Entry information : HaGOX08 (HanXRQChr12g0374381)
Entry ID 13767
Creation 2016-05-30 (Christophe Dunand)
Last sequence changes 2016-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGOX08 (HanXRQChr12g0374381)
Name (synonym) HaGOX08 (HanXRQChr12g0374381)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGOX08
start..stop
S start..stop
HaGOX09 744 0 1..369 1..369
BstrGOX03 712 0 1..369 1..369
ThasGOX11 700 0 1..369 1..367
ThasGOX03 685 0 1..369 1..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 84039716..84039852 137 N° 2 84039420..84039591 172 N° 3 84039107..84039184 78 N° 4 84038814..84039005 192
N° 5 84038609..84038741 133 N° 6 84038317..84038522 206 N° 7 84037496..84037687 192  
complement(join(84037496..84037687,84038317..84038522,84038609..84038741,8403881 4..84039005,84039107..84039184,84039420..84039591,84039716..84039852))


exon

Literature and cross-references HaGOX08 (HanXRQChr12g0374381)
DNA ref. HanXRQ genome:   HanXRQChr12 (84039852..84037496)
Protein sequence: HaGOX08 (HanXRQChr12g0374381)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369
PWM (Da):   %s   40423.17  
PI (pH):   %s   9.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEVTNVTEYQAIAKEKLPKMVYDYYASGAEDQWTLEENRNAFSRILFRPRILIDVSKIDMTTTILGFKISMPIMLAPTAMQKMAHPEGEYATARAASAAGTITLSSWATSSVEEVASTGPGIRFFQLYVYKDRNVVAQLVRRAERAGFKAIALTVDTPRLGRREADIKNRFTLPPFLTLKNFEGLDLGKMDEANDSGLASYVAGQIDRTLSWKDVKWLQTITSMPILVKGVITAEDTRLAIQAGAAGIIVSNHGARQLDYVPATIMALEEVVKAAQGRVPVFLDGGVRRGTDVFKALALGASGIIGRPVVFSLAAEGEAGVRKVLQMLRDEFELTMALSGCTSLKEITRNHIVTEWDAPRSRPAPRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTGACCAATGTTACAGAGTATCAGGCAATTGCGAAAGAAAAGTTGCCGAAGATGGTCTATGACTACTACGCTTCTGGTGCTGAGGACCAATGGACTCTAGAAGAAAACCGAAAC
GCGTTCTCAAGAATCTT
GTAAGTTTCGTATATATTGACCGTAAAACCGTTTTAAAATGACAAATCAAATGTTGTCTCAAAAGGGTGTTTGGATATGTGTTGTTTTGGTTTCTGACGCGTT
GGGTTTATTTAAATCAAATAGGTTTAGGCCCCGTATTCTTATTGATGTGAGCAAGATCGACATGACCACCACAATTTTGGGATTCAAGATATCGATGCCTATTATGCTTGCCCCGACAGC
CATGCAGAAAATGGCTCATCCTGAAGGCGAGTATGCAACAGCAAGAGCTGCATCTGCAGCTGGAACCATCATG
GTTTGTATTTCTAAATTGACCCGTTGTATAATTTGACTAGACCTAAT
TTGACACGTGTATAATATTAGTAGACCCAAATTGTCCCGAACCAAACTGATACTTATCTAAAATGACCCGTTTTGACCAGAATCTGTCTCGACCCGTTACCCAGTCCGGCCTGGCTTTTT
GCCAGGCTTTGGATCGAATTTATGATGGGGGCGGTTTGTTTTTTAATAATTTATTTTTTTTATTGTAGACATTGTCTTCATGGGCAACATCTAGTGTTGAGGAAGTTGCGTCAACGGGAC
CTGGAATCCGTTTCTTCCAGCTTTAC
