Entry information : HaGOX09 (HanXRQChr13g0389801)
Entry ID 13768
Creation 2016-05-30 (Christophe Dunand)
Last sequence changes 2016-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGOX09 (HanXRQChr13g0389801)
Name (synonym) HaGOX09 (HanXRQChr13g0389801)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGOX09
start..stop
S start..stop
HaGOX08 744 0 1..369 1..369
BstrGOX03 708 0 1..369 1..369
ThasGOX11 694 0 1..369 1..367
HaGOX03 681 0 20..369 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19300804..19300940 137 N° 2 19301056..19301180 125 N° 3 19301308..19301354 47 N° 4 19302058..19302135 78
N° 5 19302208..19302399 192 N° 6 19302574..19302636 63 N° 7 19302709..19302778 70 N° 8 19302845..19303050 206
N° 9 19303747..19303938 192  
join(19300804..19300940,19301056..19301180,19301308..19301354,19302058..19302135 ,19302208..19302399,19302574..19302636,19302709..19302778,19302845..19303050,193 03747..19303938)


exon

Literature and cross-references HaGOX09 (HanXRQChr13g0389801)
DNA ref. HanXRQ genome:   HanXRQChr13 (19300804..19303938)
Protein sequence: HaGOX09 (HanXRQChr13g0389801)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369
PWM (Da):   %s   40383.1  
PI (pH):   %s   8.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEVTNVTEYQAIAKEKLPKMVYDYYASGAEDQWTLEENRNAFSRILFRPRILIDVSKIDMTTTILGFKISMPIMLAPTAMQKMAHPGEYATARAASSAGTITLSSWATSSVEEVASTGPGIRFFQLYVYKDRNVVAQLVRRAERAGFKAIALTVDTPRLGRREADIKNRFTLPPFLTLKNFEGLDLGKMDEANDSGLASYVAGQIDRTLSWKDVKWLQTITTMPILVKGVITAEDTRLAIQAGAAGIIVSNHGARQLDYVPATIMALEEVVKAAQGRVPVFLDGGVRRGTDVFKALALGASGIIGRPVVFSLAAEGEAGVRKVLQMLRDEFELTMALSGCTSLSEITRDHIVTEWDAPRARPGPRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTCACAAATGTCACCGAGTATCAGGCTATTGCCAAGGAGAAGTTGCCAAAGATGGTCTATGACTACTATGCATCTGGTGCTGAGGATCAGTGGACTCTTGAAGAGAACCGAAAC
GCGTTCTCAAGAATCTT
GTAAGCAGGGTTTATGTTTATGTTTATGTTTTTAGGATCCCAAGCTTTTCTTGGATTTGTAATAATATGTTCTTGCGCACGTATCCTAAGAGTGTTTGTTTTG
ATGACAAAACAGGTTTAGGCCGCGTATCCTTATTGATGTCAGCAAGATAGACATGACTACCACAATTTTGGGATTCAAGATCTCGATGCCTATAATGCTTGCACCAACAGCCATGCAGAA
GATGGCTCACCCTGAAG
