information : HaKat08 ( HanXRQChr14g0427441)
Entry ID 13673
Creation 2016-05-11 (Christophe Dunand)
Last sequence changes 2016-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaKat08 ( HanXRQChr14g0427441)
Name (synonym) HaKat08 ( HanXRQChr14g0427441)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaKat08
start..stop
S start..stop
HaKat05 971 0 1..502 1..492
HaKat01 863 0 1..502 1..492
HaKat06 855 0 1..502 1..492
VvKat02 853 0 1..501 1..491
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4345187..4345201 15 N° 2 4346690..4346719 30 N° 3 4346840..4346936 97 N° 4 4347020..4347297 278
N° 5 4348090..4348866 777 N° 6 4349572..4349661 90 N° 7 4349940..4350007 68 N° 8 4350160..4350253 94
N° 9 4350701..4350757 57  
join(4345187..4345201,4346690..4346719,4346840..4346936,4347020..4347297,4348090 ..4348866,4349572..4349661,4349940..4350007,4350160..4350253,4350701..4350757)


exon

Literature and cross-references HaKat08 ( HanXRQChr14g0427441)
DNA ref. HanXRQ genome:   HanXRQChr14 (4345187..4350757)
Protein sequence: HaKat08 ( HanXRQChr14g0427441)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   502
PWM (Da):   %s   57521.67  
PI (pH):   %s   7.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKGSNLILPPPNQRPSSAYNAPFWTTNAGAPVYNNTAALTVGDRGPILLEDYHLIEKLANFTRERIPERIVHARGASAKGFFEVTHDITHLTCADFLRAPGVQTPTIVRFSTVIHERGSPETIRDPRGFATKFYTRGNFDIVGNNFPVFFTRDAMAFPDVIHAFKPNPKSHIQEDWRILDFLSHHPESLNTMTFWLDDVGIPSDYRHMEGSSVNALTLVNKDGKTHYVKFTWKPTCGVKCLLEDEAVKVGGNNHSHATQDLYDSIAAGKFPEWKLFVQVIDPDHEDRLDFDPLDGTMTWPEDVIPLQPVGRMVLNKNIDNFFAENEQLAFNPGLVVPGIYYSDDKMLQGWIFAYSDTQRHRLGPNYLQLPVNAPKCAHHNNHYDGNMNFMHRDEEVDYFPSRYDRVQHAQQYPISPVKLTGTRQRAVIPKYNDFKQPGERYRSWAPDRQERFICRMVKMLSDPRVTHELRSIWISYWSADKSLGQKIASRLNVRPNF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGGTACAACTCATCACTTCATCACTTGCCCTTTTTACCATTTTTGTACAACTATTTAATGCATGTATGTATCTTAGTAATTTTGTTTGAACCGTGACTTTTTTTTAG
TGATTCAATATCACACCGTCTAATATAAGATGCAATTATTAAAAAAGAAAACGAGAATATAGAAATTACCTGTTTAAAACAAATATTTTGTATATAAAATTGGGATTTTAATTGGAAATG
AATATCCAAGAAGGAGCTAAAAATTCTAAAAAAAATGTCCAAGAAGGAGCTAAAAATTCTAAAAAAAAATGTTTGTAAATGGTAAAAAAAAAATTTGATGGTGAACGAATAGAAGAAAAT
CAACCTAAAGGGTGTTTAAGTATTTTTTTTTTTACCATTTTCAAAGTCCTCCAATATTCTTTACTATTTTATATATAAAAAAACCACACAACATAACTTAATAAAAAAATTTACGTCATA
