Entry information : HaFSD01 (HanXRQChr08g0223311)
Entry ID 13744
Creation 2016-05-24 (Christophe Dunand)
Last sequence changes 2016-05-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaFSD01 (HanXRQChr08g0223311)
Name (synonym) HaFSD01 (HanXRQChr08g0223311)
Class FeSOD    [Orthogroup: FSD001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaFSD01
start..stop
S start..stop
HaFSD03 403 2e-143 1..270 3..255
AtFSD02 369 2e-129 33..300 36..300
ThasFSD02 326 3e-112 39..263 45..269
HaFSD02 295 1e-101 50..271 2..200
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59052919..59052976 58 N° 2 59052804..59052847 44 N° 3 59051752..59051826 75 N° 4 59051289..59051649 361
N° 5 59050585..59050703 119 N° 6 59050433..59050459 27 N° 7 59050310..59050333 24 N° 8 59049873..59050085 213
complement(join(59049873..59050085,59050310..59050333,59050433..59050459,5905058 5..59050703,59051289..59051649,59051752..59051826,59052804..59052847,59052919..5 9052976))


exon

Literature and cross-references HaFSD01 (HanXRQChr08g0223311)
DNA ref. HanXRQ genome:   HanXRQChr08 (59052976..59049873)
Protein sequence: HaFSD01 (HanXRQChr08g0223311)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   307
PWM (Da):   %s   34770.02  
PI (pH):   %s   4.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASVTTIASHPTSAFISTPEFSRLSQSLHSSQRRRCSRKSVCGTISASIDLKPPPYALNALEPHMSKETLEYHWGKHHRGYVNNLNKQIEGTELDEMSLESIISASYNKGDILPAFNNAAQVWNHEFFWESMKPGGGGKPSGELLELINRDFGSFEGLIHEFKLAATTQFGSGWAWLAYKEHKLDIPNARNPRPSEEDRKLVVVKSPNATNPLVWEYHPLLTLDVWEHAYYLDYENRRTDYISTFLNKLVSWETVSSRLEAAKVLIADREREMAEIDAIDEMDTIEPEDGDMYFGSDADEFVDDD

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTGTCACCACAATCGCTTCCCATCCAACGTCCGCCTTTATTTCCACCCCAGGTTTTTCCATCATTTACTCCTATCCACACTTACTTGTTTCTATTGGATAATTAAATCTGAAT
CAATTGCAGAATTTTCTAGATTATCTCAGAGCTTACACTCGTCACAGAGGCAGGTCAGTTGTCTCTACTCAATTGTTTCCTTCAAATTCTCTAAAAAGAGATTCATGGTAGTAGATAAAG
TTGTTTGCTTTCTAGGGGTTTTGGGTATGTAAGCAAGGTGTTCGATGAAATGTCTGTCACTAAATAAAACTTTTATTTTTGTGTATCCGGGATTGAGAGAAGAAGTTATTCATTTTCTAG
CAACTTTTTTTAGGTTATAATGTGTCTGTGTTTGTTCTAAGCTGGACTTGTGTCATTAAGATTAGATGAAGTTGGTTACTAAAAAAAGATGCAATTTTTCCTGCTCATCATCATCATCAT
CATCATCATCATCATCATACACAGTATATCTCACCAATAGCAAAGCTAAGGTAGAGTTTGAGGAGGGTGAGATGTAGACAGCCTTACCTCTACCTGTAGGAATAGAAAGGCTGCTTCCAA
TGAGACCCCCGGCTCGATTGTAGTTTTGCATCAAGCCTTGGACATAAGGCACATAACACTCAGCAATTGAGACAAACGCCTATTAGTGCATGTACCCCCTTGTCTTTCAGCTATCAACGC
