Entry information : HaUCC07 (HanXRQChr15g0479221)
Entry ID 13727
Creation 2016-05-13 (Christophe Dunand)
Last sequence changes 2016-05-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaUCC07 (HanXRQChr15g0479221)
Name (synonym) HaUCC07 (HanXRQChr15g0479221)
Class Uclacyanin    [Orthogroup: UCC004]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaUCC07
start..stop
S start..stop
HaUCC09 149 1e-45 1..195 46..234
AtUCC01 126 3e-36 9..155 8..145
HaUCC04 115 6e-33 8..195 7..181
ThasUCC06 112 6e-32 6..192 1..176
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 57522091..57522265 175 N° 2 57522616..57523025 410  
join(57522091..57522265,57522616..57523025)


exon

Literature and cross-references HaUCC07 (HanXRQChr15g0479221)
DNA ref. HanXRQ genome:   HanXRQChr15 (57522091..57523025)
Protein sequence: HaUCC07 (HanXRQChr15g0479221)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   195 (170)
PWM (Da):   %s   19993.63 (17336.2)  
PI (pH):   %s   4.51 (4.35) Peptide Signal:   %s   cut: 26 range:26-195
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHAMMKAILLSIVATTMLFELALGADHAVGGTGGSWDQVTDLKTWASSETFTVGDNLVFTYTSNHDVLEVSKDDYDSCSIANPVTSNTASPTTIALKDAGSRYFICGTPGHCDQGMKVEIKTVAASSGPPTTTTPPSSDSPTTTTPPSSDSPTPPVSTKSPPASSGDEPPKPSSATIVKMSVVSMVGIGFLMM

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCATGCAATGATGAAGGCAATTCTACTAAGCATCGTTGCTACAACGATGCTCTTTGAATTGGCTTTAGGCGCAGATCACGCAGTAGGGGGAACTGGAGGGTCGTGGGACCAGGTA
ACTGACCTCAAGACATGGGCTTCATCAGAAACATTTACAGTAGGCGATAACTTAG
GTAACTTATTTATTTTATTTTCCCCGAATTGATAGTTACACTTTTACTCCCGGACTAAACCCGGG
GGTCAAGAGTGTGTGTTGATCCGTCATGCAAATTTGTCATATTGTTTTCATGAAATCTAAGACCCCTTACAGAAATTTGTCAGATTACCCTTTTTCTTATGAGAACACATAAGTTTGTCC
TTTACAATAGTTGGTAGAGAATATATTATATATGTATATGATGGCCCTGACCAATATGTTCTGGTTCTGCCACTGCTTTTAGCTGTGTTCCAAGCATTATCTCGTGATCTTCAAAATGAT
CCTTCAAACACCCTCTAAAACATTTTTTTACGTATTTGTTTGCAGTTTTCACGTATACATCGAACCACGATGTATTAGAGGTGTCCAAGGATGATTACGATTCTTGCTCGATAGCTAATC
CTGTTACGAGTAACACTGCTAGCCCAACTACCATTGCACTTAAGGATGCTGGAAGCCGGTATTTCATATGTGGCACTCCTGGCCACTGTGATCAAGGAATGAAAGTTGAGATTAAGACAG
TAGCCGCAAGTTCCGGACCACCAACAACCACCACTCCTCCATCATCTGATTCACCAACAACCACCACTCCTCCATCATCTGATTCACCAACACCACCCGTTTCCACCAAATCACCTCCAG
CATCTAGCGGCGATGAACCTCCAAAGCCATCATCAGCGACAATAGTAAAGATGAGTGTTGTTTCTATGGTCGGAATTGGGTTCCTTATGATGATG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCATGCAATGATGAAGGCAATTCTACTAAGCATCGTTGCTACAACGATGCTCTTTGAATTGGCTTTAGGCGCAGATCACGCAGTAGGGGGAACTGGAGGGTCGTGGGACCAGGTA
ACTGACCTCAAGACATGGGCTTCATCAGAAACATTTACAGTAGGCGATAACTTAG
TTTTCACGTATACATCGAACCACGATGTATTAGAGGTGTCCAAGGATGATTACGATTCTTGCTCG
ATAGCTAATCCTGTTACGAGTAACACTGCTAGCCCAACTACCATTGCACTTAAGGATGCTGGAAGCCGGTATTTCATATGTGGCACTCCTGGCCACTGTGATCAAGGAATGAAAGTTGAG
ATTAAGACAGTAGCCGCAAGTTCCGGACCACCAACAACCACCACTCCTCCATCATCTGATTCACCAACAACCACCACTCCTCCATCATCTGATTCACCAACACCACCCGTTTCCACCAAA
TCACCTCCAGCATCTAGCGGCGATGAACCTCCAAAGCCATCATCAGCGACAATAGTAAAGATGAGTGTTGTTTCTATGGTCGGAATTGGGTTCCTTATGATGATG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTACATCAA CCCAAAACTC AACATTCGAC CTATAGAACA CATCGATGGC TCATGCAATG ATGAAGGCAA TTCTACTAAG CATCGTTGCT ACAACGATGC TCTTTGAATT GGCTTTAGGC  GCAGATCACG CAGTAGGGGG AACTGGAGGG TCGTGGGACC AGGTAACTGA CCTCAAGACA TGGGCTTCAT CAGAAACATT TACAGTAGGC GATAACTTAG TTTTCACGTA TACATCGAAC  CACGATGTAT TAGAGGTGTC CAAGGATGAT TACGATTCTT GCTCGATAGC TAATCCTGTT ACGAGTAACA CTGCTAGCCC AACTACCATT GCACTTAAGG ATGCTGGAAG CCGGTATTTC  ATATGTGGCA CTCCTGGCCA CTGTGATCAA GGAATGAAAG TTGAGATTAA GACAGTAGCC GCAAGTTCCG GACCACCAAC AACCACCACT CCTCCATCAT CTGATTCACC AACAACCACC  ACTCCTCCAT CATCTGATTC ACCAACACCA CCCGTTTCCA CCAAATCACC TCCAGCATCT AGCGGCGATG AACCTCCAAA GCCATCATCA GCGACAATAG TAAAGATGAG TGTTGTTTCT  ATGGTCGGAA TTGGGTTCCT TATGATGATG TAAATTAACA ATCTTTTTAT TATTTTGTGT GTGTTTTCTT TGATGCATAA TGTTGTGTTT TTTCTTGTAT TGCAATTAGT TCTATGTTTC 
ATATTTATTT ACAGGGCTCG CTAATAAAAT TATTTCCTTT CTTTAATGCA AATATGAATT CTAC 

Retrieve as FASTA