Entry information : HaCSD04 (HanXRQChr02g0055581)
Entry ID 13741
Creation 2016-05-24 (Christophe Dunand)
Last sequence changes 2016-05-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaCSD04 (HanXRQChr02g0055581)
Name (synonym) HaCSD04 (HanXRQChr02g0055581)
Class Cu/Zn SOD    [Orthogroup: CSD001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaCSD04
start..stop
S start..stop
AtCSD02 319 2e-112 8..225 1..216
LeCSD03 300 9e-105 9..225 1..217
ThasCSD02 286 5e-99 9..225 1..221
PpaCSD04 278 2e-96 37..225 22..204
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165504867..165505158 292 N° 2 165506905..165506966 62 N° 3 165507057..165507096 40 N° 4 165507190..165507285 96
N° 5 165508560..165508591 32 N° 6 165508695..165508770 76 N° 7 165508894..165508947 54 N° 8 165510013..165510035 23
join(165504867..165505158,165506905..165506966,165507057..165507096,165507190..1 65507285,165508560..165508591,165508695..165508770,165508894..165508947,16551001 3..165510035)


exon

Literature and cross-references HaCSD04 (HanXRQChr02g0055581)
DNA ref. HanXRQ genome:   HanXRQChr02 (165504867..165510035)
Protein sequence: HaCSD04 (HanXRQChr02g0055581)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   225
PWM (Da):   %s   22692.66  
PI (pH):   %s   6.43
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQAALALMAAHSILFSSPTTTTNPLIFPLSNPNTLHSSFTGVSLKSTLNRQSLTLSAAAATAPKPLTVVAATKKAVAVLKGTSSVEGVVTLTQEDDGPTTVNVKITGLTPGPHGFHHEFGDTTNGCISTGPHFNPNGHTHGAPEDEIRHAGDLGNIIANADGVAEATIVDNIPLTGPNAVVGRALVVHELADDLGKGGHELSLSTGNAGGRLACGVVGLTP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAAGCTGCACTTGCATTAATGGCTGCTCACTCAATCCTCTTCTCTTCACCAACAACCACCACTAATCCCCTCATCTTTCCTCTTTCAAACCCTAACACTCTCCACTCTTCTTTC
ACCGGCGTCTCCCTCAAATCCACCCTCAACCGCCAATCCCTAACCCTCTCCGCCGCCGCCGCCACCGCTCCTAAGCCGCTTACGGTTGTCGCCGCCACCAAGAAAGCTGTTGCTGTTCTC
AAGGGTACTTCTAGCGTTGAAGGCGTTGTTACTCTTACTCAAGAAGACGATG
GTATTATTTTTATATATTTATGTATTTATATATTTTTATGTTTAGTAATCTATTTGACTTAAACGCTA
GGGGTGAGAAAATAACTGAATTAACTGAAGTGGAACCTGCTTATTACCTATAGGTTTTTAGCATAGTTGTTAAAAACCATGGTTTCTTGCGCCTAGGCCCATTTTTCAGGCGAGGCGAGT
CAATTGCGCTTTAATTCTCCGAGTGATGATTCGGGCGTAGATTCCTTAGGCTAGAGGGTGTGGTTTAAAGCCCTAGGGGCTTTATTACGCCACGTAAGCAAGGGGCTTTATCGCTAACTT