CACCACATGATGCATGATTAACCATCCCCCTCTTTTAACGTTATTTTCCTGCTATATATGAATATTCAAATGATCGTTGTCGTGTTTCTATATTAAAACCGATACCATTAAAGCAATTTT
CCAGTTGGTTTACAAAGGGTGAAGGTGAAGTATCAATTACAGAAAATGAAGTTCTGTTAGATGATATTCTTCATGAATTTTCATTTGCATAACTTCAATTTATAGTTCTCAAGTGTATTG
AAAATTTCTAAAAGAATTCTCATTGCCCTAACTTTGAACTATAATTTCATGAGAAACACTATTTATGTTATGATACCGTTGTGTTGCAAGTGCAAATGACGATATTGGCTAAAAGATGCG
CTCTTTGATTCTATATAGATTTTGTTATTTCCATTTACTGTTTTTTGAAGAAACTAAATTTATGGTACAGAGACGGTGTAGTAGAAAATCTGTTTGTGGGACAATATCAGCCAGCATCGA
TTTGAAGCCACCTCCTTATGCATTG
GTACGACGAATAATCGAATATATATCTCATAACTGTACTATAAGTTAAGTAATTTAATTATTTCTGTAATATATCTTCTATTTCCTGTTGCGTGT
ATGGCAGAATGCTTTGGAACCACATATGAGCAAAGAGACATTGGAATATCATTGGGGAAAACACCACAGAGGTTATGTCAACAATCTAAACAAGCAGATTGAGGGAACCGAGTTAGATGA
AATGTCATTAGAAAGCATAATATCTGCTTCTTATAATAAAGGCGATATTCTTCCCGCCTTCAACAATGCTGCACAGGTTTGGAACCATGAATTTTTCTGGGAATCTATGAAACCTGGTGG
CGGTGGAAAGCCTTCGGGGGAACTTTTAGAATTAATAAACCGAGATTTCGGTTCATTCGAAGGCCTAATTCACGAGTTTAAGTTAGCTGCCACTACTCAGTTTGGTTCTGGTTGGGCTTG
GCTTGCAT
GTAAGCGTTTATTCCATCTAGGGGTGTGAATTTCTGACACATCCTGAAAACACCATACGAACCTAACATGAAATTCGCGGGTTTGGGTTTAGTCTAAAAGGGTTCAAGTCTA
TTTCAGATTGAACCCGCAAACCCGTTTAGCTAAACGGGTCGGGTTCGGGTCAACCTGATTAACCCATTTATATTATATTATATAGTATTTTACCATATGTTTTATGTCATAAATTAAATT
GGATGTGTATTTTATGCCATAACTATAACTTAAAAAGAGAAATTGACATAAGATCTTATAATTTATATTTAACTGTATTATATACATTTCTGTTTCTTGTAGTAAATTTTAATATATTAA
TTTGCAGAAAAAAATTAAAAAATTCGGGTGAACGGGTCGTGTTCGGGTCACCCCACGAATATTTGATTATTTGGGTCGTGTTCAGGTTCATCTAAAAGGTTCGGGTCGGGTTGAACCCAC
CAACCTGCAAACACAACCCGTTTAGCACCCCTAGTTCCATCAGATCCATAACCGAAAATTGGAAATTATATCGACCATTTTTCTTAAATCATTTTGATATTTTTTATTTGTAGATAAAGA
GCATAAACTTGACATACCAAATGCTAGGAATCCACGTCCCTCAGAAGAGGACAGGAAGCTTGTTGTGGTGAAGAGCCCGAATGCGACTAATCCTCTTGTGTGGGAGTACCAT
GTGAGTAG
ACAATAATACTATATACTTTTTGTTATCTTGATCTTAAATGAATCCTTAATTTTGTTGTTTTTCTTTGTGTTAAACTGTAACTGTTTTTTTTTTTTTTTTTTTTTTTGAATTTCCAGCCA
CTCCTCACATTAGATGTTTGGGAG
GTAAGATTTCTTCGCTTACATTTTCCGGTTTCTGCGATAAATAATCTATGTCGATGACGTATTCACTAACTTCACTTTGAATCTGATTTGTGATTG
CAGCATGCATACTACCTAGATTATGAGGTAAGAACTTGTTGATTCGATACAGGAAACAAATATACAAGCAACCCCTTTAGCCCATTTCATCTCACACTCTCACACACAATATGTGTGTGT
GTGCACGTGTTGCGGGTGTCATACTAATAGTTTATGAATGTCCAAACACCCTTATTCATCACATGGTATAAATAAAGTGACCTTTTAGCCTGTCATACTAATAGTTTATGAATGTTTAAT
GTGTATTACAGAACCGTAGGACAGATTATATATCAACTTTCCTCAATAAGCTTGTATCATGGGAGACGGTGAGTTCCAGGCTCGAAGCAGCCAAGGTTTTAATAGCAGATAGGGAAAGAG
