Entry information : HaGOX03 (HanXRQChr09g0257521)
Entry ID 13762
Creation 2016-05-30 (Christophe Dunand)
Last sequence changes 2016-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGOX03 (HanXRQChr09g0257521)
Name (synonym) HaGOX03 (HanXRQChr09g0257521)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGOX03
start..stop
S start..stop
HaGOX09 697 0 1..350 20..369
HaGOX08 681 0 1..350 20..369
BstrGOX03 668 0 1..350 20..369
ThasGOX11 660 0 1..350 20..367
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 138723305..138723384 80 N° 2 138723461..138723585 125 N° 3 138723713..138723759 47 N° 4 138724336..138724413 78
N° 5 138724885..138725076 192 N° 6 138725169..138725231 63 N° 7 138725721..138725790 70 N° 8 138725883..138726088 206
N° 9 138726304..138726495 192  
join(138723305..138723384,138723461..138723585,138723713..138723759,138724336..1 38724413,138724885..138725076,138725169..138725231,138725721..138725790,13872588 3..138726088,138726304..138726495)


exon

Literature and cross-references HaGOX03 (HanXRQChr09g0257521)
DNA ref. HanXRQ genome:   HanXRQChr09 (138723305..138726495)
Cluster/Prediction ref. HanXRQ:   HanXRQChr09g0257521
Protein sequence: HaGOX03 (HanXRQChr09g0257521)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350
PWM (Da):   %s   38176.99  
PI (pH):   %s   8.89
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVYDYYASGAEDQWTLEENRNAFSRILFRPRILIDVSKIDMTTTILGFKLSMPIMIAPTAMQKMAHPGEYATARAASAAGTITLSSWATSSVEEVASTGPGIRFFQLYVYKDRNVVAQLVRRAERAGFKAIALTVDTPRLGRREADIKNRFTLPPFLTLKNFEGLDLGKMDEANDSGLASYVAGQIDRTLSWKDVKWLQTITTMPILVKGVITAEDTRLAIQAGAAGIIVSNHGARQLDYVPATISALEEVVKAAQGRVPVFLDGGVRRGTDVFKALALGASGIIGRPVVFSLAAEGEAGVRNVLKMLRDEFELTMALSGCTSLREITRDHIVTEWDAPKARPAPRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTATGACTACTATGCTTCTGGTGCCGAGGATCAGTGGACTCTCGAAGAGAACCGAAACGCTTTTTCAAGAATATTGTACGCTCTACTTATGCTCACAGGCACGCGTGCACACACA
TATGCTGAAAGTGGTTGTTTTTTAATGGTGAAACAGGTTTAGGCCGCGCATTCTTATTGATGTGAGCAAGATTGACATGACTACCACAATTTTGGGATTCAAATTATCGATGCCGATTAT
GATTGCGCCAACAGCCATGCAGAAGATGGCTCACCCTGATG
GTAAACATATCTTGTTGATCTAGTCGGCCCGTTTTATGTCACGAAAACAATGAATTATGCTAGAAGTTAATTACGTGGT
TTATATATATGTTTAACAACTAATATTGTTTCTTTATTTTTAATGAAGGTGAGTATGCAACAGCAAGAGCTGCATCTGCAGCTGGAACTATTATGGTCCGTATTTTCACAGATTTATATG
GCAGTCACAAGAAGTGGTCCTGTTTTTTTTTTTTTTTTGTATAGATATTTAATTATTATTACTATATTTTCAGTTGCAACCAAACTTTTTCTTTTAAATACATCTATATTTTAGAATTTC
GAAATTTATGTTTTGATTATTTAACTTATGAGGAATATCTTTTTTTTAAATAGGCTTAGTTAGTTTAAGAATCACATTTATTATACATGTTTTCATAAATAGGCTTAGTTAGTTTAAAAA
TCACATTTATTATACATGTTTTCATAGAAAATTTAATGCTAAATCCAGAATATTAAGTGTATGTTACATGACAAAAAAAAAAAAAAACAATTTTATGTACTGGCCGTTTGGACTGGACAT