ACACGGTGTGGAATAACGCCCCTTATAAAAGCCCTTTTTTAACTATATTAAAAAAAGATAAATAAAAAATCTGATTGGTTTACATTAGGTGGGGCTCCTTGATTTCATCTCTCGCGCGCA
CTACTCCTTTGGCGGAAGCCATTGATGGCGCCCCCTTTAACGGAGGCGGGGTGGTTTAACTAGATGGGGGGCGCTAAAGTTCATGAGGTGGCAGGGAGGCGCCAAGCCACACCCCCTGGC
CTTAGAGTTTCCGACCAAAATATCTAAATTCCGGCAAGATTTTAGCCAAATTTCTACTTTTATATAAGGAAAACTACTTTTCTACACTAATATTTTAGATCTCTTGGTTCTAAATAGATG
ATATTAAATGTTAATATATATTTTTAGTACATAATATATTTTTAATTTTTTTTCATTGTGCGCTTTTATTTCCTCAAGCCCTCACTTTTTTTGCGCTCTGTGCTTAGGCCTCATGCGATG
CCTATTCGCCTTGAGTGCGCCTAGCGCTTTTAATAACTTTTAATAAAATATTGTGGTTTCTGTTTGGTTCTTGTTTTAAAAAGCGAAAAGCGACAAAGTCTAAAACCAAGAGAAGCGCGC
CGCTTTTGTACCCGAGGGGCAAATAACTATGTAATTTTATTTATATATTGTCTGTAGGTTTCTAATATTATTTACCCAATAATTAGAGACAAGTAAGCGTTGTATATTTTTTCAATATGC
AAATTACATACATTTACAATCTGAAAAGCATGCTGCACAACAACTTGTTGCACAAAAATATGGGAAATACATGAGGCGCACGGCTCAGAGTCAAATTTTTTGCCAAGAAATCGCGCCTCA
GGTAGTGCGCTTTTTTAAAAAAGCGCGCCTTATGCAGTTATGCTACCAAAACTTGTTGTGCCTAGGCACACTTTTCTAAACCAAGGTGTGGTTGGGGCTCAAAGCCGACCTGAACCGAAT
CAACCAAGACGGACCAAATTTTTAAAATTATATGAAAATTTAGGTTTCAGTTCGGTTGGGGATTAAAAAGCAAACCGAATCAACCAAGACGGACCAAATTTTTAAAATTATATGAAAATT
TAGGTTTCAGTTCGGTTGGGGATTAAAAAGCAAACCGAATCAACCAAGACGGATCAATTTCCAAAAACTTTTAAACTGAATATTCCAGTTTCGGTTCGCTTGGTGCTCAAAACCAAACTG
AACCGCCCCGTGCACACACTACTTAAACCTATCTAGCACTTAACTGTTAAAATATTTAAGCATCCGTTTCGATTTGAACCTGAAACTTAGCTGGATTGGAATGTTTTTTTTTTTTTTTTT
TTTTTTTTTAATTTGTGATTAAACATTATATCATATTTGGATTAGGGTTTGAATTTTGACTAGACAAGTGTATGATATATGCCATTGATTTGTTTGTGAATTGTTGTTATTGATGTAGGC
CCAACAACTGTGAATGTGAAAATAACCGGACTAACTCCCGGACCCCACGGGTTTCATCTA
GTAAGCATTCATCTTGTTCTTAGCGTAACACGTTAAATGATTTTAATGCATGATTAAGTG
CTAATAGTTTGGCGTTTCTTTAATCTGTAGCATGAGTTTGGTGATACCACAAACGGGTGCATATCAACAGGTTTGATTTTTTTTAATGCATTACAATGTACATGTTCTAGGGTACGGTTC
GTTTAGTTCTAATGATTTAACGTTGACCATTGATTAATATTAGGACCTCATTTCAATCCGAATGGGCATACTCATGGTGCTCCTGAAGACGAAATTCGCCATGCGGGTGACCTGGGAAAC
ATAATTGCCAATGCCGATG
GTATTTCACTATAATCATATTTTATATTTTAAGGGTAAAGTTCTTGTACAAATAATCTTAACATACTAAACATACAAATTGAAGGAAAACTCAAAAAGACA
AGGTGGCATTTTTGTAATTATCAATAACCATCAAAGTTACTCTACAAATATACCTAAAAAAACCTAACCACTCCCCCCACCCCCAAAAAAAACCTAAACCCCCCACCCCCCAAAAACCTA
ACCCCCCCACCCAAGCTAAAATGCTAAAAACTAACCCCCCCAAAAAACCTAAAAAAATCTAAAAAAATAAAAAAAACACACAAATTATTTTATTTTATTTTTTTAACATTTTTTATTAAA
