Entry information : HaDiOx03 (HanXRQChr12g0385541)
Entry ID 13772
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaDiOx03 (HanXRQChr12g0385541)
Name (synonym) HaDiOx03 (HanXRQChr12g0385541)
Class Alpha-dioxygenase    [Orthogroup: DiOx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaDiOx03
start..stop
S start..stop
HaDiOx06 1003 0 1..640 1..642
HaDiOx04 1003 0 1..640 1..642
HaDiOx05 950 0 1..640 1..628
CclDiOx02 937 0 9..641 5..639
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 163499749..163499868 120 N° 2 163500141..163500407 267 N° 3 163501083..163501232 150 N° 4 163501363..163501496 134
N° 5 163502349..163502556 208 N° 6 163502641..163502786 146 N° 7 163504615..163504842 228 N° 8 163504987..163505189 203
N° 9 163505659..163506128 470  
join(163499749..163499868,163500141..163500407,163501083..163501232,163501363..1 63501496,163502349..163502556,163502641..163502786,163504615..163504842,16350498 7..163505189,163505659..163506128)


exon

Literature and cross-references HaDiOx03 (HanXRQChr12g0385541)
DNA ref. HanXRQ genome:   HanXRQChr12 (163499749..163506128)
Cluster/Prediction ref. HanXRQ:   HanXRQChr12g0385541
Protein sequence: HaDiOx03 (HanXRQChr12g0385541)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   641 (619)
PWM (Da):   %s   73628.98 (71060.6)  
PI (pH):   %s   9.13 (8.99) Peptide Signal:   %s   cut: 23 range:23-641
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIPFLSCAKSLLFWVIKHFVHADFREHFQRMKPLDRLLFLIIHGLDRSGMEWHRFPVFLGLAYLLARRHLHYHYTLLNVGKNQAGERFNPAEFPYRTANGKFNDPSNEDAGSIESFFGRNIAPLDCRKGLLKPNPMKVATKLLARKQFIDTGKQLNLIAVSWIQFMTHDWMDHLESTQQIELKASEKVANQCPLRSFKFYKTERVNTCLDNIKEGHLNIRTSWWDGSAIYGSNSSQLHEVRTYKEGKLKIAGLIQHDQEGLEKAGNIRNAWIGVSSLIALFILEHNAICDALKEYPNLDDENLYRHARLVTSAVMAKIHTIDWTVQLLKTDTLLAGMRGNWYGILGKRFKDTYGHVGGPFLGGLVGLKKPNNHGVPYSLTEEFVSVYRLHSLLPDHLLIRDIDSSPGPNKSPKLSHKIDMVNLIGNKGEKEFSKIGFTTRMVSMGHQACGALELWNYPVWLRDVVPQNVDATDRADHVDLASLIYRDRERSVPRYNAFRRSLFLIPISKWDNLTNNKEVIDTLREVYGDDVEQLDLLVGMLAEKKIKGFAICETAFVIFLIMASRRLEADRFFTSDFNEKVYTRKGFEWVNTCESLKDVLDRHYPGMTNRWMNSTSVFTVWDAPPDPHNRIPIYLRLPH