TCGGGCCTAACCCGATCTACAACCGGGTTTGAGCCTGATTTTGATCAAGTAATAAGACTACTATATTATGAAACTTTTGGGCTCAACCGGACTAAAGGCCGGGCTTGGACCGCCCCAGGA
CCATTTGGGCAACTCTACTTTGAATTTTACAACACAGAAGTATGTATGCTAATAATTTGTCCACTTTATAGACCTTGTCTTCATGGGCTACATCAAGTGTTGAGGAGGTTGCTTCAACAG
GACCTGGAATCCGTTTCTTCCAGCTTTAT
GTGAGCAAAACTACTATTTCATCTAGGGTTGAACTGCAAAACCAATTAAATGAAATAATAAAAAAAAATTGAACCGAAATAACCAACATAT
TGATGATGCAGGTTTGGTTATGATCTTTTCAATAACCGATTTTTGATTCAATTATGGTTATAGGTGTATAAATAACCAAATTAACTTAACCGACTCGACATTTAAACCAACATAATTTTT
CTTAATAAATAATATGTTATACGTCGATTTTTTTTTTTTAAATTTTACAAAATCGCGTATTAGTTGTCCTTTATATAATTGAATTTATTAATCTAACCATCTTTCTCAAAAACCGACCAA
CAATTAAAATCTAAAGGCCTAAACATCGGTTATAGATTCATTTTTATTCATAACTAAACCTAACTGAACCGTGCTCACCCCTATTTCATCTTTTATTTTTTCTTAATATACATGTTAACG
TTGTTGATCCTTAATATCAGGTGTACAAGGACAGGAACGTGGTTGCTCAGCTTGTGCGAAGAGCCGAAAGAGCTGGTTTTAAGGCTATCGCTCTTACAGTTGATACACCTAGGCTTGGAC
GCCGAGAAGCTGACATCAAAAACAGGTTTACTCTACCACCATTTTTGACACTGAAGAACTTTGAGGGTTTGGACCTTGGCAAGATGGATGAA
GTAAGTCAATACAACAAATATTAAAGAT
TAATCTTGAGTTTTCGTATATGTTTTATCGGTCTTTTCTAATTTGTTATAATCTTGCAATGCAGGCTAATGATTCTGGTTTAGCTTCTTATGTTGCTGGTCAGATCGACCGCACCTTGAG
CTGGAAG
GTATATATATATATTTTTTTTACAAAAATGTCTGTTATTGCACTACAAGAAAGCATACTTGTGGGGACTAGATTTTTTTGGCCTGGGACGACATGGTGTCTCCATAGTTTCGT
CTATGGAACCCATTGCATATAGGTCCCTTAGGTCATCTCTATAGGTGTTGTCCTCATGCATTAACTTTTAGAGACGACATATCGTCACAATAGACTTAGAGCACATTCTAAAATCGGCCC
CTTCCCATAGAAAATTTTACTTAGGATCCTAACATGTGGGATTAAAATGACACACATAAATTGTATGCAATTTTTAAAAGGCAAAAAATTACACAATTCCAATGAGGGAGGAGTTGTGAT
CGTAGAGTAAGAATCGAATGTAGTCGAGTTTTAAAAGTCCTCCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAAAAAAGTCGAGCCACCCATGGTTCTCGATTGCGCCTTATGTTAGTA
ACTTATGTGCATGCAGGATGTGAAGTGGCTACAAACAATTACCACAATGCCGATCCTCGTTAAGGGTGTTATCACTGCTGAGGACAGTAAGAAGGATCAAAAGCCGTTGTAATTATGTTT
TTCATTAGTTTTTGTATTTTGTTAAACTAATGTTAGAATGCTGCTGATCATTGTACAGCAAGGTTAGCTATTCAAGCTGGAGCAGCGGGTATTATTGTTTCCAACCATGGAGCTCGCCAG
CTGGATTACGTTCCGGCTACAATCAGCGCTTTGGAAGAGGTTGTGAAAGCGGCACAGGGTCGTGTCCCAGTGTTCCTGGACGGTGGTGTCCGCCGTGGAACCGATGTTTTCAAGGCACTG
GCTCTTGGAGCTTCTGGCATCTTT
GTAAGTAACTAAACATATCAAGTCTTGTTTTGAGCTCATACAAATCTTTCTTAAGAAAATGCAAATAATTCACCATTATATTTTGCAAAAATGAGC
AATACTAGATGATTTATCTTATGCTTTAAAGTGATTTATTTTTAATAGTAGAAATCAAATAAATAGTTATAATAAATAGTTATAATCTCATATTTCTTATGATATGGTGTAAATTTCAGA
TCGGGCGACCTGTGGTGTTTTCTTTGGCTGCTGAGGGAGAAGCTGGAGTGAGAAATGTACTCAAAATGTTACGTGATGAATTCGAGCTAACTATGGCACTAAGCGGTTGCACCTCACTCA
GAGAGATCACTCGTGACCACATTGTGACCGAGTGGGACGCCCCAAAGGCTCGTCCTGCACCACGGTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTATGACTACTATGCTTCTGGTGCCGAGGATCAGTGGACTCTCGAAGAGAACCGAAACGCTTTTTCAAGAATATTGTTTAGGCCGCGCATTCTTATTGATGTGAGCAAGATTGAC
