Entry information : HaGOX06 (HanXRQChr10g0311881)
Entry ID 13765
Creation 2016-05-30 (Christophe Dunand)
Last sequence changes 2016-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGOX06 (HanXRQChr10g0311881)
Name (synonym) HaGOX06 (HanXRQChr10g0311881)
Class Glycolate Oxidase    [Orthogroup: GOX002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGOX06
start..stop
S start..stop
HaGOX05 701 0 5..369 1..364
HaGOX07 636 0 26..369 1..343
AtGOX01 567 0 7..360 2..355
AtGOX02 558 0 7..360 2..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 220548282..220548292 11 N° 2 220547713..220547856 144 N° 3 220547497..220547621 125 N° 4 220546703..220546749 47
N° 5 220546544..220546621 78 N° 6 220546346..220546470 125 N° 7 220546211..220546268 58 N° 8 220546063..220546125 63
N° 9 220545366..220545435 70 N° 10 220545202..220545302 101 N° 11 220545010..220545114 105 N° 12 220544730..220544912 183
complement(join(220544730..220544912,220545010..220545114,220545202..220545302,2 20545366..220545435,220546063..220546125,220546211..220546268,220546346..2205464 70,220546544..220546621,220546703..220546749,220547497..220547621,220547713..220 547856,220548282..220548292))


exon

Literature and cross-references HaGOX06 (HanXRQChr10g0311881)
DNA ref. HanXRQ genome:   HanXRQChr10 (220548292..220544730)
Cluster/Prediction ref. HanXRQ:   HanXRQChr10g0311881
Protein sequence: HaGOX06 (HanXRQChr10g0311881)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369
PWM (Da):   %s   40690.24  
PI (pH):   %s   6.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIFIMGDEPVNVKEYQELAKQALPKMYYDFFAGGSEDQHTLKENVEAFQRITLRPRILVDVSKIDMSTTILGYKTSAPIMIAPTSLHQLAHPGEILTAKAAAACNVIGLSFSSTCTIEEVASSCNAVRFFQLYMYKRREISALMVKRAEINGFKAILLTVDSPKLGRREADIKNKMIAPQLKNFEGLVSTEVHSEGSNLEAYASRTLDPSFSWKDIAWLKSITNLPILIKGVLTREDVIKAMEIGVEGVIVSNHGARQLDYVPATIDALEVVLAVQGRIPVLFDGGIRRGTDVFKALALGAQAVMVGRPIVFGLAAKGEYGVKRVIEMLKDELELTMALSGCPTLNDITRNHVRTQIDDDRHCRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTTTTATGTTATATTCTTGACTATCTTAATTATAATCCAATTCATCATCATGTTAACTAGTTTAGTTAGTCTTGATTTTAGGGTTCTAGACATGCAACATCACTTCCTAACTGTCC