GTGAATACACGTTATTACTTAGTTCAGTGTGGTTTATGTTGCTAAAAACAATGAATTGTGCTCGAAAAGTAGAGATTTATATGGATTTTGCTTCTCTGTTAAT
ACGGTTTCTTTATTCTCAATGAAGGTGAATATGCAACAGCAAGAGCTGCATCTTCTGCTGGAACTATTATGGTTTGTATTTTTGTAGCTTTCTTTATATGCACAACAATTAAGATTTTTT
TATTTATGATAGATAGGTGCGTACTAGACTAGGTTGATAATCAACTTTCGGGCTCAATCCGGGGCTAGGACGGACATTTAGGCTTAAACAATTATGTAGCCGTTATTTGGATTGGCCTAG
GGGATGGCAAACGAACCCGAACCTAACGGGTAAACCCGAAACATTCGGGACGGATTATTAGACAACTATTCGGGGATTGGACTAGTTTTATAAATTTTGGCTAGTATGGTATACGGTGAT
ACCCAACCCATTTACATGTTTAGCTGAACCATACCCATAAATTTGTTGTTATTTTTCTCTGTCCTTGGTTAATAAAGTAATAGTAAATCCACTAATTTTTAGCTTTTTGTATTTTTAAAT
TCTTTTGGTAATAAAATATGTAAAAACTAAAATACTAAGAAATGTATTTAGATATCCCAGCGGCTAATTTTTAACAAACTAACGGGTACACCCGAGTCCCAACAGATACTAGGTGGGTAT
GAGACACGGTTTTACAATCGGATATGGGACGCGGCACAAACCACCCTAGGTTGGCCCAACCAGACTATGGAATTAAGTAAAGGGAGGGCCGGGCCTAGGATGGTTTGTGCATCTCTACTT
ATGATTTACAAAGAGGAAGTATCATGATGTGCTAATAGTTTGTCCACTTTGTAGACTTTGTCATCATGGGCTACATCAAGTGTTGAGGAGGTTGCCTCTACAGGACCCGGAATCCGTTTC
TTCCAGCTTTAT
GTGAGCAAAACTAGTATCTCACATTCCATTTTGGTTTGTAATATGCAAGCTAATGTTCTGGATCAATATCAGGTGTACAAGGACAGGAACGTGGTTGCTCAGCTTGTG
AGAAGAGCTGAACGAGCTGGTTTCAAGGCTATTGCTCTTACTGTTGATACACCTAGGCTCGGCCGCCGAGAAGCTGACATCAAAAACAGGTTCACATTACCACCATTTTTGACATTGAAG
AACTTTGAGGGCTTGGACCTTGGCAAGATGGATGAA
GTAAGTCCAAACTCCAAACTAAGGACAGGAACGTGGTCTGCTTAACTTGAGCGAGCTCAGCTCATTCAATTACTAAAAGATGTT
GAGCAAGCTTTTATCAAGCAAGCTTCGAGATTCTTGAATTTTTATAGTATATGTTTAGTTCTTCTTCTAAAATGCAACTTTGCAACGCAGGCTAATGATTCTGGTTTAGCTTCTTATGTT
GCTGGTCAGATCGACCGCACTTTGAGCTGGAAG
GTATACTTTTTTTCAAACTGTAGTTTCTCATGGCTCATGTTAGTAACTTTTGTGGCTCGAGTGTTCTTGCAGGACGTGAAGTGGCTG
CAAACAATCACCACGATGCCAATCCTCGTGAAGGGTGTGATCACTGCTGAGGACA
GTAAGTGCGAGCGATCAAAACCCCCTTGGTTTGTTTTTTCGGTTAGCTGAATGTTTACTTATGCA
GCAAGGTTAGCTATTCAAGCTGGAGCAGCAGGTATTATTGTTTCCAACCACGGAGCCCGCCAGCTGGATTATGTTCCTGCCACCATCATGGCATTGGAAGAGGTTGTGAAAGCGGCACAA
GGCCGTGTTCCCGTGTTCTTAGATGGTGGTGTTCGCCGTGGAACTGATGTGTTCAAGGCGCTGGCTCTTGGAGCTTCTGGCATATTT
GTAAGTAAACTAATCAAGTATTTTCTTTTGTCA
AGCATTACTAGAAAACTGGGTATGTGTGACCATTAAAACTGCTGCAAACTAGAGTATTACTTTTAGTTTCGCTCATGTTTTTATTTTTAAATTTTTTACCAGTATTTAATTTTTAAATTT
