Entry information : HaGOX05 (HanXRQChr10g0311871)
Entry ID 13764
Creation 2016-05-30 (Christophe Dunand)
Last sequence changes 2017-12-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-07 (Christophe Dunand)
Peroxidase information: HaGOX05 (HanXRQChr10g0311871)
Name (synonym) HaGOX05 (HanXRQChr10g0311871)
Class Glycolate Oxidase    [Orthogroup: GOX002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGOX05
start..stop
S start..stop
HaGOX06 701 0 1..364 5..369
HaGOX07 627 0 22..364 1..343
AtGOX01 563 0 3..356 2..355
AtGOX02 556 0 3..364 2..363
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 220535931..220536073 143 N° 2 220535715..220535839 125 N° 3 220534173..220534219 47 N° 4 220534003..220534080 78
N° 5 220533799..220533923 125 N° 6 220533202..220533259 58 N° 7 220533063..220533125 63 N° 8 220532653..220532722 70
N° 9 220532469..220532569 101 N° 10 220532283..220532387 105 N° 11 220532017..220532196 180  
complement(join(220532017..220532196,220532283..220532387,220532469..220532569,2 20532653..220532722,220533063..220533125,220533202..220533259,220533799..2205339 23,220534003..220534080,220534173..220534219,220535715..220535839,220535931..220 536073))


exon

Literature and cross-references HaGOX05 (HanXRQChr10g0311871)
Protein ref. UniProtKB:   B8N366
DNA ref. GenBank:   AAIH01000489 (13306..9868)
EST ref. GenBank:   CO147399
Cluster/Prediction ref. HanXRQ:   HanXRQChr10g0311871
Protein sequence: HaGOX05 (HanXRQChr10g0311871)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   385
PWM (Da):   %s   42248.04  
PI (pH):   %s   6.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGDEPVNVKEYQELAKQALPKMYYDFFAGGSEDQHTLKENVEAFQRITLRPRVLVDVSKIDMSTTILGYKTSAPIIVAPTSLHQLAHPGEILTAKAAAACNVIGLSFSSTCTIEEVASSCNAVRFFQLYVYKRRDISALMVKRAEANGFKAILLTVDTPKMGHREADIKNKMIAPQLKNFEGLMSTTVDSEGSNLEAFTSSSLDPSLSWKDIAWLKSITQLPILIKGVLTREDVIKAMEIGVEGIIASNHGGRQLDYVPAAIDALEVVLAVQGRIPVLFDGGIRRGTDVFKALALGAQAVMVGRPVLYGLAAKGEYGVKRVIEMLKDELELTMALSGCPTLNDITRNHVRTQIDDHHSRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGATGAACCAGTCAATGTGAAGGAGTATCAAGAACTGGCAAAACAGGCCCTTCCAAAAATGTATTATGACTTCTTTGCTGGCGGATCCGAGGATCAACACACACTCAAAGAAAAT
GTTGAAGCATTTCAACGAATTAC
