Entry information : HaGOX07 (HanXRQChr12g0360171)
Entry ID 13766
Creation 2016-05-30 (Christophe Dunand)
Last sequence changes 2016-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGOX07 (HanXRQChr12g0360171)
Name (synonym) HaGOX07 (HanXRQChr12g0360171)
Class Glycolate Oxidase    [Orthogroup: GOX002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGOX07
start..stop
S start..stop
HaGOX06 636 0 1..343 26..369
HaGOX05 627 0 1..343 22..364
AtGOX01 543 0 1..334 21..354
AtGOX02 533 0 1..343 21..363
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18533998..18534077 80 N° 2 18534159..18534283 125 N° 3 18534376..18534422 47 N° 4 18535364..18535441 78
N° 5 18535579..18535703 125 N° 6 18535779..18535836 58 N° 7 18535950..18536012 63 N° 8 18536102..18536171 70
N° 9 18536253..18536353 101 N° 10 18536850..18536954 105 N° 11 18537036..18537215 180  
join(18533998..18534077,18534159..18534283,18534376..18534422,18535364..18535441 ,18535579..18535703,18535779..18535836,18535950..18536012,18536102..18536171,185 36253..18536353,18536850..18536954,18537036..18537215)


exon

Literature and cross-references HaGOX07 (HanXRQChr12g0360171)
DNA ref. HanXRQ genome:   HanXRQChr12 (18533998..18537215)
Cluster/Prediction ref. HanXRQ:   HanXRQChr12g0360171
Protein sequence: HaGOX07 (HanXRQChr12g0360171)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343
PWM (Da):   %s   37656.71  
PI (pH):   %s   8.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYYDYFAGGSEDQHTLRENVDAFQRIIIRPRILVDVSKIDMSTTILGYKTSAPIMIAPTAMHKLAHPGEILTAKAAAACNVIGLSFMSTCTIEEVASSCNAVRFFQLYVYKRREIAALMVKRAETNGFKAILLTVDTPKLGRREADIKNKMIAPQLKNFEGLISTEVDNKGSNLEASASRNFDPSVSWKDIAWLKSITKLPIMIKGVLTREDAIKALEVGVEGIIVSNHGARQLDYVPATISVLEVVDAVQGRVPVLFDGGIRQGTDVFKALALGADAVMVGRPIVYGLAAKGEYGVRRVIKMLKDELELTMALSGCPTLNDITRNHVRTRVDNHHCRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATTACGACTACTTTGCTGGAGGATCTGAGGATCAACACACACTCAGAGAAAATGTTGATGCATTTCAAAGAATTATGTAATACGTTATAATTATATATTTAATTATATGATTTTAA
TTATCATTTACATTCTTTTTCTAACTACATTTTATCGACAGTATTCGGCCAAGAATTCTTGTGGATGTGAGCAAAATAGATATGTCAACAACCATATTGGGTTACAAAACTTCAGCACCA
ATTATGATTGCTCCAACTGCTATGCATAAATTGGCACATCCTGAAG
GTAGTTATATCATATCATGCTTACGAAAGTGTTGTATGTCGTATAACAGCGTGCTTGTGTCTGAGAAACTGTTT
TTTTTTTGTGTGTTTTAGGAGAGATCTTGACAGCCAAGGCAGCGGCTGCATGTAATGTCATAATGGTAATTTAAAATGCCACCGCTGCAACTCGGTAGATTAGTGTCTTAGGGGTAAAGA
TCAAATACAAATGAGTCTTAACATACTAAACATGAGAAGTGAAGGATGCTGACTCCAGGATTCGGCGAGTTTGACGGAGCTTCGGTCCAGATCCGACGTGTTCTGTGCGATTATTACGAC
TAAGAAAGGAGTAGAAACAGAATACGACACCGATCAGTCAATTTCAATCTGGTCTCTATTGTTATTCAACGTTTACAGCACCACCAGACCACTTGGACAGCATGTCCCCTCTGGGAACCA