TGATTAGTTTTATTATTTGTTTTTTGTGGCTGGAATTTAAATTCCAGTTTTAATTTTGCTTTTTAAATTGGTATTATATTTTAAGTTTTGATTATTTTTTTTAAATCTGTTTTTTTTTTT
TTCTCAACTTTTTGACAGTGTTACTACCGGTAATCAGTTTCTATTTTCAATTTAGTTTTTCCAACCGTTTGCAACTGAAATGAAAACTGGCAAAATAGGCGTTGATTTGTGACCGGTTTG
GATATGGTCGCTAATTTTGCGACAGTTTCTCGTTAGCTAGTTTTGCGGCCATCTTTTTCGTTAGCAAGTTTTGGTCGTGAAATAAACCATGAATCTTAAGGAAATGCAATTAAAACACCT
GTTTTCAAAAGTGATTATGTGATTTTAAACTTTCAAAATCAGATAATCCGTTATAATAAACCAACGAGATGTAGCATAGTGTTTGAATGTGTTTCTAAGTAGTAATAATCGATCAGTTCA
TATACACACACACTCCTAGTAAATCTTACAGATCTCACGTCTTTGGTATGGTGTAAATTTTAGATTGGGCGACCCGTAGTGTTTTCATTGGCTGCTGAAGGAGAAGCCGGAGTGAGAAAA
GTACTCCAGATGTTACGCGATGAATTCGAGCTAACCATGGCACTAAGTGGCTGTACCTCGCTCAGTGAGATTACTCGCGACCATATTGTGACTGAGTGGGATGCACCCCGGGCTCGTCCT
GGACCAAGGTTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTCACAAATGTCACCGAGTATCAGGCTATTGCCAAGGAGAAGTTGCCAAAGATGGTCTATGACTACTATGCATCTGGTGCTGAGGATCAGTGGACTCTTGAAGAGAACCGAAAC
GCGTTCTCAAGAATCTT
GTTTAGGCCGCGTATCCTTATTGATGTCAGCAAGATAGACATGACTACCACAATTTTGGGATTCAAGATCTCGATGCCTATAATGCTTGCACCAACAGCCATG
CAGAAGATGGCTCACCCTGAAG
GTGAATATGCAACAGCAAGAGCTGCATCTTCTGCTGGAACTATTATGACTTTGTCATCATGGGCTACATCAAGTGTTGAGGAGGTTGCCTCTACAGGA
CCCGGAATCCGTTTCTTCCAGCTTTAT
GTGTACAAGGACAGGAACGTGGTTGCTCAGCTTGTGAGAAGAGCTGAACGAGCTGGTTTCAAGGCTATTGCTCTTACTGTTGATACACCTAGG
CTCGGCCGCCGAGAAGCTGACATCAAAAACAGGTTCACATTACCACCATTTTTGACATTGAAGAACTTTGAGGGCTTGGACCTTGGCAAGATGGATGAA
GCTAATGATTCTGGTTTAGCT
TCTTATGTTGCTGGTCAGATCGACCGCACTTTGAGCTGGAAG
GACGTGAAGTGGCTGCAAACAATCACCACGATGCCAATCCTCGTGAAGGGTGTGATCACTGCTGAGGACACAAGGTTA
GCTATTCAAGCTGGAGCAGCAGGTATTATTGTTTCCAACCACGGAGCCCGCCAGCTGGATTATGTTCCTGCCACCATCATGGCATTGGAAGAGGTTGTGAAAGCGGCACAAGGCCGTGTT
CCCGTGTTCTTAGATGGTGGTGTTCGCCGTGGAACTGATGTGTTCAAGGCGCTGGCTCTTGGAGCTTCTGGCATATTT
ATTGGGCGACCCGTAGTGTTTTCATTGGCTGCTGAAGGAGAA
GCCGGAGTGAGAAAAGTACTCCAGATGTTACGCGATGAATTCGAGCTAACCATGGCACTAAGTGGCTGTACCTCGCTCAGTGAGATTACTCGCGACCATATTGTGACTGAGTGGGATGCA