GTAACACATTAACTTTATATTTCATTGATTACAGTTTTGTTATAACTTATCACATACATATATTATCTTTATGACAACATTCTATAAACAGTCTTCG
GCCGAGAGTTCTTGTGGATGTGAGCAAAATAGACATGTCAACAACCATATTGGGTTACAAAACTTCAGCACCAATTATTGTTGCTCCAACTTCTTTGCATCAGTTGGCACATCCTCAAG
G
TAGAAAATTCATAAGCCATAGTTATCGATAGCGAATAGCGACAAATAGCGACAACGTACCTATATGCTACGTAGCGATAGCGATGAAATAGCGCCCGCTATTTCGTGTTTAGCGATAAGG
TAGTTAAAAATTTAAGAAATAAAACATAGCTATCTACATAACTTTTTTTTATATATAAAGTTAGTTTTATACCTTTTATGTGTAAATTTATAGGTTTAAGGACCAAATCTAAGCTAGTAA
AAATAGGGGGGGTTAAATGTTAAAATACACAAACCAATTTTACCCACTTTTTATGTAAATTTTACAAGTTTTAATGACTAAATGTAACCTAATAAAAAATAGAGGGGTTAAATGTTAAAA
TCCATAAAGTTATCTAACCCTAGAAAGGCTCAGACACGACAAAAACAAAAAAGGCAGCCGCTCAGCCACTCTCTCTTCTTCTTCTTCTTCATAGTTTCCGGCAGAAATTGCAGGTTTCTG
GCCGGAGCAACAAAAAAAAAACGCAGCCGCTCTTCTCTTCTTCTTCATAGTTTCCAGCAAGTTTCCGGCAGATTTCCGGCAAAAATTGCAGGTTTCCGGCAGAAATTGCAGGTTTCCGGC
CGCTATTTTCACGCTATTCAGCGCTATACACCATATAGCGACCATGTCTCGCCTCGCCACGCTATTCGCGATAGCGGTCGCTATGGCCGCTATCGATAACTATGTCATAAGCGATAATAT
TCTTAAACTGATTGACTATTTAATGAAAAAAAACAAATAAAAAAAGAGAAAATTACGAAAATAGCCAAGACCAGGGTTGAATTACGAAAATAGCCACCTCATGCGTCCTTGGAGTGGCGC
ATCACGGATTCAAATGCGTTGGATGCGTCTGGAAGTCTTGGGATGCGTCTTTGGAGCGAAACCCAATAGAAAATGGACACGTGACGGCAGACTCCTCCAAGGGGTCAGGCAGACTCTTCC
AAGGGGTCAGACAGGCTCTTCCAAAAGGTCAGGCAGACTCTTCCAAGGAGTCAGGCCTGACGCCTTGGATCTCACACTCGGAGGAGTCTGCTTGACTCATTGGAGAAGTCTGTCTGACCC
CTTGGAGGAGTCTGTTTGACCCCTTGGAGGAGTCTGCCACCACGTGTCCATTTTCTATTGGGTTTCGCTCCAAAGACACATCCCATTGTTTCCAGACGCATCCCGCGCATTTGAATCCCT
GATGCGCCACTCCAAGGACGCATGAGGTGGCTATTTACATTAAAGTATTCCTATGTGATTACCTAAACAGGATAAAAGATCAGGTTCTAGAGTTTAAAAAGAATCATTTCATATAAATTT
GTTTTTTTTTTTGTTGTAAATTGCAACTTAGTAAAATATGCAAAAGAAAATTAGAAGATATTGTGTTAATCTGGTTGTGTCTGTGTCAACACGTGACGTGTCGGGGTTCATGTGTATGAC
ACGATTTACAACTATTATTTCGTGTGTTTGTGATTATTGATTGTGTTTTTTCAGGAGAGATCTTGACCGCCAAAGCAGCGGCTGCATGTAATGTCATAATGGTAATTTTATAGCTACAAC
TCCAGCTTGCTAAATTTCTTGTTTTATTTAATTTAATCTTATTTTATTTTTCTTTTTTCTGTTGTGCTGCCAGGGGTTATCTTTCTCGTCTACATGCACAATTGAGGAAGTTGCTTCGAG
TTGCAATGCTGTTCGATTCTTTCAGTTATAT
GTATGCAACTGTTACATTCCAAATCAAGTTTTTAATATTTGTGTGAAACTTTATATTATTTTGCATTTGTTTTAATTAGGTGTACAAGA
GACGTGACATATCGGCTTTGATGGTTAAAAGAGCTGAAGCAAATGGATTCAAAGCGATTCTTCTTACTGTTGATACTCCTAAAATGGGTCATAGGGAGGCTGATATCAAAAACAA
GTAAA
