Entry information : HaFer05 (HanXRQChr16g0509631)
Entry ID 13701
Creation 2016-05-12 (Christophe Dunand)
Last sequence changes 2017-12-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-08 (Christophe Dunand)
Peroxidase information: HaFer05 (HanXRQChr16g0509631)
Name (synonym) HaFer05 (HanXRQChr16g0509631)
Class Ferritin    [Orthogroup: Fer003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaFer05
start..stop
S start..stop
HaFer04 507 0 1..247 1..247
ThasFer04 341 6e-120 33..240 51..257
SpolFer02 339 3e-119 26..245 42..261
ThasFer01-1 336 7e-118 19..246 42..264
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 64606794..64607056 263 N° 2 64607699..64607782 84 N° 3 64607855..64607915 61 N° 4 64608054..64608141 88
N° 5 64608256..64608317 62 N° 6 64608464..64608529 66 N° 7 64608611..64608674 64 N° 8 64608952..64609004 53
join(64606794..64607056,64607699..64607782,64607855..64607915,64608054..64608141 ,64608256..64608317,64608464..64608529,64608611..64608674,64608952..64609004)


exon

Literature and cross-references HaFer05 (HanXRQChr16g0509631)
DNA ref. HanXRQ genome:   HanXRQChr16 (64606794..64609004)
Protein sequence: HaFer05 (HanXRQChr16g0509631)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   247
PWM (Da):   %s   27700.01  
PI (pH):   %s   5.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLQTPFSSASPFLLKNLGKSIGFVRSGVVRCGSSVGEENLVMSSGVLFQPFEEVKKEEFIVPISPQKSLARQRYFDEPEAAINEQINVEYNVSYVYHALYAYFDRDNIALKGLAKFFKESSEEEREHAEKLMQYNMRGGRVKLNTIVAPPSEFEHVEKGDALYAMELALSLEKLVNEKLLCLHVADRNNDPQMADFIESEFLVEQVEAIKKISEYVSQLRRVGKGHGVWHFDQMLLDGGGAAA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTTCAAACACCATTCTCATCAGCATCACCATTTTTGTTGAAGAATCTGGGAAAATCGATCGGATTTGTGAGATCAGGGGTTGTGCGTTGTGGATCAAGTGTTGGTGAGGAGAAT
CTGGTGATGAGTAGTGGAGTGTTGTTTCAGCCGTTTGAAGAAGTAAAGAAGGAGGAGTTTATTGTGCCGATTTCGCCTCAAAAATCGCTTGCTCGTCAACGCTATTTTGATGAGCCTGAA
GCTGCCATTAACGAGCAAATTAA
GTAAGTTTTTCATTTTTTTATATGAAAAAACTGTGATATGTACATTTTTTTTTTGTATTCGATATATTGTTTATTTGGTGCTTACCTGGAGACATAG
ACACCTCTTTTCATGTAATTACTTTTTAAAATCCAGATATATGTTAGAATTGAAAAAGACCGAAGAAACAGTGAGTTTTGAGTGTGTTAATTGGAATTTGAAATGAAAGTGCTCAACAAG
ATTTAATATATTTATTTATTGTAGACATATGTGATGATAGTTCATAGTTTTTGAATTTTAGTTACTTTTTTCGTCTATGTGATTTGTCAAAAATCACTATTTCAGTCCATTAGTTTAAAA
ATTACGATTTGAGTCCCTGTGGTTTCACTTTGGTAACCATCTCAGTCCATCTCGTAACCATTTCAGTCCCTGTACTAACAAAATAAATGGATTGAAATGGTTATGAAAGTAAAACTACAG
GGACTGAAATGGTTACGAAAGTGAAACCATAGGGACTGAAATCGCAAATTTTAAACTAATGGACTGAAGTAGTGATTTTTGACATACCAAAGGAACGAAAACAGTAGTTAACTCTACTTT
TAACTATATTATTGGAACTTTTAGCTTATGATTGGGTTTATTTTGTTTCTTTGTTAATGATGCAGTGTGGAATATAATGTCTCCTATGTGTACCATGCTTTGTATGCTTACTTTGATCGG
GACAACATAGCACTGAAGGGCCTTGCCAA
GTAAACAAATCACATAAACTCCAACCCCTTTTTATCTTTACATGCTTATAAACTTTCTTTTGTTTTTATCAGGTTCTTCAAGGAATCAAGT
GAAGAAGAAAGAGAACATGCTGAGAAGTTAATGCAATATCAG
GTCTTTTTCGCACTATTATTATTTTATAAGATTTTTAAACAACATAGTAATTAGTTCCTTTTATGCAAATCCCATTGT
