Entry information : HaUCC02 (HanXRQChr06g0178001)
Entry ID 13718
Creation 2016-05-13 (Christophe Dunand)
Last sequence changes 2016-05-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaUCC02 (HanXRQChr06g0178001)
Name (synonym) HaUCC02 (HanXRQChr06g0178001)
Class Uclacyanin    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaUCC02
start..stop
S start..stop
HaSTC17 105 3e-29 1..122 1..117
HaSTC17 68 0.000000000000005 46..132 171..262
HaSTC28 93 1e-23 35..121 280..364
HaSTC28 93 1e-23 1..121 2..124
HaSTC28 92 3e-23 35..121 161..245
HaSTC24 87 2e-23 34..122 39..125
HaSTC32 90 4e-23 35..121 159..242
HaSTC32 88 2e-22 1..121 1..122
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45930395..45930551 157 N° 2 45931385..45931629 245  
join(45930395..45930551,45931385..45931629)


exon

Literature and cross-references HaUCC02 (HanXRQChr06g0178001)
DNA ref. HanXRQ genome:   HanXRQChr06 (45930395..45931629)
Protein sequence: HaUCC02 (HanXRQChr06g0178001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   134 (113)
PWM (Da):   %s   14853.77 (12669.6)  
PI (pH):   %s   9.69 (9.46) Peptide Signal:   %s   cut: 22 range:22-134
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANKMLGIFILIATIVAQANAAQKHEIYWKYGKKYDHVPLQSFNTFEIGDTLVFIYPRGTHDVIEVDEKSFEDCVVPPSAKPLTSGKDVIKIDAPGKRWFICGFKNGKHCKDGGMKLMINIQKPVAQGGRKLP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAACAAAATGTTGGGCATCTTCATCCTCATAGCAACCATAGTTGCTCAAGCAAATGCAGCACAAAAGCATGAAATTTATTGGAAATACGGTAAAAAGTATGATCACGTGCCCTTG
CAGAGCTTCAATACATTCGAAATTGGTGATACTTTAG
GTAAGTATCCTTATTCTAAAAAAAGATTCATTAGTGATTTTTTTTTAACGGCAAATTTGGATCACTGACGGTCCACTGGAGTA
TCATCGTGCCACCAGTAGAACCATCCGATCATATCCATCTCCACTAGGCAATAATGCATATACACCAATTCAGGAAAAAACCCAATAAATCTGAGAAAAACCTCCCTTATGAAAATCGAA
CCCATAACCTAATGGCTTTCATTTCCTTTGCATTTTTTCTCAGTGATCAATTTTCACCATCGCTATGTTTAAGCAAAATAATAAATTAAGCAAACCAAAACATGCATGGTTCACATTTTT
ATGATTAGTTTAACAGCATACTTAGTTTGTAAAGTATATATAATAACAACATGCTTTGATTTTATTGGCAAATGAATCAGGGGCGGACCTAAGTATCTGTGTGGGTGGGTGGGTGGGTGA
GCGCACCCTTTGAAAAAAAAAATAATGTATTTTTTAGACAAAAAAACTCGACCGCATTTTTAAAAATATGCGTGAACCACTCATCCGCACCCTAGCAAATAATTTCTGTATCCACCACTG
AAATGAGCTTATACTATAAGATTGGCAAAAGCATGATACACATCCGGCAATTTATATCAATGAATCCTATGTGATTCTCTAGATTTGGTTTTCAAATATCCTAAACCTCACTATACTCGA
AAAAAAGCTTTATGAAGAAAAGGTTTCATTGGGACAGCCTCTCTATCTCCTATGTGATAGAGGAAAAGTTTGCCTTCATCCACCCTCCCTAAAAAATAATAGCTTTTGATACGCATGTGT
GGGATTTTATTGGGTACGTTTGTTTGTTAGTTTTCATATATCCTCGTGGAACACACGATGTGATTGAAGTAGATGAGAAAAGCTTTGAAGATTGTGTGGTGCCTCCTTCTGCTAAACCTC
TCACAAGTGGAAAGGATGTGATAAAGATAGATGCCCCAGGAAAAAGATGGTTCATTTGTGGATTTAAAAACGGAAAGCATTGTAAGGATGGTGGTATGAAGCTTATGATAAATATCCAGA
AGCCCGTGGCTCAGGGAGGAAGAAAACTACCAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAACAAAATGTTGGGCATCTTCATCCTCATAGCAACCATAGTTGCTCAAGCAAATGCAGCACAAAAGCATGAAATTTATTGGAAATACGGTAAAAAGTATGATCACGTGCCCTTG
CAGAGCTTCAATACATTCGAAATTGGTGATACTTTAG
TTTTCATATATCCTCGTGGAACACACGATGTGATTGAAGTAGATGAGAAAAGCTTTGAAGATTGTGTGGTGCCTCCTTCTGCT
AAACCTCTCACAAGTGGAAAGGATGTGATAAAGATAGATGCCCCAGGAAAAAGATGGTTCATTTGTGGATTTAAAAACGGAAAGCATTGTAAGGATGGTGGTATGAAGCTTATGATAAAT
ATCCAGAAGCCCGTGGCTCAGGGAGGAAGAAAACTACCAAAT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGCTCA TCCAAAATTC TTGGCTTCAA ATAGGCATCT AAATTCGTAA AAAACGAAGA TCGTTTAAAG TGAACGGAAA TGGCTAACAA AATGTTGGGC ATCTTCATCC TCATAGCAAC  CATAGTTGCT CAAGCAAATG CAGCACAAAA GCATGAAATT TATTGGAAAT ACGGTAAAAA GTATGATCAC GTGCCCTTGC AGAGCTTCAA TACATTCGAA ATTGGTGATA CTTTAGTTTT  CATATATCCT CGTGGAACAC ACGATGTGAT TGAAGTAGAT GAGAAAAGCT TTGAAGATTG TGTGGTGCCT CCTTCTGCTA AACCTCTCAC AAGTGGAAAG GATGTGATAA AGATAGATGC  CCCAGGAAAA AGATGGTTCA TTTGTGGATT TAAAAACGGA AAGCATTGTA AGGATGGTGG TATGAAGCTT ATGATAAATA TCCAGAAGCC CGTGGCTCAG GGAGGAAGAA AACTACCAAA  TTAAAACTAT CACATTTTTT GTTCTGCTCC AGTGATAAAT GTATTATTGT GTGTGTTAAT AGTTGTTTTT CTATTATTTG TTATGCTTCA GTGATAAATG TATTATTGTG TGTGTTAATA 
GTTGTTTTTC TATTAATATT CAAATCCCCA TCCAAAATGT CCCTATA 

Retrieve as FASTA