GTAAGCAACCCGTTTCACTTTCTTAATCATAACTTACAATTAGTACGATAAGATATAATCATAAAAACTATTACAAATGACAATTTTGTCCCTG
ATCTTAGGTGTACAAGGACAGGAATGTTGTTGCTCAGCTCGTAAGGAGAGCCGAAAGAGCCGGTTTCAAGGCCATTGCCCTTACAGTTGACACACCAAGGCTTGGTCGTAGAGAAGCCGA
CATTAAAAACCGATTTACTTTACCGCCATTTTTGACATTGAAGAACTTCGAGGGCTTGGACCTCGGGAAAATGGATGAA
GTGAGTCAAAACACAACTTAAAAAGTTTATTATTGGATTAG
TGTCAATCTAACCGTAACGTGGGCAACGCAGGCTAATGACTCTGGCTTGGCTTCTTATGTTGCGGGTCAAATTGACCGCACCTTGAGCTGGAAGGACGTAAAGTGGCTCCAGACCATCAC
CAGTATGCCCATTCTGGTTAAGGGGGTGATCACTGCTGAAGACA
GTAAGAACTACAAACACGCTTGTGATTATTATCTCCGGTTTGTTCGTGTTGTTTAACTGTAACATGCTATTTTATT
AACCGCGCAGCAAGGTTAGCGATCCAAGCTGGTGCAGCGGGTATCATTGTATCGAACCATGGAGCTCGCCAGCTCGACTATGTTCCCGCTACCATTATGGCTTTGGAAGAGGTTGTGAAA
GCGGCCCAAGGTCGCGTCCCCGTGTTCTTGGACGGTGGGGTCCGCCGTGGGACGGATGTGTTTAAGGCACTGGCTCTTGGAGCTTCAGGCATATTT
GTAAGTAAAATTGCATTGTGTTTT
TTTTTTTTTTTTTTTTTTTTTTTTGAGGTTTCTACTAATAAAATAAAGTAGTGGGTTACCACCCGCGCTTTGCGGCTAGCTCGAAACGTAGATAAAAATAAGTAAATTGCGATGGGACAT
TATAGGTGACCATAAAAAAAACCACATCGCAACAGTATATTCGAAAGTCATGAAAAAGTTATCGGTTCAGATCCTTAAGGTATCAACACTCGTTATAACTAAAAAAACAAATGTCCGCAA
CAGGTTCGAAAAGTAAATGAAATAACCCGCATACGAGGGGAGATACCCAATTTATAAAAATATTACGTTGAGAAAAAAACCAAAAAGAAACGAAAAAAAAATAAGTAAATGGAAATAACT
AAAAGTTCAGGGTCTAAATTGTAATTACAATAAGGTGTAAAGGGAGAAAACTAAAAGTTGAGGGTCCAAATAGTAATTATAATAAAGTGCAAGGGTAAATAATGAAATTAAAAAAAAAAA
AAAAAGAAACCTAACTAAAGTTTAGAGACTAAATATGTTTTTACAATAGTTAAGTGACAAAAATGGTTGATGTTGACAAATTAGCCTTATAAGATATATGATAATTTTATTATTGAATTG
CGCAGATTGGGCGACCAGTGGTGTTTTCTTTAGCTGCTGAAGGAGAAGCGGGAGTGAGAAAGGTGCTTCAAATGTTACGAGATGAATTCGAGCTAACAATGGCGTTAAGTGGTTGCACGT
CGCTGAAAGAGATCACCCGCAACCATATTGTGACCGAGTGGGATGCACCTCGATCCCGCCCGGCACCAAGGTTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTGACCAATGTTACAGAGTATCAGGCAATTGCGAAAGAAAAGTTGCCGAAGATGGTCTATGACTACTACGCTTCTGGTGCTGAGGACCAATGGACTCTAGAAGAAAACCGAAAC
GCGTTCTCAAGAATCTT
GTTTAGGCCCCGTATTCTTATTGATGTGAGCAAGATCGACATGACCACCACAATTTTGGGATTCAAGATATCGATGCCTATTATGCTTGCCCCGACAGCCATG
CAGAAAATGGCTCATCCTGAAGGCGAGTATGCAACAGCAAGAGCTGCATCTGCAGCTGGAACCATCATG
ACATTGTCTTCATGGGCAACATCTAGTGTTGAGGAAGTTGCGTCAACGGGA
CCTGGAATCCGTTTCTTCCAGCTTTAC
GTGTACAAGGACAGGAATGTTGTTGCTCAGCTCGTAAGGAGAGCCGAAAGAGCCGGTTTCAAGGCCATTGCCCTTACAGTTGACACACCAAGG
CTTGGTCGTAGAGAAGCCGACATTAAAAACCGATTTACTTTACCGCCATTTTTGACATTGAAGAACTTCGAGGGCTTGGACCTCGGGAAAATGGATGAA
GCTAATGACTCTGGCTTGGCT
TCTTATGTTGCGGGTCAAATTGACCGCACCTTGAGCTGGAAGGACGTAAAGTGGCTCCAGACCATCACCAGTATGCCCATTCTGGTTAAGGGGGTGATCACTGCTGAAGACA
CAAGGTTA