AAATCGCTACTTTTAGTAGCAGCCAAAAAAAAAAAAAAAAAATTTTTTTTTTTGCTAACGAAATGTAGTGATTTTTTAATAAAAAATGTTAAAAAAAATTGTGTTTTTTTAGGTATTTTT
GGTTGTAACTTTGATAGTTGGTGGTAATTACAAAAATGCCACCTTGTCTTTTTGGGTTTTCCTTCAATTTGTATGTTTAGTATGTTAAGATTATTTGTATTTGATCTTTTGCCTATATTT
TAATTGTTTTAAAGTAAAACTGAGGTTTGGCCAGTTTTGTGACTTTCGTCCAAAGGTTTGTTTTTCCGCATCTGGGACGAAAATGGCATTTTACTCTACTTTTTAGGAAAAATTACAAGT
TTTGTCCTTTATCTTTATACCACTTTTCAGGCCGTGTCCTTTTTAACGAATGTTGACAGGCGGTGTCCTTTACTAGGTATTTTGTTGCAAGTTTAGTCCTTTACACCCAACAATTAACAG
GGTTTTTTAACTGGGTTGGGTGTAAAGGACTAAACTTGCAACAAAATACCTAGTAAAGGACACCGCCTGTCAACATTCGTTAAAAAGGACACCGCCTGAAAAGTGGTATAAAGATAAAGG
ACAAAACTTGTAACAAAATACCTAGGTAAAGGACTAAACTTGCAACAAAATACCTAGTAAAGGACACCGCCTGTCAACAATTAATAGGGTTTTTTAACTGGGTTGGGTGTAAATGACTAA
ACTTGCAACAAAATACCTAGTAAAGGACACTGCCTGTCAACATTCGTTAAAAAGGACACCGCCTGAAAAGTGGTATAAAGATAAAAGACAAAACTTGTAATTTTTCCTATTTTTTATTTA
TTCTTAATTTGGTCGTCCGTCGTTTACACCAGCCCCAAGTTAAATGACCGTCTTTGATCTTTCTTTATAATTTTTGTGTTAAATATAATGCAGGCGTGGCTGAGGCTACAATCGTCGATA
ATCAG
GTTTGAGTGTAAAGTTTGTTTGTTTTTTTTTTTGTTTAATGATCCTGTTTGGTGTAATTTGTTGATCGTCTAGTTATAATATTTGATTTATGAGGACTTGCAGATACCATTGACC
GGGCCTAATGCTGTGGTTGGAAGAGCCTTGGTGGTTCATGAGCTTGCTGACGACCTCGGAAAGG
GTAATTTGCAATTAATTTTTATAATTATTATTATTTTTTTTAAATTTAATTTTTTG
AGTATATGTTACCTAGAATCTGAACGTTGTGTAATTCTTTTTTGACGTTTTTTTGGTTTGATTTTAGGTGGTCACGAACTTAGCCTCTCCACTGGAAATGCAGGCGGACGATTGGCTTGT
G
GTATGATAATTAATTAATTATACACATGTTAATTTTAATTATTTTGGTGGCAGTTTTGACCCATTTATCCAAAGATGGGTTGATCCTAGGGGTGTTCAAAATTCGTTTCGAATTCGAAA
AATCGAAATTCGTTTCGATTATCAACAATTCGAATCCGAATTCAAATTTGATTCAAATCGAGTCTAGTAAATCGAATACAAATTTATAATTTTATATCCGATTTGAAATTCGAATTAAAA
TGATACATATTTATTTATCATTTTTATATATAATTGTATATAACTTTTGTTGGCCTACAATATAAATTAATTTCTAAATTTATTCTAAGTATTAAAATAGCCCATTACCAAACCCATAAC
TTAAACGAAATTATTACATATCTTAACTGAATTTTTATCAAAACGAATTTATTCGAATTTAACCGAATTCGATTCGAATTCGAATTGGGATTTTAATTCGAATACGAATCGAATTGGTTG
GTTCTTAATTGAATTCGAATTCAAGCAAAAAATAGATTATAGGAAAAATTCGATTTGAAATTTCGATATTCGATTCGATGAACACCCCTAGTTGATCTGGATTATATTTTATCTCAAACG
GGTCAAAAGGTGTCTAAAAGTGTAATAAAATCCTTACAATCTTTTAATCCAGTTTATTAAAAATCATATTACTCTTTTCGTACTTTAGTTTTTCAATCATATTTAGTAGTTAGTACGTTA
ATCATTAAATTAAAAAAAAATAAAGAACACCTCAAAAGATCGTTCGTGTAGTTTTTTGGTTTTATTAAATTAAGTATAACCTTTTTATTAAAAATCATATTGCCATTTTCATGCTTTAGG