TATACACACACATATATACATAAACATATACATCAGCAACTAAACCTTATATCTTTGTAGAATATGAGAGGTGGAAGAGTGAAGTTGAACACCATAGTTGCGCCACCTTCAGAGTTTGAA
CATGTGGAAAAGGGAGATGCTTTATATG
GTAAGCACAACTCAGAAATTACCCATCAAGTACAATAATGATTTCAACTTAATTAGCAGTTGTTTAACAAATATTCATCCTTATTTCGCCTT
TAATTTATAAATTATCTGTCAGCAATGGAGCTAGCGTTGTCTTTGGAGAAACTAGTCAATGAAAAGCTTCTTTGTTTGCACGCGGTATGCCGTTTTATCTTGATATTTAAGTATTTTATA
TATCTCACATGATAACTAATGCTTGAGGAAGAACTTATCCCCAAATCCGGATCATGACACCTTGTCATACATACACTATGTTAAATATAAATGTGTTTTCCAAATTGAAGGTGGCTGATA
GGAACAATGATCCGCAAATGGCAGACTTCATTGAGAGCGAGTTTCTTGTTGAGCAG
GTGAAACTCCTAGTTGTTGATATATAAGTGTGTGTGATATATAAAAGTCTAATCTGCATTACTT
TTTATGTTGTGTGGCAGGTTGAAGCAATAAAGAAAATTTCAGAATATGTTTCTCAACTGAGAAGAGTAGGGAAAGGCCATGGTAAGATTATTATCCTTATGACTTGTAACTTATTCAACA
TACAATACAAGAGCAAAACTGTTTGGTCAACCTGATTAGTTATAGTTCATTTCAAACATGACTCGTTTATCAAATGGGTTAAAATGTCATTAAAATGATTCCAAAAGTAAAAAAGGGGTT
GATAGATTGTAATCGTGTTGTAAACGAGGTTAGTGGGTCGTACTTGTAAAACGATGTTTATTCAGAACTTTTTTACATTTAAATGGGCTAGTGGGTTGACTAACAATTTGAACTGCAGGG
GTATGGCATTTTGATCAGATGCTTCTTGATGGGGGTGGTGCTGCTGCTGTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTTCAAACACCATTCTCATCAGCATCACCATTTTTGTTGAAGAATCTGGGAAAATCGATCGGATTTGTGAGATCAGGGGTTGTGCGTTGTGGATCAAGTGTTGGTGAGGAGAAT
CTGGTGATGAGTAGTGGAGTGTTGTTTCAGCCGTTTGAAGAAGTAAAGAAGGAGGAGTTTATTGTGCCGATTTCGCCTCAAAAATCGCTTGCTCGTCAACGCTATTTTGATGAGCCTGAA
GCTGCCATTAACGAGCAAATTAA
TGTGGAATATAATGTCTCCTATGTGTACCATGCTTTGTATGCTTACTTTGATCGGGACAACATAGCACTGAAGGGCCTTGCCAAGTTCTTCAAGGAA
TCAAGTGAAGAAGAAAGAGAACATGCTGAGAAGTTAATGCAATATCAG
AATATGAGAGGTGGAAGAGTGAAGTTGAACACCATAGTTGCGCCACCTTCAGAGTTTGAACATGTGGAAAAG
GGAGATGCTTTATATG
CAATGGAGCTAGCGTTGTCTTTGGAGAAACTAGTCAATGAAAAGCTTCTTTGTTTGCACGCGGTGGCTGATAGGAACAATGATCCGCAAATGGCAGACTTCATT
GAGAGCGAGTTTCTTGTTGAGCAG
GTTGAAGCAATAAAGAAAATTTCAGAATATGTTTCTCAACTGAGAAGAGTAGGGAAAGGCCATGGGGTATGGCATTTTGATCAGATGCTTCTTGAT
GGGGGTGGTGCTGCTGCTGTT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCCTCCTCC TCATCAGATC AAAACACACA CACACACACA CACACACACA CATTGATAAC AAAATGTCTC TTCAAACACC ATTCTCATCA GCATCACCAT TTTTGTTGAA GAATCTGGGA  AAATCGATCG GATTTGTGAG ATCAGGGGTT GTGCGTTGTG GATCAAGTGT TGGTGAGGAG AATCTGGTGA TGAGTAGTGG AGTGTTGTTT CAGCCGTTTG AAGAAGTAAA GAAGGAGGAG  TTTATTGTGC CGATTTCGCC TCAAAAATCG CTTGCTCGTC AACGCTATTT TGATGAGCCT GAAGCTGCCA TTAACGAGCA AATTAATGTG GAATATAATG TCTCCTATGT GTACCATGCT  TTGTATGCTT ACTTTGATCG GGACAACATA GCACTGAAGG GCCTTGCCAA GTTCTTCAAG GAATCAAGTG AAGAAGAAAG AGAACATGCT GAGAAGTTAA TGCAATATCA GAATATGAGA  GGTGGAAGAG TGAAGTTGAA CACCATAGTT GCGCCACCTT CAGAGTTTGA ACATGTGGAA AAGGGAGATG CTTTATATGC AATGGAGCTA GCGTTGTCTT TGGAGAAACT AGTCAATGAA  AAGCTTCTTT GTTTGCACGC GGTGGCTGAT AGGAACAATG ATCCGCAAAT GGCAGACTTC ATTGAGAGCG AGTTTCTTGT TGAGCAGGTT GAAGCAATAA AGAAAATTTC AGAATATGTT  TCTCAACTGA GAAGAGTAGG GAAAGGCCAT GGGGTATGGC ATTTTGATCA GATGCTTCTT GATGGGGGTG GTGCTGCTGC TGTTTGAAGA ATTTGGGTAG TCTAGCTAAT GGCATTAGGT 
GTGTGTTTGA TGGTGTTTAA TTCAGTTTAG TAACTACTAT GAATCACGGG CTGTGGTTTC CGGTGAAGTT ATGTTATATG TTGGCTAG 

Retrieve as FASTA