AACATCGCGTAAAATAGTTTCGTTTTGGGTTAATACCATAAAAACCAATATATTTTTCGTTTTTCATGAAAAAAAATCCACAACCTAATTTTGGTATTTTTAAAGTCTAAAAATACACAA
ATAAATTAAATCATTGAACTCGTTTTTGTATATTAAAGTCTCTAAACGTGTCTCCAACGCACTAACTTTTTTTAATTGATTGTTTAACTCCTCAATTGATCAAAATAAGTTGGTTTAAAT
TTATTAATTTTTTTAAGTTGAATGCCATTTTTTCAAGTTTTGACAAATTTAATAGCGAACAAAGCATCATTTAAAAAAAATACATGTAAGTGTATTTTAGACAAGTTTAGAGACTTTAAT
ATAAAAAAATATTTTGTGACTTTTTCATGTACTTTTTTACAAGTTGAGGGTCTTTAATATACCAAAATTATGTTTAGTAACTTTTTCGTGGCTTTTCATGGTATTGAACTTTTTTTTGAT
AATTTTAATTCTTTTTTTTTTTACAAATAATTAATCTAGCAACATTTTATGTAGAATGATTGCACCCCAATTGAAGAATTTTGAAGGTCTTATGTCAACTACAGTTGATAATGCAAGTGA
AATCACTATCTTTTTGTTGGATTTTTGTTATGCATTTCTTTTAATGATCATTTACATGTGGTTTGTAGAGTGAGGGTTCAAATCTTGAAGCATTTACATCTAGCAGCCTTGATCCTTCTC
TTTCTTGGAAG
GTATAATAAATAATTACTTTTGACATCTCCTTGTTCTTCTACAACCATGATAATTCAATCTATGAGTCTTGACACAAAGTGGAAACAAATAAAATTATGGGCCCCGTTA
TCCGACATGGGCCCCGTAACTCCAGACGTAGCCTAAGTTATGCCCTTTTTAAGTTGGGCAGTTTGCCACACAATCCGGCCCATAGAGATGTTTTCGTCCATTACTTATGGGCCTCGTAAG
TTATGCCCTTTTTAAGTTGAGTCCAAATATGAATCCGGCTATTGGATTAGTTTGGTATTATAATAGCCTTTATGGTTTGCTAGAAGTAGTTATAGCTGATTTGTTTTGCAGGATATTGCA
TGGTTAAAGTCCATTACGCAATTGCCGATTTTGATAAAGGGTGTGCTCACTCGCGAGGATG
GTAAAGACCGATTTAACCGGTTTCTCATCCCACCCAACCTTTTCATCTTGTCATCTCTA
ATCTTAGTATGTGTTTCTTGGCAGTCATTAAGGCTATGGAAATAGGAGTTGAAGGAATTATAGCATCTAATCATGGAGGTCGCCAACTAGATTATGTACCAGCCGCCATTGATGCTCTTG
AAGAA
GTAGTTATCCACATAATCGTAATCACTTAACAAACCCAAATTCGCATATCGCCGTTTATTAAGAAAGTTATTGGGTTGCAGGTGGTCCTTGCAGTTCAAGGAAGAATACCAGTTC
TCTTTGATGGGGGAATACGGCGAGGAACAGATGTATTCAAAGCTTTAGCTCTTGGTGCACAGGCCGTTATG
GTAATTTCACCTACAAATGTTGCATAAAAACTTTAATCTTTAGTGATTT
CTTATAATTATAGGTGACGATATAACTGATATTGCAGGTAGGGCGACCGGTTTTGTATGGGTTGGCGGCGAAGGGTGAGTATGGAGTTAAAAGAGTGATTGAAATGTTGAAGGATGAACT
TGAGCTCACAATGGCTCTCTCTGGCTGCCCCACTCTCAATGATATTACCAGAAATCATGTCAGAACGCAGATCGATGATCACCATTCTAGATTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGATGAACCAGTCAATGTGAAGGAGTATCAAGAACTGGCAAAACAGGCCCTTCCAAAAATGTATTATGACTTCTTTGCTGGCGGATCCGAGGATCAACACACACTCAAAGAAAAT
GTTGAAGCATTTCAACGAATTAC
TCTTCGGCCGAGAGTTCTTGTGGATGTGAGCAAAATAGACATGTCAACAACCATATTGGGTTACAAAACTTCAGCACCAATTATTGTTGCTCCAACT
TCTTTGCATCAGTTGGCACATCCTCAAG
GAGAGATCTTGACCGCCAAAGCAGCGGCTGCATGTAATGTCATAATGGGGTTATCTTTCTCGTCTACATGCACAATTGAGGAAGTTGCTTCG