ACAGTTTCATTTCTAAATTGGCCCATCACACTTTCAAATTTCTTGACTTCTGAAATTTTATTACTTTGGCTTCTTCTTTAAAAGTGAAGCCTTTAATCTTTGTTTTCACTATAATTTGTA
AAATTTGAGGATTGATGTTAGAATCCTATTAACCAACTAGTGAGACGGTCTCACTGAGCCGCCACTAGGGGCTCAGCCCCTTGGACCCCGCGTAGATGCATATCGTGCACATACGGCTCA
AACTGAACCCGAAATATTTAATGATGATAAAAAAGCTTAACTAATCCTAATTCTTGATACCACAAACAATAGTGAGAATGGGTGATGAACCAGTGAATGTGAAGGAATATCAAGAACTGG
CAAAACAGGCCCTTCCAAAAATGTATTATGACTTCTTTGCTGGCGGATCCGAGGATCAACACACACTCAAAGAAAATGTTGAAGCATTTCAACGAATTAC
GTAATACATTAACTTTATAT
TTCATTGATTACAGTTTTGTTATAACTTATCACATATATTAATTATCTTTATGACAACATTCTAAAAACAGTCTTCGGCCGAGAATTCTTGTGGATGTGAGCAAAATAGACATGTCAACA
ACCATATTGGGTTACAAAACTTCAGCACCAATTATGATTGCTCCAACTTCTTTGCACCAGTTGGCACATCCTCAAG
GTAGGAATTTCTTAATTATCAGATTTCTTAAATTTATCGAGTAC
GCCCCGCTTGAGGTATGCGCATATAATGTATATATGTGTGGGCCCTTGGGGGGGGGGGCAAAAGTGAAAGTGCACTAATTTTAACGTTATTTTACTAATTTCGTGAAAATAACGTTAAAA
AGCAAGAGACGGTTAATCATGCATCATGTGGTGGCGTTGATAGCCGAAAGACAAGGGGGTACATGCACTAATCGGTAGTTGTCTCAATTGCTGAGTGTTATGTGCCTTATGTCCAAGGAT
TGATGCAAAACTACTATCGAGCCGGGGGTCTCACTGGAAGCAGCCTCTCTATTCCTACGGAGTAGAGGTAAGGTTGTCTACATCTTACCCTCCTCAGACCCTACCTTAGCTTTGCTATCA
GTGGGATTTACTGAGTATGATGTTGATGATGATCGAGTATTTTGTGCAAAAACAAAAAAATAAAAAAAAATATTACTATGTGATAAGCTAAACAGATTGGGGTTTTATGTAGGTATTTAA
AAGATCAGGTTCTACAGGTTAACTTTAATTATTTCATATGAATTTGTATTTTTTTAGTGTAAATTTGTAACTTTAGAGTAAAATATGCAAAGAAAACTTACTAAAAAGTTAAAATATGCT
AAACACGTCATGTTGGAGTTCATGTGTATGACACGATTTACCAACCCACTAACATGGCCCATTTAAAACCCCTTATTTTGTGATTATTGATTATATTTTTCAGGAGAGATCTTGACCGCC
AAAGCAGCGGCTGCATGTAATGTCATAATG
GTAATTTGATTGCTACAACTGCAGCTTACTAAATTATTTGTGTTAGTTTATCTTATATTTCTTTTTTCTGTTCTGCTGCAGGGGTTGTCT
TTCTCGTCTACATGCACAATTGAGGAAGTTGCTTCCAGTTGCAATGCTGTTCGATTCTTTCAGTTATAT
GTATGCAACTGTTACATTCCAAATCAAGTTTTTAATTTTAGTGTGAAACAT
TATATTATTTTGGTATTGTTAGATGTACAAGAGGCGGGAAATATCGGCTTTGATGGTGAAGAGAGCTGAAATAAATGGATTCAAAGCTATTCTTCTTACTGTTGATAGTCCTAAACTCGG
TCGTAGGGAGGCTGATATAAAAAACAA
GTAAAACAAGGCGTAAAATAGTGTCAATTTTTATTCTTTTTCTAGATAAATAATTAAACTCTTAACATTTTATGTAGAATGATTGCACCCCAG
CTGAAGAATTTTGAAGGTCTTGTGTCAACTGAAGTTCATGAT
GCAAGTGAAATCACTGCCGTTTTGTTGGTTTTTTAACCTCTTTGTTATGCATATATTTTAATGAAACACTACATGTTG