AAATCGAGAAATTGTTATCAATAATAAATGCACTGATAAAAAAAAATAAAGTTAAATTTTGATGATAATCAAATTAGAGGTAAGAAGGGGTTGGGCTGTGCTTAAACTCTGAACGCTCAT
ATGAGTTCGATTAAATTTAAACTCTAAAACGAGTGAGGTCTAGAACTCGTTTCAAACTTGATGTGTTTAATTCAATTTATCGATTCACACAGCATATTTCATTTCATTATCATATTAGGC
CATGTGTAGTCATAAAGCCCTCAAAGGGGCGTTATGCGACATGTGGCACTCCACGTCAGCGTGTGGGCGTTATGGGGCCTTATGCATTTTAAGCCCGTAGTCATAACGCCCCTACCTCAT
CATTACCCAATTATTTAATAAACCCTTAAATTATACATATATATATGTATGTATATATCTATGTGAGAGTGGAGAGAACACAAACCAAATGCATGGCGCCGCGAAAATTATCACGCCACC
TCCAAAAAATCGTTTGATGGCGCCCCGGGGGGCGGTGTGCCGGCGCTATACCGGCGCTATGAGGGCATACCGCCCAACTATGCCGCCCCACTACTGAAAGCCTTATGTATTTAGATAACA
CTTTTTATGAACCTAATCAAACACAAGACATGAAAAATAAAGTTTATTACAACATAATAAAGCATTCATTTTAAATAAAATTAAAAAGTAAATATTTTTGTTGATAATAAAAAAACATAA
AGTAAATAGTTTATCTTTTCTGTAAAGACGTCGGAGAGTTTATGTTCCCGCGCAAAAAAGAAAAAAAAAACACTCTCCTGCCATCGCCACCGCAATTATGTTAAAAATAGATAAATAATT
TATATAATGTTATATATAATAATTATAATCAAAATATCTATAAAATGTGCATGATTTAATTAGTAAATAATAAACTAGCCGAGCTCAAGCTTTACGAATAGGCTCGAAACGGGCTCAGTT
CAAGAAGCACACTTCTTGGCCTGACCGTTTCGAGATTTTGAACTGTATTATGTGACTGTGCAGGGTTCAAATCTCATCCTCCCTCCCCCGAATGTAAATAACTGAAAAACGGCTTCCTTT
GATTAAATTTCGTTGCAATAATCATGTCTTTGTAAGTAAGTTCCTTTGCACACTGGTTACATTTATCATACAAGTTTCTTTGATTTGGTGTAGCAACGCCCTTCGAGTGCTTACAATGCT
CCGTTTTGGACGACTAATGCTGGTGCACCGGTTTACAACAATACTGCAGCCTTGACTGTTGGAGACAGAG
GTAACTGTTTTATAGATATTTTGCTACTTGTCAGTTACATGTTGTTAGCA
TAATATGATCTGATTTACTGTTGTGCATGACAGGTCCAATTCTTCTTGAGGACTATCATTTAATAGAGAAACTTGCTAATTTCACTCGTGAACGGATCCCAGAACGCATTGTACACGCTA
GGGGCGCAAGTGCTAAGGGATTTTTTGAGGTTACACATGACATCACTCACCTTACATGTGCTGATTTCCTTCGTGCTCCTGGAGTCCAAACGCCTACTATTGTTCGTTTCTCGACTGTTA
TCCATGAGCGTGGTAGTCCCGAAACTATCAGGGACCCTAGAGGTTTTGCAACCAAGTTTTACACCAGAGAG
GTGAATCTTATTTCAATTAGTGAATTTGTTTATCCGTTTTTTTTCTTCT
TTAACCGTACTTTCATTTCAAATATAAAAATTTCGTTTTGATCTAGTTAGAGGTGACAATTTAGGCTCGTTTAGTTATTGACGAGTTGATTTGGCTTGCGTCTTTTTTTCAAATGAGTAA
ATAAATAAAATTAGCTAAAAGGAGAACGGGCCAAACGGGTCATATAGAACGATTGTTATATAAAACGATTATTGCCCAAAGTCTATTTAAACTGCATACAATCTTCTGAATTGTTTTATA
AAACGATTAAATAGTTAACATAAGGATATCTTTTTATCATAACTAATACACTGGTTCTTTTATAAATACGTTAAGAAATGGACAAAGAAGCGTTAAAACCATAGTTGTTAATAGCATAGC
GATGCGATACTATATATGCCGCTATCTGATTTTTTGCGCCTTAAACACGAGGAAATAGCGGGAAAATAGTTTTTTTATTCTTTTTAGTAAATACATGTAGCGACTGAAAAAATAAGCGTA
TTTTAGGGTTTTTTGTTGCAGGATTGAAAATAGAAGCGTATATACTTCCATATTTACCAGATTTTTTTATAAAATATACATGTAAAATATTTCTAAAGTTTTCTTCTAGTGTATCGCTAA