AAAGCTTGTCCAAATGGGAACCCCATATGCCCCTATTTATAGACAACTCCTATGTGTCCATCCGATTGGATTGCCATCCGTCCGGATGGACCTTGACATTTACAAAACTTGTCCAACTTT
CTCCTATTCTATACAATATTCAACACACGCCCTATCTAACTATTCGCACAGTGGCAGACGTACGAAATATGCACCAACAAAGGAAGATTTATTTTTTTATTTATTTTTTTTCCTCATCTA
CTTAAGCATGATGTTTAGTTGAAAAATGTAAAGAATAAAAAAAGTTTTTTTCGTGTATTTACTCTTGTAGAGTAATTATGTGTAATTACATTAGAGTGATTACAACTCTACTAATGTACA
ACAACAACAACCATACCCAGTAAATCCCACAAATAGCAAAGCTACTTATAGGGTCTGGGGAGGGTGGGATGTAGACAGACCTTGCCTCTATCCATAGGGATAGAGAGGCTGCTCAACTCT
ACTAATGTAAATACATGATTTTTTTTTTTTTGATTCTGGGACTAAAATACATGCTTGACACGATGGAAAAAAAATCCCTCATTCGCTTCTCACTTTTAGTGTGTTAAGCTCATTTGTACA
ATAACCTTACTCTACTTTTTATATTATTTTTATTTTGTCTTCTCAGGGGTTATCTTTCATGTCTACATGCACAATAGAGGAAGTTGCTTCCAGTTGCAATGCTGTTCGATTCTTTCAGTT
ATAT
GTATGCAATCTTCATGACTCCGTTATTTTTTCTTTTCTTTGGATGACCATGAGAACCCGTTAAAGAAAACTCATGGGCCCCACATGTACTCTGCTAAGTCAGTGTAAAATATTATA
TTGTTTTGCATTTGTTCTTAGGTCTACAAGAGACGTGAAATAGCCGCTCTGATGGTGAAAAGAGCTGAAACAAATGGATTCAAAGCTATTCTTCTTACGGTTGACACTCCTAAACTTGGT
CGTAGGGAAGCCGACATAAAAAACAA
GTAAAAATATTTTGTTCTTTTTCTACATAAATAATTAATCTCCTTTATTACGCGACTCTTGAACGTTTTATGTAGAATGATTGCGCCTCAGCTG
AAGAATTTTGAAGGTCTCATTTCAACTGAAGTTGATGAT
GCAAGTGAAATTACCATAATTTTGTTGGGGTTTTTTTTTTTTTTTTTTTGTTTTGTTTTTCAAAATTCCCTATCATGCATA
AATAATAACAGTTAATTATATGTGTTTTGCAGAATAAGGGTTCAAATCTTGAAGCTTCTGCATCCAGGAACTTTGATCCTTCTGTATCTTGGAAGGTATAAACCGTAAACGTTTCGAACG
AAAGGAACCATAATTTCGAATGTATTAGTTCACTGAAAGTAGTTACATCTCGTATATTTTGCAGGACATTGCTTGGCTAAAGTCCATTACAAAGTTGCCGATAATGATCAAGGGTGTACT
TACCCGTGAAGACG
GTAAGACCCGTTTGACCCATTACCCAACCCACTCGATCCACCTATCGTGTCACCTCTAATCTCGCCTATGTATCCTGGCAGCCATTAAAGCTTTGGAAGTAGGAGT
TGAAGGAATCATCGTCTCTAACCATGGAGCTCGCCAGCTAGATTATGTTCCCGCCACCATTTCTGTTCTCGAAGAG
GTGCTTAATCTTATCATCACTTACCGAGTATATAAAAAACAAAA
GTAGCCATATGGCCCATATTTTCGTCCATGAGGTTTGACCAGTTTTGCGACTTTCATCCAAAGGTTTGTTTTTCCACATCTGGATCCAAAAAGTTTGAAATCTTGCCATCTTCATCTGGC
TCGTTAGCTCTATCCATTTTTCTCCATTATGTTAGGGGTATTCCCGTCTTTTTTGTTAACTTAAAGGGCAATTCGGTCTTTTTTCAGGGTATTTGGTCTTTTAACATAAAGTGAAAAAGA
CCGAATTGCCTTTTAAGTTAGCAAAAAAGACGGAAATACCCCTGACTTAACGGAGAAAAATGGATGGAGCTAATGGGCCGAATGAAAATGGCAAGATTTCAAACCTTTTGGATCCAGATG
TGGAAAAACAAACCTTTGGACGAAAGTCGCAAAACTGGCCAAACCTCATAGGGACGAAAATGGCATTTACTCTCTATAATTTATGTTTGCAGGTGGTAGATGCGGTTCAAGGAAGAGTAC
CGGTTCTGTTTGATGGAGGAATAAGGCAAGGAACGGATGTATTCAAAGCTTTAGCTCTCGGTGCAGACGCGGTTATG
GTAGTTCACAACTGCAAATGATGGATAAAACCTCAAAATTTCT
TATGATAATGCTACTCATGATATCAAATAACATTGCAGGTTGGGAGACCGATTGTGTACGGGTTGGCAGCGAAGGGGGAGTATGGAGTTAGAAGAGTGATTAAAATGTTGAAGGATGAAC
TCGAGCTTACGATGGCTCTTTCGGGTTGCCCCACTCTCAATGATATAACCAGGAACCATGTCAGAACCCGAGTCGACAATCACCATTGTAGACTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATTACGACTACTTTGCTGGAGGATCTGAGGATCAACACACACTCAGAGAAAATGTTGATGCATTTCAAAGAATTATTATTCGGCCAAGAATTCTTGTGGATGTGAGCAAAATAGAT