GCGATCCAAGCTGGTGCAGCGGGTATCATTGTATCGAACCATGGAGCTCGCCAGCTCGACTATGTTCCCGCTACCATTATGGCTTTGGAAGAGGTTGTGAAAGCGGCCCAAGGTCGCGTC
CCCGTGTTCTTGGACGGTGGGGTCCGCCGTGGGACGGATGTGTTTAAGGCACTGGCTCTTGGAGCTTCAGGCATATTT
ATTGGGCGACCAGTGGTGTTTTCTTTAGCTGCTGAAGGAGAA
GCGGGAGTGAGAAAGGTGCTTCAAATGTTACGAGATGAATTCGAGCTAACAATGGCGTTAAGTGGTTGCACGTCGCTGAAAGAGATCACCCGCAACCATATTGTGACCGAGTGGGATGCA
CCTCGATCCCGCCCGGCACCAAGGTTATAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTGGGGGAA GAAGATAATG CAGAAAAAAC TGATAATCAC ATAATCAATC ATGTGGATCA AAGGCATCCA GCTGCATACC CTCAAATCAA ATGGATTTGG TATTCATTCT TTACCTCCAA  TCACCCATCC CCTTTTTTTG TCTTCATCCC ATTATTTTCT TCATTTTTTC TCTATATATA TACATTTTTA AATTTATCTG GTACACACCC TTCTTCCCTG ATCTATCCCT ACTTTAACTG  TTTCCTCCAT ATTTTTTGTT GCTTATCTAT ACTTGTTCAC TCTTTCCAAT AGATACAGAT ATCCAACTGC CAAAAAGATT TTGTTGGAGG AAGCATCTAG ATAAACAAGA AAGATGGAGG  TGACCAATGT TACAGAGTAT CAGGCAATTG CGAAAGAAAA GTTGCCGAAG ATGGTCTATG ACTACTACGC TTCTGGTGCT GAGGACCAAT GGACTCTAGA AGAAAACCGA AACGCGTTCT  CAAGAATCTT GTTTAGGCCC CGTATTCTTA TTGATGTGAG CAAGATCGAC ATGACCACCA CAATTTTGGG ATTCAAGATA TCGATGCCTA TTATGCTTGC CCCGACAGCC ATGCAGAAAA  TGGCTCATCC TGAAGGCGAG TATGCAACAG CAAGAGCTGC ATCTGCAGCT GGAACCATCA TGACATTGTC TTCATGGGCA ACATCTAGTG TTGAGGAAGT TGCGTCAACG GGACCTGGAA  TCCGTTTCTT CCAGCTTTAC GTGTACAAGG ACAGGAATGT TGTTGCTCAG CTCGTAAGGA GAGCCGAAAG AGCCGGTTTC AAGGCCATTG CCCTTACAGT TGACACACCA AGGCTTGGTC  GTAGAGAAGC CGACATTAAA AACCGATTTA CTTTACCGCC ATTTTTGACA TTGAAGAACT TCGAGGGCTT GGACCTCGGG AAAATGGATG AAGCTAATGA CTCTGGCTTG GCTTCTTATG  TTGCGGGTCA AATTGACCGC ACCTTGAGCT GGAAGGACGT AAAGTGGCTC CAGACCATCA CCAGTATGCC CATTCTGGTT AAGGGGGTGA TCACTGCTGA AGACACAAGG TTAGCGATCC  AAGCTGGTGC AGCGGGTATC ATTGTATCGA ACCATGGAGC TCGCCAGCTC GACTATGTTC CCGCTACCAT TATGGCTTTG GAAGAGGTTG TGAAAGCGGC CCAAGGTCGC GTCCCCGTGT  TCTTGGACGG TGGGGTCCGC CGTGGGACGG ATGTGTTTAA GGCACTGGCT CTTGGAGCTT CAGGCATATT TATTGGGCGA CCAGTGGTGT TTTCTTTAGC TGCTGAAGGA GAAGCGGGAG  TGAGAAAGGT GCTTCAAATG TTACGAGATG AATTCGAGCT AACAATGGCG TTAAGTGGTT GCACGTCGCT GAAAGAGATC ACCCGCAACC ATATTGTGAC CGAGTGGGAT GCACCTCGAT  CCCGCCCGGC ACCAAGGTTA TAGATGAACC AGAAACAGTT ATATTTCTAG TGGCAAAGCC CACATGTTAT AGTTGTAACT GGTGCTATTT CGAATTTATT TGTTGCCTGT ATTTTGAACT  TCTTGTTTTG AAATAATAAG TGGTCTGTTA TTGTAGCTGT AGCGAAAGTA AGATGCTATT ATTATCATAT ATATAGAAAA CAGGATAAAA GATCCAATAT TTAAAGAAAA CAGCATAAAA 
ATTTAATATT TAAAGAAAAT AGGATAGAAG AACCAATATT TAAAGAAAAC AGGAATAAT 

Retrieve as FASTA