AATGTAGAGTGAGGGTTCAAATCTTGAAGCTTATGCATCTAGGACCTTGGATCCTTCTTTTTCTTGGAAGGTATAATTAAAGTATCTAATTTACATCTAATAATAGCTTTTTATGGTTTA
CTAAAAGTAGTTGCATCTTATTTAGGGCTGCAAACGAACCAAACGTTCGGCGAACAGTTCGTGAACCGTTCGGCGAGAAGTTCGTTTGTGTTCGTTTGTTTATTAAACAAACGAACACAA
ACAAGAAATTTGTTCGTTTAGTTAAATGAACAAACATGAACAAAGGTCGCGTTCGTCCGTTTATGTTCGTGAACGTGTTCATTTGTGTTCGATAGTTTATTAGTGTTTTTAGTTTTTATA
TTTATTTAAATACTTCAAAAATTCCAACAAATTAAATATCTAATAAGTGTTAGTGTATTATATATTATGTTCATGAACGATTGTTTGTGTTCGCTTGTTTCCATTTGTGTTCATGAACAT
TAGTTTGTGCTCATTTGTGTTCATTAACATTCATCGCCTAAAATTAACAAACAAACAAATACGGAAAAGTTCATTTCCTTAACAAACAAACACAAACATAAAATCTCGTTCGATAAGTGT
TCGTGAACACATATATTTTTTAACAAACGAACACGAACAAGGTCTTGTTCGTGTTCGTGCGGTTCATTTGCAGCCCTAATCTTTATTTGTTTTGCAGGACATTGCATGGTTAAAGTCCAT
TACAAACTTGCCAATTTTGATAAAGGGTGTACTCACTCGCGAGGATG
GTAAGACGCGTTTCAATTTAAACCCGGTTTAACCCGTAATCTAAGCCTTATGTTTCTTGACAGTCATTAAGGC
TATGGAAATAGGAGTTGAAGGAGTTATAGTGTCTAATCATGGAGCTCGCCAGCTAGATTATGTTCCGGCCACCATTGATGCTCTAGAAGAA
GTAATTATCCATAAGTAATCATATCTTTT
AACAAAATCCGAATTCGCATACCATCTTTTGTTAAGAATTTATTGGGCTTGCTTGCAGGTGGTACTTGCAGTTCAAGGAAGAATACCGGTTCTCTTTGATGGAGGAATACGACGAGGAAC
AGATGTGTTTAAAGCTTTAGCTCTTGGTGCACAAGCTGTTATG
GTAATTTTAATTTTCACTTATATATGGAATAAACACTCTCAACATTTAGGTGATTTCTTATAGTTATATGAGATTGA
TATAATATATAATATTGCAGGTTGGGCGACCGATTGTGTTTGGATTGGCGGCAAAGGGTGAGTATGGAGTTAAAAGAGTGATTGAAATGTTGAAGGATGAACTTGAGCTCACAATGGCTC
TTTCTGGCTGCCCCACTCTTAATGATATTACCAGAAATCATGTCAGAACGCAGATCGATGATGATCGCCATTGTAGATTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTTTTATAATGGGTGATGAACCAGTGAATGTGAAGGAATATCAAGAACTGGCAAAACAGGCCCTTCCAAAAATGTATTATGACTTCTTTGCTGGCGGATCCGAGGATCAACACACA
CTCAAAGAAAATGTTGAAGCATTTCAACGAATTAC
TCTTCGGCCGAGAATTCTTGTGGATGTGAGCAAAATAGACATGTCAACAACCATATTGGGTTACAAAACTTCAGCACCAATTATG
ATTGCTCCAACTTCTTTGCACCAGTTGGCACATCCTCAAG
GAGAGATCTTGACCGCCAAAGCAGCGGCTGCATGTAATGTCATAATGGGGTTGTCTTTCTCGTCTACATGCACAATTGAG
GAAGTTGCTTCCAGTTGCAATGCTGTTCGATTCTTTCAGTTATAT
ATGTACAAGAGGCGGGAAATATCGGCTTTGATGGTGAAGAGAGCTGAAATAAATGGATTCAAAGCTATTCTTCTT
ACTGTTGATAGTCCTAAACTCGGTCGTAGGGAGGCTGATATAAAAAACAA
AATGATTGCACCCCAGCTGAAGAATTTTGAAGGTCTTGTGTCAACTGAAGTTCATGATAGTGAGGGTTCA
