Entry information : HaUCC06 (HanXRQChr09g0256161)
Entry ID 13724
Creation 2016-05-13 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaUCC06 (HanXRQChr09g0256161)
Name (synonym) HaUCC06 (HanXRQChr09g0256161)
Class Uclacyanin    [Orthogroup: UCC001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaUCC06
start..stop
S start..stop
HaUCC08 232 5e-78 62..189 1..128
ThasUCC06 176 4e-56 90..214 24..148
AtUCC06 162 9e-51 69..187 6..122
HaUCC07 112 6e-31 69..189 9..126
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 133502182..133502261 80 N° 2 133502917..133503197 281 N° 3 133503313..133503656 344  
join(133502182..133502261,133502917..133503197,133503313..133503656)


exon

Literature and cross-references HaUCC06 (HanXRQChr09g0256161)
DNA ref. HanXRQ genome:   HanXRQChr09 (133502182..133503656)
Protein sequence: HaUCC06 (HanXRQChr09g0256161)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   235
PWM (Da):   %s   25400.41 Transmb domain:   %s   i66-88o209-231i
PI (pH):   %s   8.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVTAIMLFSTRSSRFFLSWVKEDYTKGKVVKQGYYVQRCSVYIYTHIPHLVPYTNHLIKKMEKNTYTMLLLVAFVGMLLMLSTHGSAEQHVVGGKQGWDESTDFDSWASGQTFKVGDTVFKYSPLHNVAELGSESEYKNCDVGSATNSMSDGNSVVKLTKAGTRYFACGTPGHCDQGMKVKITTVSASSDSSPTSSSSSKTPTSTSTSTSGAICVSGSFVFAAVFMVLMNML