ATGACTACCACAATTTTGGGATTCAAATTATCGATGCCGATTATGATTGCGCCAACAGCCATGCAGAAGATGGCTCACCCTGATG
GTGAGTATGCAACAGCAAGAGCTGCATCTGCAGCT
GGAACTATTATG
ACCTTGTCTTCATGGGCTACATCAAGTGTTGAGGAGGTTGCTTCAACAGGACCTGGAATCCGTTTCTTCCAGCTTTATGTGTACAAGGACAGGAACGTGGTTGCTCAG
CTTGTGCGAAGAGCCGAAAGAGCTGGTTTTAAGGCTATCGCTCTTACAGTTGATACACCTAGGCTTGGACGCCGAGAAGCTGACATCAAAAACAGGTTTACTCTACCACCATTTTTGACA
CTGAAGAACTTTGAGGGTTTGGACCTTGGCAAGATGGATGAA
GCTAATGATTCTGGTTTAGCTTCTTATGTTGCTGGTCAGATCGACCGCACCTTGAGCTGGAAGGATGTGAAGTGGCTA
CAAACAATTACCACAATGCCGATCCTCGTTAAGGGTGTTATCACTGCTGAGGACA
CAAGGTTAGCTATTCAAGCTGGAGCAGCGGGTATTATTGTTTCCAACCATGGAGCTCGCCAGCTG
GATTACGTTCCGGCTACAATCAGCGCTTTGGAAGAGGTTGTGAAAGCGGCACAGGGTCGTGTCCCAGTGTTCCTGGACGGTGGTGTCCGCCGTGGAACCGATGTTTTCAAGGCACTGGCT
CTTGGAGCTTCTGGCATCTTT
ATCGGGCGACCTGTGGTGTTTTCTTTGGCTGCTGAGGGAGAAGCTGGAGTGAGAAATGTACTCAAAATGTTACGTGATGAATTCGAGCTAACTATGGCA
CTAAGCGGTTGCACCTCACTCAGAGAGATCACTCGTGACCACATTGTGACCGAGTGGGACGCCCCAAAGGCTCGTCCTGCACCACGGTTGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAATAATCTT TTAAAGTTTG TTTGGTTATC TTCACTTGTT ATCTATCTTG GGCTTTGCCC CTCTCACCAA AAATACCAAG TGTCCAAAAG GGTAGTGAAG AAAAATGGAG GTCACAAATG  TCACTGAGTA TCAGGCTATT GCCAAGGAGA AGTTGCCAAA GATGGTCTAT GACTACTATG CTTCTGGTGC CGAGGATCAG TGGACTCTCG AAGAGAACCG AAACGCTTTT TCAAGAATAT  TGTTTAGGCC GCGCATTCTT ATTGATGTGA GCAAGATTGA CATGACTACC ACAATTTTGG GATTCAAATT ATCGATGCCG ATTATGATTG CGCCAACAGC CATGCAGAAG ATGGCTCACC  CTGATGGTGA GTATGCAACA GCAAGAGCTG CATCTGCAGC TGGAACTATT ATGACCTTGT CTTCATGGGC TACATCAAGT GTTGAGGAGG TTGCTTCAAC AGGACCTGGA ATCCGTTTCT  TCCAGCTTTA TGTGTACAAG GACAGGAACG TGGTTGCTCA GCTTGTGCGA AGAGCCGAAA GAGCTGGTTT TAAGGCTATC GCTCTTACAG TTGATACACC TAGGCTTGGA CGCCGAGAAG  CTGACATCAA AAACAGGTTT ACTCTACCAC CATTTTTGAC ACTGAAGAAC TTTGAGGGTT TGGACCTTGG CAAGATGGAT GAAGCTAATG ATTCTGGTTT AGCTTCTTAT GTTGCTGGTC  AGATCGACCG CACCTTGAGC TGGAAGGATG TGAAGTGGCT ACAAACAATT ACCACAATGC CGATCCTCGT TAAGGGTGTT ATCACTGCTG AGGACACAAG GTTAGCTATT CAAGCTGGAG  CAGCGGGTAT TATTGTTTCC AACCATGGAG CTCGCCAGCT GGATTACGTT CCGGCTACAA TCAGCGCTTT GGAAGAGGTT GTGAAAGCGG CACAGGGTCG TGTCCCAGTG TTCCTGGACG  GTGGTGTCCG CCGTGGAACC GATGTTTTCA AGGCACTGGC TCTTGGAGCT TCTGGCATCT TTATCGGGCG ACCTGTGGTG TTTTCTTTGG CTGCTGAGGG AGAAGCTGGA GTGAGAAATG  TACTCAAAAT GTTACGTGAT GAATTCGAGC TAACTATGGC ACTAAGCGGT TGCACCTCAC TCAGAGAGAT CACTCGTGAC CACATTGTGA CCGAGTGGGA CGCCCCAAAG GCTCGTCCTG  CACCACGGTT GTAAACAAAA ACATGATACG GTCATAAGCA TCTCGACTTT TAATGGCACA TTATAAGGTA TATACCTTGT GTTACGGTTG CAAAACTCAT ATTGTTTCCT TGTATAATGT  TCGTTTCTGA ATGATCGGCT GTATGGATGT ATAATTCTTA AAGGTTCATG GCTTTACTTA TATATATGTG GTTAATTAAT AATTGTATAC ATATGATCCA CATTTAACTT GGATAATAAC 
TTAATATATT AAACATGAAT TCGTAA 

Retrieve as FASTA