AGATGGCGGAAATCGATGCAATTGATGAGATGGACACAATAGAACCCGAGGATGGAGACATGTACTTTGGAAGCGACGCGGATGAATTTGTGGATGATGATGAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTGTCACCACAATCGCTTCCCATCCAACGTCCGCCTTTATTTCCACCCCAGAATTTTCTAGATTATCTCAGAGCTTACACTCGTCACAGAGGCAGAGACGGTGTAGTAGAAAA
TCTGTTTGTGGGACAATATCAGCCAGCATCGATTTGAAGCCACCTCCTTATGCATTG
AATGCTTTGGAACCACATATGAGCAAAGAGACATTGGAATATCATTGGGGAAAACACCACAGA
GGTTATGTCAACAATCTAAACAAGCAGATTGAGGGAACCGAGTTAGATGAAATGTCATTAGAAAGCATAATATCTGCTTCTTATAATAAAGGCGATATTCTTCCCGCCTTCAACAATGCT
GCACAGGTTTGGAACCATGAATTTTTCTGGGAATCTATGAAACCTGGTGGCGGTGGAAAGCCTTCGGGGGAACTTTTAGAATTAATAAACCGAGATTTCGGTTCATTCGAAGGCCTAATT
CACGAGTTTAAGTTAGCTGCCACTACTCAGTTTGGTTCTGGTTGGGCTTGGCTTGCAT
ATAAAGAGCATAAACTTGACATACCAAATGCTAGGAATCCACGTCCCTCAGAAGAGGACAGG
AAGCTTGTTGTGGTGAAGAGCCCGAATGCGACTAATCCTCTTGTGTGGGAGTACCAT
CCACTCCTCACATTAGATGTTTGGGAGCATGCATACTACCTAGATTATGAGAACCGTAGGACA
GATTATATATCAACTTTCCTCAATAAGCTTGTATCATGGGAGACGGTGAGTTCCAGGCTCGAAGCAGCCAAGGTTTTAATAGCAGATAGGGAAAGAGAGATGGCGGAAATCGATGCAATT
GATGAGATGGACACAATAGAACCCGAGGATGGAGACATGTACTTTGGAAGCGACGCGGATGAATTTGTGGATGATGATGAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAGAGCATAA CACCGTTAAC ACATTATTCT TTCAAAACCC AGAAACCCTC CCAAACCCCA ACCCAACTTA TCATTATCCT GTTACAATCT CTTCCAGTAA TGGCGTCTGT CACCACAATC  GCTTCCCATC CAACGTCCGC CTTTATTTCC ACCCCAGAAT TTTCTAGATT ATCTCAGAGC TTACACTCGT CACAGAGGCA GAGACGGTGT AGTAGAAAAT CTGTTTGTGG GACAATATCA  GCCAGCATCG ATTTGAAGCC ACCTCCTTAT GCATTGAATG CTTTGGAACC ACATATGAGC AAAGAGACAT TGGAATATCA TTGGGGAAAA CACCACAGAG GTTATGTCAA CAATCTAAAC  AAGCAGATTG AGGGAACCGA GTTAGATGAA ATGTCATTAG AAAGCATAAT ATCTGCTTCT TATAATAAAG GCGATATTCT TCCCGCCTTC AACAATGCTG CACAGGTTTG GAACCATGAA  TTTTTCTGGG AATCTATGAA ACCTGGTGGC GGTGGAAAGC CTTCGGGGGA ACTTTTAGAA TTAATAAACC GAGATTTCGG TTCATTCGAA GGCCTAATTC ACGAGTTTAA GTTAGCTGCC  ACTACTCAGT TTGGTTCTGG TTGGGCTTGG CTTGCATATA AAGAGCATAA ACTTGACATA CCAAATGCTA GGAATCCACG TCCCTCAGAA GAGGACAGGA AGCTTGTTGT GGTGAAGAGC  CCGAATGCGA CTAATCCTCT TGTGTGGGAG TACCATCCAC TCCTCACATT AGATGTTTGG GAGCATGCAT ACTACCTAGA TTATGAGAAC CGTAGGACAG ATTATATATC AACTTTCCTC  AATAAGCTTG TATCATGGGA GACGGTGAGT TCCAGGCTCG AAGCAGCCAA GGTTTTAATA GCAGATAGGG AAAGAGAGAT GGCGGAAATC GATGCAATTG ATGAGATGGA CACAATAGAA  CCCGAGGATG GAGACATGTA CTTTGGAAGC GACGCGGATG AATTTGTGGA TGATGATGAG TGATGGTTTT GGTGTTACGC AAGTGTAGTT TTGTATCGAG ATTTAGAAAC TAGTGTCAGA  ATTGTAATAT GGTTGTAATG CTTATAGTTA GATATATTAG ATAAGTGTAA TATTTAACAA CTTAGAAGTT TGAAATGGCA AGAGAGAATG ATTTTTTAGA GTAAACTTTA GTTTTACCCC 
CTGAGGTTTA TACAGGTGGA ATCACGTTTA CCC 

Retrieve as FASTA