CCCCGGGCTCGTCCTGGACCAAGGTTATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAACAGTTAC GTTGACTAAT AATGGAGGAG ATAAAGCTCT TCTACAACAG TTACGTTGAC TATTAATGGA GGAGATAAAG CTGTGATTTG GAAGGAGAAG ATTGTGGAGG AGATAAAGCC  GTATTAATTG GAGGAGATAT CTTTGATTTT TATTTTTATT TTATTTTATT TTTTTTTTTG GTACACACCC TCTTCTGTTC TATCACTTTA TCTACAAGGT GTCTTTGTCT TGCAACTCCA  AAAAAATTTT AAATTTTTTT TGCTTATCTA TACTTGTTGC TTGCTCTTTC CACCAAGTCC CAAAAGGTTT GCTCTCTTGC AGAAACTACG CGGGTAGTGA AGAGAAATGG AGGTCACAAA  TGTCACCGAG TATCAGGCTA TTGCCAAGGA GAAGTTGCCA AAGATGGTCT ATGACTACTA TGCATCTGGT GCTGAGGATC AGTGGACTCT TGAAGAGAAC CGAAACGCGT TCTCAAGAAT  CTTGTTTAGG CCGCGTATCC TTATTGATGT CAGCAAGATA GACATGACTA CCACAATTTT GGGATTCAAG ATCTCGATGC CTATAATGCT TGCACCAACA GCCATGCAGA AGATGGCTCA  CCCTGAAGGT GAATATGCAA CAGCAAGAGC TGCATCTTCT GCTGGAACTA TTATGACTTT GTCATCATGG GCTACATCAA GTGTTGAGGA GGTTGCCTCT ACAGGACCCG GAATCCGTTT  CTTCCAGCTT TATGTGTACA AGGACAGGAA CGTGGTTGCT CAGCTTGTGA GAAGAGCTGA ACGAGCTGGT TTCAAGGCTA TTGCTCTTAC TGTTGATACA CCTAGGCTCG GCCGCCGAGA  AGCTGACATC AAAAACAGGT TCACATTACC ACCATTTTTG ACATTGAAGA ACTTTGAGGG CTTGGACCTT GGCAAGATGG ATGAAGCTAA TGATTCTGGT TTAGCTTCTT ATGTTGCTGG  TCAGATCGAC CGCACTTTGA GCTGGAAGGA CGTGAAGTGG CTGCAAACAA TCACCACGAT GCCAATCCTC GTGAAGGGTG TGATCACTGC TGAGGACACA AGGTTAGCTA TTCAAGCTGG  AGCAGCAGGT ATTATTGTTT CCAACCACGG AGCCCGCCAG CTGGATTATG TTCCTGCCAC CATCATGGCA TTGGAAGAGG TTGTGAAAGC GGCACAAGGC CGTGTTCCCG TGTTCTTAGA  TGGTGGTGTT CGCCGTGGAA CTGATGTGTT CAAGGCGCTG GCTCTTGGAG CTTCTGGCAT ATTTATTGGG CGACCCGTAG TGTTTTCATT GGCTGCTGAA GGAGAAGCCG GAGTGAGAAA  AGTACTCCAG ATGTTACGCG ATGAATTCGA GCTAACCATG GCACTAAGTG GCTGTACCTC GCTCAGTGAG ATTACTCGCG ACCATATTGT GACTGAGTGG GATGCACCCC GGGCTCGTCC  TGGACCAAGG TTATAAACCA AAACATGATA TCGTTGCGAC CAACTCGACT TTTAATCGCA AAATATAACA TGTACCTTGT GTTATGGTTG CCAAACTTGT ATTGTTTCCT TGTATAATGT  TCGTTTCTGA ATGATAAGCT GTCTGAATGT ATAATTTTTA AATGTCCATT GCCTTGCATA CATGGTTTGT TGAATAGGTA GCGAAATGAT ATTTCTAAAT AATTTATACT AGTTTTGTTG  CCGGCCGCGC GTTGCGGCGG CATACTTGAC GTGATAAAGT ATATAGACTA AGATCATCCC AACTCGTTTT TGAACTAAAT TTACTTCTAT TATATCGTTG TGGATTCACG AAAAAACTTA  CGTAATAAAA GGAAAGACAA AAAAAAAGAT AAACAAAACC GACTTGTTTC CAAACTAAAT TTACGTAGAT TATACCGTTG CGAATTCACG AAAACAACAT ACGTAAAAAC TCGGTAAAAG 
AAACGCAAAA AAAATAAATA AA 

Retrieve as FASTA