ATATGAAATAGCACCCACTATTTCATCGCCATCGCTACATAGCGTGTAGGTAGCTTGTCGCTCGCTATTGACAACTCTGAACCTGTTATGACCCATCTATCTTGCCACCTTAGTGAATTT
GATATATGTTTCTAAATTTGCAGGGTAACTTTGATATTGTGGGAAACAACTTTCCCGTGTTCTTTACTCGCGACGCAATGGCTTTCCCAGACGTGATCCACGCGTTTAAACCGAACCCAA
AGTCACACATTCAAGAAGACTGGAGAATCCTCGACTTCCTCTCACACCATCCCGAGAGTTTAAACACTATGACGTTCTGGCTTGACGATGTTGGCATACCATCAGATTACCGACACATGG
AAGGCTCGAGTGTTAACGCTCTCACTTTAGTCAACAAAGACGGGAAAACACATTACGTGAAGTTTACATGGAAGCCAACATGCGGCGTGAAGTGTCTTTTAGAAGATGAAGCGGTTAAAG
TTGGCGGAAATAATCACAGTCACGCCACACAAGATTTATACGACTCGATTGCAGCCGGTAAGTTTCCCGAGTGGAAGCTGTTTGTTCAAGTTATTGATCCTGATCATGAAGATAGGCTTG
ACTTTGACCCGCTTGATGGGACGATGACATGGCCCGAGGATGTGATACCGCTGCAGCCAGTTGGACGTATGGTGTTGAATAAGAATATTGATAACTTCTTTGCAGAAAATGAGCAGCTGG
CGTTTAATCCGGGCCTTGTTGTTCCTGGAATATATTATTCTGATGATAAGATGCTTCAAGGTTGGATCTTTGCGTATTCGGATACGCAAAGGCATCGTTTAGGACCGAATTATCTGCAGT
TACCTGTTAATGCTCCAAAATGTGCTCATCATAATAATCACTATGATGGAAATATGAATTTCATGCATAGAGATGAGGAG
GTATTATGCCAATTGTCTATTCATCTTTCATTAGAGAGTA
AAGTACACAGATGGTCCCTATGGTTTGCACTTTGTAACGCATTTAGTCCCCAGCTTTTTCAAAAAGTACATGAATGGTCCCTGTAGTTTGCACTTTGTAACACATTTAGTCCTCAGTTTT
TTTTCGAAAAGTACATGAATGGTCCATGTGGCTTGCACTTTGTAACGCATTTAGTCTCCACCTTTTTCAAAAAGCACATGACTGGTCCCTGTGGTTGCACTTTGTAACGCATTTAGTCCC
TAACTTGGACATGCTAAAACCTTTAGATTTGTTGGCTGGGGACTAAATGCGTTACAAAGTGCAAACCACAGGGACCGTCCGTGTAATTTTGGAAAGTTAGGGACCAAATCCAAAATTTTG
GTAAACCACAGGGACCATCCGTGTACTTTACTCTTAATTAGAGGTGGTAACATGGACAGGCGTGTGGGTTAGGTAACAGCCAACGGGTCAAAATAGGTTCAGGTTAAAACAATGTTTTTT
CTACTACAGGGCGAAATGGGCCCCATTGGGTTCGGTTGACCCCCGAGTCAAGTGTTAGGAAGTTGACCGACTTCCAATCTGTTTGACCCGTTCTACCCATTCCCTTTTGGCTATTTGCTT
CGTTCAGATAAAATACCATCCGAATTGACCCATTCATAAGTAACTGGATTATTATATTGTTCCAGGTTGATTACTTCCCTTCGAGGTATGATCGTGTTCAACATGCTCAGCAGTATCCGA
TTTCCCCTGTTAAGCTAACTGGAACCCGTCAAAGG
GTTAGTTATTTTGTGTTTTCTTTATTGTATCAGGCCGGTTTATATTTTTGATATTTAAGATGATCTCAAAATCAAGTCATTGACT
TTTAAACAGTCAAACTTGGGGTTTCATCGCCAATAGTCCTTCGTCCTTAGTTTTTCCAAAACATGAAAAAAAAAATTTTAAAATTAAAATATAAAAATGTTGAATATATGTTTGGTGCAC
GGTCTGTTATCCCAGATATCAAACACTTGACGACCTGTAGTTGTTACGTAAAAATTCTGTTATTTTCGTGCAGGCTGTTATCCCAAAATACAATGATTTTAAGCAGCCAGGGGAGAGATA
CCGATCATGGGCACCGGACAG
GTACTATTTACTTTCTATTATATTATATTAAATTTAAACGAATATGTCGTAATTACAAGAATAAATAATGCATGTGCAATATTTTTTCTATATAAACAT
ATAGCATTAGATTTGGTCATTTGATGGTCAAATTGAGTATATTATTTGTACAGGCAAGAAAGGTTCATTTGCCGAATGGTGAAGATGTTGTCTGACCCACGGGTCACCCATGAGCTCCGC