AATCTTGAAGCTTATGCATCTAGGACCTTGGATCCTTCTTTTTCTTGGAAG
GACATTGCATGGTTAAAGTCCATTACAAACTTGCCAATTTTGATAAAGGGTGTACTCACTCGCGAGGAT
G
TCATTAAGGCTATGGAAATAGGAGTTGAAGGAGTTATAGTGTCTAATCATGGAGCTCGCCAGCTAGATTATGTTCCGGCCACCATTGATGCTCTAGAAGAAGTGGTACTTGCAGTTCAA
GGAAGAATACCGGTTCTCTTTGATGGAGGAATACGACGAGGAACAGATGTGTTTAAAGCTTTAGCTCTTGGTGCACAAGCTGTTATG
GTTGGGCGACCGATTGTGTTTGGATTGGCGGCA
AAGGGTGAGTATGGAGTTAAAAGAGTGATTGAAATGTTGAAGGATGAACTTGAGCTCACAATGGCTCTTTCTGGCTGCCCCACTCTTAATGATATTACCAGAAATCATGTCAGAACGCAG
ATCGATGATGATCGCCATTGTAGATTGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGGCCCTGA CCCTCACTTA TCCTCTTCTG CAGATCAAAG GTATGATTTT TATAATGGGT GATGAACCAG TGAATGTGAA GGAATATCAA GAACTGGCAA AACAGGCCCT TCCAAAAATG  TATTATGACT TCTTTGCTGG CGGATCCGAG GATCAACACA CACTCAAAGA AAATGTTGAA GCATTTCAAC GAATTACTCT TCGGCCGAGA ATTCTTGTGG ATGTGAGCAA AATAGACATG  TCAACAACCA TATTGGGTTA CAAAACTTCA GCACCAATTA TGATTGCTCC AACTTCTTTG CACCAGTTGG CACATCCTCA AGGAGAGATC TTGACCGCCA AAGCAGCGGC TGCATGTAAT  GTCATAATGG GGTTGTCTTT CTCGTCTACA TGCACAATTG AGGAAGTTGC TTCCAGTTGC AATGCTGTTC GATTCTTTCA GTTATATATG TACAAGAGGC GGGAAATATC GGCTTTGATG  GTGAAGAGAG CTGAAATAAA TGGATTCAAA GCTATTCTTC TTACTGTTGA TAGTCCTAAA CTCGGTCGTA GGGAGGCTGA TATAAAAAAC AAAATGATTG CACCCCAGCT GAAGAATTTT  GAAGGTCTTG TGTCAACTGA AGTTCATGAT AGTGAGGGTT CAAATCTTGA AGCTTATGCA TCTAGGACCT TGGATCCTTC TTTTTCTTGG AAGGACATTG CATGGTTAAA GTCCATTACA  AACTTGCCAA TTTTGATAAA GGGTGTACTC ACTCGCGAGG ATGTCATTAA GGCTATGGAA ATAGGAGTTG AAGGAGTTAT AGTGTCTAAT CATGGAGCTC GCCAGCTAGA TTATGTTCCG  GCCACCATTG ATGCTCTAGA AGAAGTGGTA CTTGCAGTTC AAGGAAGAAT ACCGGTTCTC TTTGATGGAG GAATACGACG AGGAACAGAT GTGTTTAAAG CTTTAGCTCT TGGTGCACAA  GCTGTTATGG TTGGGCGACC GATTGTGTTT GGATTGGCGG CAAAGGGTGA GTATGGAGTT AAAAGAGTGA TTGAAATGTT GAAGGATGAA CTTGAGCTCA CAATGGCTCT TTCTGGCTGC  CCCACTCTTA ATGATATTAC CAGAAATCAT GTCAGAACGC AGATCGATGA TGATCGCCAT TGTAGATTGT AGTTTAAAAC AATCTTATCG AGAATCATTT GATAAGGATA TACTTGATGA  ATAAGTTGTT ACAGATCCAA TGCTATATAT TGATCTTAAA TTTTCATAAC ACAAGAGTGG TAGTCGGGGA GCATTCGGGG TGTGTTGCTA TTAGAATTGT AATGCTTCTT CATCTATGTT 
GTTGATTAAC TTACTCTTT 

Retrieve as FASTA