ATGTCAACAACCATATTGGGTTACAAAACTTCAGCACCAATTATGATTGCTCCAACTGCTATGCATAAATTGGCACATCCTGAAG
GAGAGATCTTGACAGCCAAGGCAGCGGCTGCATGT
AATGTCATAATG
GGGTTATCTTTCATGTCTACATGCACAATAGAGGAAGTTGCTTCCAGTTGCAATGCTGTTCGATTCTTTCAGTTATATGTCTACAAGAGACGTGAAATAGCCGCTCTG
ATGGTGAAAAGAGCTGAAACAAATGGATTCAAAGCTATTCTTCTTACGGTTGACACTCCTAAACTTGGTCGTAGGGAAGCCGACATAAAAAACAA
AATGATTGCGCCTCAGCTGAAGAAT
TTTGAAGGTCTCATTTCAACTGAAGTTGATGAT
AATAAGGGTTCAAATCTTGAAGCTTCTGCATCCAGGAACTTTGATCCTTCTGTATCTTGGAAGGACATTGCTTGGCTAAAGTCCATT
ACAAAGTTGCCGATAATGATCAAGGGTGTACTTACCCGTGAAGACG
CCATTAAAGCTTTGGAAGTAGGAGTTGAAGGAATCATCGTCTCTAACCATGGAGCTCGCCAGCTAGATTATGTT
CCCGCCACCATTTCTGTTCTCGAAGAG
GTGGTAGATGCGGTTCAAGGAAGAGTACCGGTTCTGTTTGATGGAGGAATAAGGCAAGGAACGGATGTATTCAAAGCTTTAGCTCTCGGTGCA
GACGCGGTTATG
GTTGGGAGACCGATTGTGTACGGGTTGGCAGCGAAGGGGGAGTATGGAGTTAGAAGAGTGATTAAAATGTTGAAGGATGAACTCGAGCTTACGATGGCTCTTTCGGGT
TGCCCCACTCTCAATGATATAACCAGGAACCATGTCAGAACCCGAGTCGACAATCACCATTGTAGACTGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACCGGACAAC ACATCATTTA TCTTCAAACG TTGACACATT TGTCTGACAT TCTGATTTCC CATGTAAAGT GGCTCACTTC CTAAAACAAA CTCCCCCAAC ACCAGCTTTC TCACAAGGCC  ATCACCAGAT CATTACCAAT TAAGAGAAGC AAAAGTCAAA ATGGGTGATG AACCAGTCAA TGTGAAGGAG TATCAAGAAT TGGCGAAACA AGTCCTCCCG AAAATGTATT ACGACTACTT  TGCTGGAGGA TCTGAGGATC AACACACACT CAGAGAAAAT GTTGATGCAT TTCAAAGAAT TATTATTCGG CCAAGAATTC TTGTGGATGT GAGCAAAATA GATATGTCAA CAACCATATT  GGGTTACAAA ACTTCAGCAC CAATTATGAT TGCTCCAACT GCTATGCATA AATTGGCACA TCCTGAAGGA GAGATCTTGA CAGCCAAGGC AGCGGCTGCA TGTAATGTCA TAATGGGGTT  ATCTTTCATG TCTACATGCA CAATAGAGGA AGTTGCTTCC AGTTGCAATG CTGTTCGATT CTTTCAGTTA TATGTCTACA AGAGACGTGA AATAGCCGCT CTGATGGTGA AAAGAGCTGA  AACAAATGGA TTCAAAGCTA TTCTTCTTAC GGTTGACACT CCTAAACTTG GTCGTAGGGA AGCCGACATA AAAAACAAAA TGATTGCGCC TCAGCTGAAG AATTTTGAAG GTCTCATTTC  AACTGAAGTT GATGATAATA AGGGTTCAAA TCTTGAAGCT TCTGCATCCA GGAACTTTGA TCCTTCTGTA TCTTGGAAGG ACATTGCTTG GCTAAAGTCC ATTACAAAGT TGCCGATAAT  GATCAAGGGT GTACTTACCC GTGAAGACGC CATTAAAGCT TTGGAAGTAG GAGTTGAAGG AATCATCGTC TCTAACCATG GAGCTCGCCA GCTAGATTAT GTTCCCGCCA CCATTTCTGT  TCTCGAAGAG GTGGTAGATG CGGTTCAAGG AAGAGTACCG GTTCTGTTTG ATGGAGGAAT AAGGCAAGGA ACGGATGTAT TCAAAGCTTT AGCTCTCGGT GCAGACGCGG TTATGGTTGG  GAGACCGATT GTGTACGGGT TGGCAGCGAA GGGGGAGTAT GGAGTTAGAA GAGTGATTAA AATGTTGAAG GATGAACTCG AGCTTACGAT GGCTCTTTCG GGTTGCCCCA CTCTCAATGA  TATAACCAGG AACCATGTCA GAACCCGAGT CGACAATCAC CATTGTAGAC TGTAGTTCCA AATAATCTTA TCAAGAATCA TGTGATTAGA ATAATATAGA TGGGTTGTAT GACATTTTGA  AATATAGTAT TTTTATATGA AACCAAACAT CATATAAGGA AAAATTACAA GTTTTGTCCT TTATCTTTAT ACCACTTTTC AGGCGGTGTC CTTTTTAACG AATGTTGACA GGCGGTGTCC 
TTTACTAGGT ATTTTGTTGC AAGTTTAGTC 

Retrieve as FASTA