AGCATTTGGATCTCATACTGGTCTCAG
GTTCGTTCACCTCCCCCTCTTTGGTCCATTTCAAATAAAGGTTGACTTTTGAAGTTAAAAAGCAATTTTGTTTGACATCAGAATTCAAATTTA
TATCTGGATATAGTGAATGCTCGATCAAGTGGATACATACTCTGACCCAACCTGATTCGTAATAACGCGTTGGTTCAGAATATGTAATTTTAGATATGGGTCATGTTGGGTTGACACGAA
ACACTATGTCCAAGTTTCTTTTAATATTCTTTTGAGTAATTAGCATCAAATGTGATTACAAAAATATTATTTCAACCGTAGTCTAATTCTTTTAATAGAAATATTTAGGATATTTTATAC
ATTAAAACTACATTTTGGGCGCCTTTTGACCCATATTTAACATAACTCGGATTGACTTGTTTATAAGTAAATGGGTTGAAAATGCGTACTTGATTTGGGCTGGTATTCTTGCAGGCTGAC
AAATCACTGGGGCAGAAAATAGCTTCACGCCTCAACGTGCGCCCTAACTTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGGGTTCAAATCTCATCCTCCCTCCCCCGAATCAACGCCCTTCGAGTGCTTACAATGCTCCGTTTTGGACGACTAATGCTGGTGCACCGGTTTACAACAATACTGCA
GCCTTGACTGTTGGAGACAGAG
GTCCAATTCTTCTTGAGGACTATCATTTAATAGAGAAACTTGCTAATTTCACTCGTGAACGGATCCCAGAACGCATTGTACACGCTAGGGGCGCAAGT
GCTAAGGGATTTTTTGAGGTTACACATGACATCACTCACCTTACATGTGCTGATTTCCTTCGTGCTCCTGGAGTCCAAACGCCTACTATTGTTCGTTTCTCGACTGTTATCCATGAGCGT
GGTAGTCCCGAAACTATCAGGGACCCTAGAGGTTTTGCAACCAAGTTTTACACCAGAGAG
GGTAACTTTGATATTGTGGGAAACAACTTTCCCGTGTTCTTTACTCGCGACGCAATGGCT
TTCCCAGACGTGATCCACGCGTTTAAACCGAACCCAAAGTCACACATTCAAGAAGACTGGAGAATCCTCGACTTCCTCTCACACCATCCCGAGAGTTTAAACACTATGACGTTCTGGCTT
GACGATGTTGGCATACCATCAGATTACCGACACATGGAAGGCTCGAGTGTTAACGCTCTCACTTTAGTCAACAAAGACGGGAAAACACATTACGTGAAGTTTACATGGAAGCCAACATGC
GGCGTGAAGTGTCTTTTAGAAGATGAAGCGGTTAAAGTTGGCGGAAATAATCACAGTCACGCCACACAAGATTTATACGACTCGATTGCAGCCGGTAAGTTTCCCGAGTGGAAGCTGTTT
GTTCAAGTTATTGATCCTGATCATGAAGATAGGCTTGACTTTGACCCGCTTGATGGGACGATGACATGGCCCGAGGATGTGATACCGCTGCAGCCAGTTGGACGTATGGTGTTGAATAAG
AATATTGATAACTTCTTTGCAGAAAATGAGCAGCTGGCGTTTAATCCGGGCCTTGTTGTTCCTGGAATATATTATTCTGATGATAAGATGCTTCAAGGTTGGATCTTTGCGTATTCGGAT
ACGCAAAGGCATCGTTTAGGACCGAATTATCTGCAGTTACCTGTTAATGCTCCAAAATGTGCTCATCATAATAATCACTATGATGGAAATATGAATTTCATGCATAGAGATGAGGAG
GTT
GATTACTTCCCTTCGAGGTATGATCGTGTTCAACATGCTCAGCAGTATCCGATTTCCCCTGTTAAGCTAACTGGAACCCGTCAAAGG
GCTGTTATCCCAAAATACAATGATTTTAAGCAG
CCAGGGGAGAGATACCGATCATGGGCACCGGACAG
GCAAGAAAGGTTCATTTGCCGAATGGTGAAGATGTTGTCTGACCCACGGGTCACCCATGAGCTCCGCAGCATTTGGATCTCATAC
TGGTCTCAG