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTAACGGCTATAATGTTGTTTTCGACAAGATCATCTCGTTTCTTTTTATCGTGGGTAAAAGAAGATTATACAAAGTAAGAACCACAGTATGTTGGAATCATTACTTAATTCAAA
TTCTTGATAATATAGTTAGACCATGTGTAGTGGAAGGGGAAGATAATGCCCCCACCCTAGGGCATTTTACGCCATGTGGCGGTCCAGTCAGCAAAGGGGCATTATTGGACGTTTTCTAAA
ATGGGGGTAGTGGGGATAGGGAATTATTGGGCAATATGTTTTGTAGTAAATAAAATAAAGAAAAAAACACCTAAAAATCTTATTGGCCAAGCAAATGGAATCTCTAATCTGATTGGTCAA
CATTTCCCTCCATCAGCGTTGTTTAAAAAACGCCAACCCAATTTTTTTCAAAAAAAAAAAACGCCCGAAAACGTCATGGTGCAATGGCTATGGGGCTTGTTTCGGCGTTTGTTTTGAATT
TTTTTTAAAAAAAGCGCCCCACTACGGGGGTCTTAACCAAAAGGAACACCAAAGTCAATTATGATTAGTTTCAAAGGCAAGCAAGCTCTTTACAGAAACAAAAAGATTTTGCTTAGATCA
CACTTTATCCAACTTTCTATAGATGTTTGATTAAACCTACCAAATAACATGAATTAGTATCTTGGAATAATGAAATACCAACTACACCATCAATGACAAGACAAATTAACCACCTTTCCA
ACAAATCAATCCCAGGGGCAAAGTGGTAAAACAAGGATATTATGTCCAACGTTGTAGTGTGTATATATACACGCACATACCACATTTGGTCCCATACACAAATCATTTGATCAAAAAAAT
GGAGAAAAATACATATACCATGTTATTGTTGGTGGCTTTTGTTGGAATGTTGCTAATGTTATCCACACATGGATCGGCCGAGCAACATGTCGTCGGAGGGAAACAAGGGTGGGACGAATC
GACAGATTTTGACTCTTGGGCTTCGGGTCAAACTTTTAAGGTCGGCGACACACTTG
GTAAGCTACAATATGTCATAAATGACCCAGACTCTTTTTCCTGGTAGTAATTTAGTGTTCTGTA
ATGAACCTCGTTTTGTATATATAATGATCGTTAATGTATTCTTTTGGATAGTATTCAAGTACAGTCCGCTGCATAACGTTGCGGAGCTTGGCAGCGAAAGTGAATACAAGAATTGTGATG
TAGGATCGGCTACGAACTCAATGAGCGATGGAAACAGTGTGGTGAAGTTAACAAAGGCGGGTACGAGGTACTTTGCATGTGGTACACCTGGACACTGTGATCAGGGTATGAAGGTGAAGA
TCACTACAGTCTCTGCTTCTTCAGATTCATCGCCAACATCATCTTCATCATCTAAAACACCAACTTCAACTTCAACTTCGACTTCGGGTGCGATTTGTGTTTCGGGATCATTTGTTTTTG
CAGCTGTGTTTATGGTGCTGATGAACATGTTGTGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTAACGGCTATAATGTTGTTTTCGACAAGATCATCTCGTTTCTTTTTATCGTGGGTAAAAGAAGATTATACAAAGGGCAAAGTGGTAAAACAAGGATATTATGTCCAACGTTGT
AGTGTGTATATATACACGCACATACCACATTTGGTCCCATACACAAATCATTTGATCAAAAAAATGGAGAAAAATACATATACCATGTTATTGTTGGTGGCTTTTGTTGGAATGTTGCTA
ATGTTATCCACACATGGATCGGCCGAGCAACATGTCGTCGGAGGGAAACAAGGGTGGGACGAATCGACAGATTTTGACTCTTGGGCTTCGGGTCAAACTTTTAAGGTCGGCGACACACTT
G
TATTCAAGTACAGTCCGCTGCATAACGTTGCGGAGCTTGGCAGCGAAAGTGAATACAAGAATTGTGATGTAGGATCGGCTACGAACTCAATGAGCGATGGAAACAGTGTGGTGAAGTTA
ACAAAGGCGGGTACGAGGTACTTTGCATGTGGTACACCTGGACACTGTGATCAGGGTATGAAGGTGAAGATCACTACAGTCTCTGCTTCTTCAGATTCATCGCCAACATCATCTTCATCA
TCTAAAACACCAACTTCAACTTCAACTTCGACTTCGGGTGCGATTTGTGTTTCGGGATCATTTGTTTTTGCAGCTGTGTTTATGGTGCTGATGAACATGTTGTGT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CATAGTTGAG CCATATGAAC TCTGCACTTG GTGTTGTTGG CCTAAATCTT TGTTAATTGA TGATCCAATA TTGCATGATG ATGGGAAGCT TAGTGTTCAA TATACCAAGG AATACGCTCA  TGCTGATTGA TTTTTAATTA TCATGGGTGT AACGGCTATA ATGTTGTTTT CGACAAGATC ATCTCGTTTC TTTTTATCGT GGGTAAAAGA AGATTATACA AAGGGCAAAG TGGTAAAACA  AGGATATTAT GTCCAACGTT GTAGTGTGTA TATATACACG CACATACCAC ATTTGGTCCC ATACACAAAT CATTTGATCA AAAAAATGGA GAAAAATACA TATACCATGT TATTGTTGGT  GGCTTTTGTT GGAATGTTGC TAATGTTATC CACACATGGA TCGGCCGAGC AACATGTCGT CGGAGGGAAA CAAGGGTGGG ACGAATCGAC AGATTTTGAC TCTTGGGCTT CGGGTCAAAC  TTTTAAGGTC GGCGACACAC TTGTATTCAA GTACAGTCCG CTGCATAACG TTGCGGAGCT TGGCAGCGAA AGTGAATACA AGAATTGTGA TGTAGGATCG GCTACGAACT CAATGAGCGA  TGGAAACAGT GTGGTGAAGT TAACAAAGGC GGGTACGAGG TACTTTGCAT GTGGTACACC TGGACACTGT GATCAGGGTA TGAAGGTGAA GATCACTACA GTCTCTGCTT CTTCAGATTC  ATCGCCAACA TCATCTTCAT CATCTAAAAC ACCAACTTCA ACTTCAACTT CGACTTCGGG TGCGATTTGT GTTTCGGGAT CATTTGTTTT TGCAGCTGTG TTTATGGTGC TGATGAACAT  GTTGTGTTAA ATGGAAAAGG CCTCAGGATA TCTTTAAGGT TTTACGGATT TAAAGGTTTT GAGTTGTTGG ATAGGAATAG TTGAGCCATG ATGTTCTTCG CTTTATTCGT TTTAATGTGG 
AATTCATATT GTTTATTGGG TACGAGTTGA GATTATAATA AAATATCTTG AGATTATAAT AGAACTAGTA TTTTGTCCCT TGTA 

Retrieve as FASTA