AGTTGCAATGCTGTTCGATTCTTTCAGTTATAT
GTGTACAAGAGACGTGACATATCGGCTTTGATGGTTAAAAGAGCTGAAGCAAATGGATTCAAAGCGATTCTTCTTACTGTTGATACT
CCTAAAATGGGTCATAGGGAGGCTGATATCAAAAACAA
AATGATTGCACCCCAATTGAAGAATTTTGAAGGTCTTATGTCAACTACAGTTGATAATAGTGAGGGTTCAAATCTTGAAGCA
TTTACATCTAGCAGCCTTGATCCTTCTCTTTCTTGGAAG
GATATTGCATGGTTAAAGTCCATTACGCAATTGCCGATTTTGATAAAGGGTGTGCTCACTCGCGAGGATGTCATTAAGGCT
ATGGAAATAGGAGTTGAAGGAATTATAGCATCTAATCATGGAGGTCGCCAACTAGATTATGTACCAGCCGCCATTGATGCTCTTGAAGAA
GTGGTCCTTGCAGTTCAAGGAAGAATACCA
GTTCTCTTTGATGGGGGAATACGGCGAGGAACAGATGTATTCAAAGCTTTAGCTCTTGGTGCACAGGCCGTTATG
GTAGGGCGACCGGTTTTGTATGGGTTGGCGGCGAAGGGTGAGTAT
GGAGTTAAAAGAGTGATTGAAATGTTGAAGGATGAACTTGAGCTCACAATGGCTCTCTCTGGCTGCCCCACTCTCAATGATATTACCAGAAATCATGTCAGAACGCAGATCGATGATCAC
CATTCTAGATTGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTAATG AACCGCCTTA CTCTCCACTC AGATCTATAC CATTTAAAGA AACAAAAGTG AGAATGGGTG ATGAACCAGT CAATGTGAAG GAGTATCAAG AACTGGCAAA ACAGGCCCTT  CCAAAAATGT ATTATGACTT CTTTGCTGGC GGATCCGAGG ATCAACACAC ACTCAAAGAA AATGTTGAAG CATTTCAACG AATTACTCTT CGGCCGAGAG TTCTTGTGGA TGTGAGCAAA  ATAGACATGT CAACAACCAT ATTGGGTTAC AAAACTTCAG CACCAATTAT TGTTGCTCCA ACTTCTTTGC ATCAGTTGGC ACATCCTCAA GGAGAGATCT TGACCGCCAA AGCAGCGGCT  GCATGTAATG TCATAATGGG GTTATCTTTC TCGTCTACAT GCACAATTGA GGAAGTTGCT TCGAGTTGCA ATGCTGTTCG ATTCTTTCAG TTATATGTGT ACAAGAGACG TGACATATCG  GCTTTGATGG TTAAAAGAGC TGAAGCAAAT GGATTCAAAG CGATTCTTCT TACTGTTGAT ACTCCTAAAA TGGGTCATAG GGAGGCTGAT ATCAAAAACA AAATGATTGC ACCCCAATTG  AAGAATTTTG AAGGTCTTAT GTCAACTACA GTTGATAATA GTGAGGGTTC AAATCTTGAA GCATTTACAT CTAGCAGCCT TGATCCTTCT CTTTCTTGGA AGGATATTGC ATGGTTAAAG  TCCATTACGC AATTGCCGAT TTTGATAAAG GGTGTGCTCA CTCGCGAGGA TGTCATTAAG GCTATGGAAA TAGGAGTTGA AGGAATTATA GCATCTAATC ATGGAGGTCG CCAACTAGAT  TATGTACCAG CCGCCATTGA TGCTCTTGAA GAAGTGGTCC TTGCAGTTCA AGGAAGAATA CCAGTTCTCT TTGATGGGGG AATACGGCGA GGAACAGATG TATTCAAAGC TTTAGCTCTT  GGTGCACAGG CCGTTATGGT AGGGCGACCG GTTTTGTATG GGTTGGCGGC GAAGGGTGAG TATGGAGTTA AAAGAGTGAT TGAAATGTTG AAGGATGAAC TTGAGCTCAC AATGGCTCTC  TCTGGCTGCC CCACTCTCAA TGATATTACC AGAAATCATG TCAGAACGCA GATCGATGAT CACCATTCTA GATTGTAGTT TCAGATAATC TTATCGAGAA TCATTTGATA ATAATATCCT 
GGATGAATAA ATTGTTATAG ATCCATGATG TTATGT 

Retrieve as FASTA