GCTGACAAATCACTGGGGCAGAAAATAGCTTCACGCCTCAACGTGCGCCCTAACTTT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGTTTGCAA GGGACCATAG ATATTCACAA GATCACAAGA CAGCTTTGAT TCTCGTTATT CTTGTCCCTC AGCATGGATC CGTACAAGGG TTCAAATCTC ATCCTCCCTC CCCCGAATCA  ACGCCCTTCG AGTGCTTACA ATGCTCCGTT TTGGACGACT AATGCTGGTG CACCGGTTTA CAACAATACT GCAGCCTTGA CTGTTGGAGA CAGAGGTCCA ATTCTTCTTG AGGACTATCA  TTTAATAGAG AAACTTGCTA ATTTCACTCG TGAACGGATC CCAGAACGCA TTGTACACGC TAGGGGCGCA AGTGCTAAGG GATTTTTTGA GGTTACACAT GACATCACTC ACCTTACATG  TGCTGATTTC CTTCGTGCTC CTGGAGTCCA AACGCCTACT ATTGTTCGTT TCTCGACTGT TATCCATGAG CGTGGTAGTC CCGAAACTAT CAGGGACCCT AGAGGTTTTG CAACCAAGTT  TTACACCAGA GAGGGTAACT TTGATATTGT GGGAAACAAC TTTCCCGTGT TCTTTACTCG CGACGCAATG GCTTTCCCAG ACGTGATCCA CGCGTTTAAA CCGAACCCAA AGTCACACAT  TCAAGAAGAC TGGAGAATCC TCGACTTCCT CTCACACCAT CCCGAGAGTT TAAACACTAT GACGTTCTGG CTTGACGATG TTGGCATACC ATCAGATTAC CGACACATGG AAGGCTCGAG  TGTTAACGCT CTCACTTTAG TCAACAAAGA CGGGAAAACA CATTACGTGA AGTTTACATG GAAGCCAACA TGCGGCGTGA AGTGTCTTTT AGAAGATGAA GCGGTTAAAG TTGGCGGAAA  TAATCACAGT CACGCCACAC AAGATTTATA CGACTCGATT GCAGCCGGTA AGTTTCCCGA GTGGAAGCTG TTTGTTCAAG TTATTGATCC TGATCATGAA GATAGGCTTG ACTTTGACCC  GCTTGATGGG ACGATGACAT GGCCCGAGGA TGTGATACCG CTGCAGCCAG TTGGACGTAT GGTGTTGAAT AAGAATATTG ATAACTTCTT TGCAGAAAAT GAGCAGCTGG CGTTTAATCC  GGGCCTTGTT GTTCCTGGAA TATATTATTC TGATGATAAG ATGCTTCAAG GTTGGATCTT TGCGTATTCG GATACGCAAA GGCATCGTTT AGGACCGAAT TATCTGCAGT TACCTGTTAA  TGCTCCAAAA TGTGCTCATC ATAATAATCA CTATGATGGA AATATGAATT TCATGCATAG AGATGAGGAG GTTGATTACT TCCCTTCGAG GTATGATCGT GTTCAACATG CTCAGCAGTA  TCCGATTTCC CCTGTTAAGC TAACTGGAAC CCGTCAAAGG GCTGTTATCC CAAAATACAA TGATTTTAAG CAGCCAGGGG AGAGATACCG ATCATGGGCA CCGGACAGGC AAGAAAGGTT  CATTTGCCGA ATGGTGAAGA TGTTGTCTGA CCCACGGGTC ACCCATGAGC TCCGCAGCAT TTGGATCTCA TACTGGTCTC AGGCTGACAA ATCACTGGGG CAGAAAATAG CTTCACGCCT  CAACGTGCGC CCTAACTTTT AAACTGATCT ACACGTCATT ACAGGAAAGG GTCTCTCTCG TTGTCTGTTA ACAGAAAGCA TGGTTTTATC ATCACAGCGT CGTACTGTTT TAATTATGTA  ATGTTTTATG AACCTAGGAC TTAGAATAAA AGCTTTGGTG TTCTAGGTTA AGTTTGAAGC TAAAAACATG TGGCATGCAT GTAGTCTAAG TTGCTTTTTT ACATGTAATA TAAGTAATGT  TGTTGCTTAT GTTGATTTTG GTTCTTGTTT TGTTCTTCAT CGTCATCAAA TAAGTTTTAT GTACAACCAA GTAAGCTTTG TGTACGACTA AAAGCCATAC AACTCTCCTC TTTTACATAT  TAGCCTTTGT AATCTAGTAA ACTATTCACA ATAAGTTCAT CTTGCTTTGT TCTTCATTGT CGCAACGTCG TTTTCTTTTT TACCTCTCTA ATTGATGCAA CCACAATCAA AGCTGCCCCG 
TCAAGCGTGA CTCTACCACG TGTTGTATAC ACCGCCAGCG ACTTTTGG 

Retrieve as FASTA