TTTCAAATTCATCTTTACTATAAAAATCATTAAACAAAGTAAGAAAAATGAATAAAGAGCATCTCAAACGATTGTCTATGTGGTTTCATCAGATTAGAAAGCGTGTCGTTTTCTAAATCA
TTATTCACATAAAAGGCGAAAAAGAAAGAAAAAAGAGTTGTATTTTGATTCACTTTGTTACAACTTTTTTAAACCGCAAATCTCTTTCGCCCTTTGAAATATGCAGGTGTGGTCGGGTTG
ACTCCAATA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAAGCTGCACTTGCATTAATGGCTGCTCACTCAATCCTCTTCTCTTCACCAACAACCACCACTAATCCCCTCATCTTTCCTCTTTCAAACCCTAACACTCTCCACTCTTCTTTC
ACCGGCGTCTCCCTCAAATCCACCCTCAACCGCCAATCCCTAACCCTCTCCGCCGCCGCCGCCACCGCTCCTAAGCCGCTTACGGTTGTCGCCGCCACCAAGAAAGCTGTTGCTGTTCTC
AAGGGTACTTCTAGCGTTGAAGGCGTTGTTACTCTTACTCAAGAAGACGATG
GCCCAACAACTGTGAATGTGAAAATAACCGGACTAACTCCCGGACCCCACGGGTTTCATCTACATGAG
TTTGGTGATACCACAAACGGGTGCATATCAACAG
GACCTCATTTCAATCCGAATGGGCATACTCATGGTGCTCCTGAAGACGAAATTCGCCATGCGGGTGACCTGGGAAACATAATTGCC
AATGCCGATG
GCGTGGCTGAGGCTACAATCGTCGATAATCAGATACCATTGACCGGGCCTAATGCTGTGGTTGGAAGAGCCTTGGTGGTTCATGAGCTTGCTGACGACCTCGGAAAGGGT
GGTCACGAACTTAGCCTCTCCACTGGAAATGCAGGCGGACGATTGGCTTGTG
GTGTGGTCGGGTTGACTCCAATA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAAAACAAC AAGAAACACA CCGAATGAAT CATCTTTTAT CTTCCATTTG TTGTCACAAA CATTATCATT TTATCATCAT TCACACCTAC CACTGAATGC AGCAAGCTGC ACTTGCATTA  ATGGCTGCTC ACTCAATCCT CTTCTCTTCA CCAACAACCA CCACTAATCC CCTCATCTTT CCTCTTTCAA ACCCTAACAC TCTCCACTCT TCTTTCACCG GCGTCTCCCT CAAATCCACC  CTCAACCGCC AATCCCTAAC CCTCTCCGCC GCCGCCGCCA CCGCTCCTAA GCCGCTTACG GTTGTCGCCG CCACCAAGAA AGCTGTTGCT GTTCTCAAGG GTACTTCTAG CGTTGAAGGC  GTTGTTACTC TTACTCAAGA AGACGATGGC CCAACAACTG TGAATGTGAA AATAACCGGA CTAACTCCCG GACCCCACGG GTTTCATCTA CATGAGTTTG GTGATACCAC AAACGGGTGC  ATATCAACAG GACCTCATTT CAATCCGAAT GGGCATACTC ATGGTGCTCC TGAAGACGAA ATTCGCCATG CGGGTGACCT GGGAAACATA ATTGCCAATG CCGATGGCGT GGCTGAGGCT  ACAATCGTCG ATAATCAGAT ACCATTGACC GGGCCTAATG CTGTGGTTGG AAGAGCCTTG GTGGTTCATG AGCTTGCTGA CGACCTCGGA AAGGGTGGTC ACGAACTTAG CCTCTCCACT  GGAAATGCAG GCGGACGATT GGCTTGTGGT GTGGTCGGGT TGACTCCAAT ATAATCTTGT GGCGAACCTT GTTCAGTCGG TCTCAGTTTT CGCATAGAGG TTAATGGTTT GCAATTAAAA  ACTGTAAGGT GAAATATTTG CACATTGTAT TTAGCCAAAT AATCATTGAG GCTTATGTGA AAACACTTGG TGAAAATGAT GCAGAACCAC TTCTTGCTGT TTTAATAACT TATGGTTTGA 
TTATCATATT ATTGGACCAC TTTTACTTGG CACCTTTATG AAGGCATTCA TATTTATAAT ATGTAGGGCT GCAAACGAAC CGAATGAACA CGAACAAGAC CTTGTTCGTG 

Retrieve as FASTA