Entry information : HaUCC05 (HanXRQChr09g0252821)
Entry ID 13715
Creation 2016-05-13 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaUCC05 (HanXRQChr09g0252821)
Name (synonym) HaUCC05 (HanXRQChr09g0252821)
Class Uclacyanin    [Orthogroup: UCC002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaUCC05
start..stop
S start..stop
HaUCC03 144 4e-44 25..172 23..198
AtUCC05 143 6e-44 1..156 1..160
ThasUCC05 142 2e-43 11..173 13..174
AtUCC01 104 4e-28 1..155 1..150
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 115750785..115750956 172 N° 2 115751046..115751422 377  
join(115750785..115750956,115751046..115751422)


exon

Literature and cross-references HaUCC05 (HanXRQChr09g0252821)
DNA ref. HanXRQ genome:   HanXRQChr09 (115750785..115751422)
Cluster/Prediction ref. HanXRQ:   HanXRQChr04g0110241
Protein sequence: HaUCC05 (HanXRQChr09g0252821)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   183 (163)
PWM (Da):   %s   19727.63 (17506.4) Transmb domain:   %s   i7-29o160-182i (i7-29o160-182i)
PI (pH):   %s   4.29 (4.08) Peptide Signal:   %s   cut: 21 range:21-183
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNMKKQLVFVVLAIIAFGFAITSDANTYIVGDNSGWHISTNLDTWEQGKKFVVGDVLVFQYASTDSVCEVGQESFRTCNTTNVINCFSDGNTSIPLTSPGERYFFCGNRLYCYSGMKLDVIVERNQSDTTEAPLSSVPETESGGSKNNNPSTIVPSGVESIYAGSNLVLMGLLGFWGVLISI

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACATGAAAAAGCAACTTGTATTTGTGGTTCTTGCTATCATAGCCTTTGGGTTCGCAATAACATCTGATGCTAACACGTATATAGTTGGGGACAACTCGGGTTGGCACATTAGCACG
AATCTGGATACGTGGGAGCAAGGGAAGAAGTTCGTCGTCGGTGATGTCTTAG
GTAACTATTTCTTTCTATGATTTTATTCTTTCTGTAGTTTTAGCGTTTAATAGTTTGATGTTATGAAT
AATTTATTTTCTTTTGTGCAGTTTTTCAGTACGCGTCCACAGATAGTGTTTGTGAGGTAGGCCAAGAGAGTTTTCGAACATGCAACACGACGAACGTCATAAACTGTTTTAGTGATGGGA
ACACGTCTATTCCTCTTACGAGTCCCGGAGAAAGATATTTCTTTTGTGGTAATAGGTTGTACTGCTATTCAGGAATGAAGCTCGATGTGATAGTGGAAAGAAACCAATCGGATACAACGG
AGGCACCTCTTAGTAGTGTACCCGAGACAGAGAGTGGTGGATCAAAGAACAATAATCCTTCAACCATTGTACCTAGTGGAGTTGAGTCTATTTATGCAGGATCAAATTTAGTCTTGATGG
GACTTTTAGGGTTTTGGGGTGTTTTGATCTCAATCGTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACATGAAAAAGCAACTTGTATTTGTGGTTCTTGCTATCATAGCCTTTGGGTTCGCAATAACATCTGATGCTAACACGTATATAGTTGGGGACAACTCGGGTTGGCACATTAGCACG
AATCTGGATACGTGGGAGCAAGGGAAGAAGTTCGTCGTCGGTGATGTCTTAG
TTTTTCAGTACGCGTCCACAGATAGTGTTTGTGAGGTAGGCCAAGAGAGTTTTCGAACATGCAACACG
ACGAACGTCATAAACTGTTTTAGTGATGGGAACACGTCTATTCCTCTTACGAGTCCCGGAGAAAGATATTTCTTTTGTGGTAATAGGTTGTACTGCTATTCAGGAATGAAGCTCGATGTG
ATAGTGGAAAGAAACCAATCGGATACAACGGAGGCACCTCTTAGTAGTGTACCCGAGACAGAGAGTGGTGGATCAAAGAACAATAATCCTTCAACCATTGTACCTAGTGGAGTTGAGTCT
ATTTATGCAGGATCAAATTTAGTCTTGATGGGACTTTTAGGGTTTTGGGGTGTTTTGATCTCAATCGTG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATATTGAAGC ATGAACATGA AAAAGCAACT TGTATTTGTG GTTCTTGCTA TCATAGCCTT TGGGTTCGCA ATAACATCTG ATGCTAACAC GTATATAGTT GGGGACAACT CGGGTTGGCA  CATTAGCACG AATCTGGATA CGTGGGAGCA AGGGAAGAAG TTCGTCGTCG GTGATGTCTT AGTTTTTCAG TACGCGTCCA CAGATAGTGT TTGTGAGGTA GGCCAAGAGA GTTTTCGAAC  ATGCAACACG ACGAACGTCA TAAACTGTTT TAGTGATGGG AACACGTCTA TTCCTCTTAC GAGTCCCGGA GAAAGATATT TCTTTTGTGG TAATAGGTTG TACTGCTATT CAGGAATGAA  GCTCGATGTG ATAGTGGAAA GAAACCAATC GGATACAACG GAGGCACCTC TTAGTAGTGT ACCCGAGACA GAGAGTGGTG GATCAAAGAA CAATAATCCT TCAACCATTG TACCTAGTGG  AGTTGAGTCT ATTTATGCAG GATCAAATTT AGTCTTGATG GGACTTTTAG GGTTTTGGGG TGTTTTGATC TCAATCGTGT AATTTGATTA TTTATGCACT TTGTAATATG TTATATTCGT 
TTGACATGAT ATTGAATTTA TTGTGATTTT GAC 

Retrieve as FASTA