Entry information : AtCSD02 (AT2G28190/CSD2/CZSOD2)
Entry ID 13733
Creation 2016-05-24 (Christophe Dunand)
Last sequence changes 2016-06-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-20 (Christophe Dunand)
Peroxidase information: AtCSD02 (AT2G28190/CSD2/CZSOD2)
Name (synonym) AtCSD02 (AT2G28190/CSD2/CZSOD2)
Class Cu/Zn SOD    [Orthogroup: CSD001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtCSD02
start..stop
S start..stop
HaCSD04 311 3e-109 8..216 14..225
ThasCSD02 309 2e-108 3..216 2..221
LeCSD03 289 2e-100 31..216 33..217
PpaCSD03 274 7e-95 1..216 1..206
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..265 265 N° 2 686..747 62 N° 3 835..874 40 N° 4 967..1062 96
N° 5 1157..1188 32 N° 6 1285..1360 76 N° 7 1517..1570 54 N° 8 1731..1756 26
join(1..265,686..747,835..874,967..1062,1157..1188,1285..1360,1517..1570,1731..1 756)


exon

Literature and cross-references AtCSD02 (AT2G28190/CSD2/CZSOD2)
Omic ref. AtProteome:   At2g28190 ATTED-II:   At2g28190 e-FP Browser:   At2g28190 ePlant:   At2g28190 TAIR:   At2g28190
Protein sequence: AtCSD02 (AT2G28190/CSD2/CZSOD2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   217
PWM (Da):   %s   22230.32  
PI (pH):   %s   7.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAATNTILAFSSPSRLLIPPSSNPSTLRSSFRGVSLNNNNLHRLQSVSFAVKAPSKALTVVSAAKKAVAVLKGTSDVEGVVTLTQDDSGPTTVNVRITGLTPGPHGFHLHEFGDTTNGCISTGPHFNPNNMTHGAPEDECRHAGDLGNINANADGVAETTIVDNQIPLTGPNSVVGRAFVVHELKDDLGKGGHELSLTTGNAGGRLACGVIGLTPL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCACCAACACAATCCTCGCATTCTCATCTCCTTCTCGTCTTCTCATTCCTCCTTCCTCCAATCCTTCAACTCTCCGTTCCTCTTTCCGCGGCGTCTCTCTCAACAACAACAAT
CTCCACCGTCTCCAATCTGTTTCCTTCGCCGTTAAAGCTCCGTCGAAAGCGTTGACAGTTGTTTCCGCGGCGAAGAAGGCTGTTGCAGTGCTTAAAGGTACTTCTGATGTCGAAGGAGTT
GTTACTTTGACCCAAGATGACTCAG
GTCCGTCTCTCTCAATTGCTCAAAATCTCTAATTTCTCATCTGGGTTTCTGAAGATTGATTTGATGGGCATGATTAGGTCACTCTCAGTGTTCAA
TCTGCTTCGTATCTGACTTTCAATATCTTCAAAGTCTCAGACTTTTTCTGTTTAATCTGCTTCATATCTGATTTTCGGTTTCTTCAAAGTTTCAGACTTTTTCTGTTTAATCTGTTGAGT
TACATTTGTTAGTGTTTGGTTCTCACTGCTATGAATAACTTAAGATAAGCTGATAAAGAAAGGGATTAGCTTTAAGAGTGTTTTGCATATTCTTGCTGATTCAATGGTTCTGTGAAAGTT
TACAAAGTAACCCTATATGGTTTCTTGCTAATTTTTGACTATGTAGATTGTTCTAAGTGAATATGGTTGTGTTTATGGCAAGCAGGTCCTACAACTGTGAATGTTCGTATCACTGGTCTC
ACTCCAGGGCCTCATGGATTTCATCTC
GTAAGCTTGTTCCTCCTCGGAAGAATGAATCATCTGTTCTTCTTATAGCTATAATGGTGTAATTATGTCCTCTGTTTGATTTTGCAGCATGAG
TTTGGTGATACAACTAATGGATGTATCTCAACAG
GTTAATAGCAAAACCCCTGTGGCAGATTCTTTTGATACTGATGTCATGATTTGCCAAATTCTAAGACGATATCTTGTCTTATATTC
TTGTAGGACCACATTTCAACCCTAACAACATGACACACGGAGCTCCAGAAGATGAGTGCCGTCATGCGGGTGACCTGGGAAACATAAATGCCAATGCCGATGGTATTTTACATCCTCCAT
TCAAGTTCCCATACAATTTGGCTGTCTTCGATAATCAAAAACCTGTTTGAACTAAGTACTGTTTTTGTAACAACAGGCGTGGCAGAAACAACAATAGTGGACAATCAGGTTGGTGCTATC
GCATGTTTTTCCTATAAGAAGTATATTGCTTCTCATATTTTCTCTTATAAGAAGCTTTTGTTTACTGTGAACTTGATTGTGTAGATTCCTCTGACTGGTCCTAATTCTGTTGTTGGAAGA
GCCTTTGTGGTTCACGAGCTTAAGGATGACCTCGGAAAGG
GTAAACCATTATACTTTACTTCCAAGTCTCGATACATCAATTGGCACGGTTGCACTAATGAATTGTTAATAAAAAGGATG
GCTCTTTCCTAGCTTATAAATGTCTCTTAAGCCAAGTTATGATATGATATTACTCTCTTTGATTTGACAAATATAGGTGGCCATGAGCTTAGTCTGACCACTGGAAACGCAGGCGGGAGA
TTGGCATGTG
GTATGTTTAAACTTTCTATCACTATGACTTAGGCTGCGATTGTTTCAAACGCCAAAAATTGTGGTTTCATTCGAAGAAAACACACTTGATTATAACGTTTAATCGCAAAT
TCGGACCATCTGTTTCGGTATCCTCACGAGTTATGTTGGTTCTTTCGCAGGTGTGATTGGCTTGACGCCGCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCACCAACACAATCCTCGCATTCTCATCTCCTTCTCGTCTTCTCATTCCTCCTTCCTCCAATCCTTCAACTCTCCGTTCCTCTTTCCGCGGCGTCTCTCTCAACAACAACAAT
CTCCACCGTCTCCAATCTGTTTCCTTCGCCGTTAAAGCTCCGTCGAAAGCGTTGACAGTTGTTTCCGCGGCGAAGAAGGCTGTTGCAGTGCTTAAAGGTACTTCTGATGTCGAAGGAGTT
GTTACTTTGACCCAAGATGACTCAG
GTCCTACAACTGTGAATGTTCGTATCACTGGTCTCACTCCAGGGCCTCATGGATTTCATCTCCATGAGTTTGGTGATACAACTAATGGATGTATC
TCAACAG
GACCACATTTCAACCCTAACAACATGACACACGGAGCTCCAGAAGATGAGTGCCGTCATGCGGGTGACCTGGGAAACATAAATGCCAATGCCGATGGCGTGGCAGAAACAACA
ATAGTGGACAATCAG
ATTCCTCTGACTGGTCCTAATTCTGTTGTTGGAAGAGCCTTTGTGGTTCACGAGCTTAAGGATGACCTCGGAAAGGGTGGCCATGAGCTTAGTCTGACCACTGGA
AACGCAGGCGGGAGATTGGCATGTG
GTGTGATTGGCTTGACGCCGCTCTAA

Retrieve as FASTA