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTCCATTTCTGTCTTGTGCGAAATCTCTTCTTTTTTGGGTCATCAAACACTTCGTACATGCTGATTTCCGTGAACATTTTCAAAGGATGAAACCCCTGGACAGGCTTCTCTTCTTG
GTACGTATTTGCACACATGTGGCTTATATATAGTTCAACATATCCTTGTAGCGGTGTATAGCGGCAAACAAGAACTTTTTAATCAAGGGTCATCATAAGGTTTTCTTATCTATCAGTTAC
ATTTATTGGTCTGACTCATTTAAAAAAAAATCAATACCTTTATATTTAGGAATCCAATAAATTCTTGTGATCGGGTGGTCAACAGACCCTCTTGGCTCCTCTTGGTTCCGCGTGAACGAT
GCATCATCGATTTTGATAGTTACCTTGTGCAGATTATTCATGGTCTTGATAGGTCCGGGATGGAGTGGCACCGTTTCCCCGTGTTCTTAGGGTTGGCATACCTTCTTGCACGACGACATC
TACATTACCACTATACTTTGCTTAACGTTGGAAAAAATCAGGCGGGTGAAAGGTTTAATCCTGCTGAGTTTCCCTATAGGACAGCCAACGGAAAGTTTAATGATCCTTCCAACGAAGATG
CTGGCAGTATAGAAAGTTTTTTCGGACGAAACATAGCGCCACTTGATTGCAGAAAAGGG
GTATACAATTACAAAATCTTGTGAACTGGTATCATCTTTTAAGACCTAAACATTAAGGAAA
GAAACCTGTCTTATATCAAGTTTACACTTTAAGATCATATACCCAAAATCATAAAATAATTAAGAAAAAAAAGGACATTAGATGAGTTCAAGTACTAGGATGTGATCAAAGTAGTACTAA
ATAGAATATGTTAGTTGGGTTTATTATAATTATCTTTACCCTTAAGAGTTATGATTTTGGAATAAAAATCATTTGGATATTTCTTGAAGGAAATAATATGAGGGGAGAAATCAGCAAAGC
CATGATAATTAAAATTATAATTAATATATCCATATGTTTGGACACCATTTTTATAATGCAAACAAAACAAACCAAATTGTGCAAACTCCTCTAGAAACTCCATATTTCACTGCTAGAAAA
TTAGGAGGTTTGCTACATGATAATGGGTCGCAAACAGTCGACGCAAAATTCTTCGTAGCAAAAAGATTAGCAACAAACTTTCGGAAAATTTTTGACAAAAGTATCCGGTTGGAAGTTCCT
ACTCCATCACTTTTTTTTTCTACAATTCTTAACAAAGGAATCCATATTAGTTTATGTGTTTTGAAGAACTATCTAATGGAATAAATTAAATAAACGTCATATGAAAGTTTTAAAGTCTTG
GTTTTTTATTATAGCTATTGAAGCCAAACCCTATGAAGGTGGCAACAAAGCTTCTGGCACGCAAACAATTCATAGACACCGGAAAACAGTTAAACCTAATTGCTGTTTCATGGATACAAT
TCATGACTCATGACTGGATGGATCATCTTGAGTCAACACAACAG
GTTTCATTACTTTACTTTACATTGTGCATGCATAAAAATGAATAGATGTGGCATTTGTAGCCAAATTCTTTTATGC
ATATGCATGTCATCTCATGATCTTCACACACATGATCATTGATTTGCATCGCAGATTGAGCTGAAGGCGTCCGAAAAAGTGGCGAATCAGTGCCCTCTAAGATCTTTCAAGTTTTACAAG
ACTGAAAGAGTCAATACTTGCTTAGATAATATCAAGGAAGGCCATCTTAATATTAGAACATCGTGGTG
GTATGAACAACCAAAGTTTCATCATTTGTTGCCCAAAAACAAATGTTAATAA
CATATTGCAATGGACCGCTTTAATTTAAAGGAAAATTGGTTTAAACCAACCTTTGTCTCGTTGGTAAATAATAATCTTACCTACGTAATTGGTATACAATAATCCTACCTATCAACATGT
TGGTACTCAATGAATTTTCGTTAATTTTCTTAACTGAAGTTAGTTTTTAAGTTTTATTTATTACACAAACAGTCCCTGTAGTTGTAATTTACTAGTTTTAACTATTTTATAAAACAAAAA
AACCTCAAGAACAATTACTAGTTTTAAGTTTTCAACGTTTTTTTGTTTTCCAAAATAGTTAAAACTAGTAAATTACAACTACAGAGACTGTTTGTGTAATAAATAAAACTTAAAAACTAA
CTTAAGTTAAAAATAATTAACGAAAGTTCATTAAGAACTAACATGTTGATAGGTAAGATTATTGTATACCAATTACGTAGGTAAGATTATTATTACCAACGGGACAAAGGTTGGTTTATT
AAAAACCAATTTTCCTAATTTAAATAACACTACCACTTTTTAACATTAGTACTAGAAAATTGGGTAATTGTAACTGAAAATTCTGGTCGCAAAATTAGCTACTCAATTCTAAAAGAGTCA
AATCTAGCCCAAATCAATTAAAATAATTACTCAAAAATTAAGTTATAAAAATTAAAATTTAAAAAAAACAATAGTCACAAAGCAAAATTACCCACGGAGATTGTGATGGGCTTTTCAGTG
GTAAAATGTCAAGTGTGACACAAATTTGTTTTAATTACAGTATTTAATGTTATGGTATAAATTTGTTGAATATTTTGTAGGGACGGAAGCGCGATATACGGAAGTAACTCTTCGCAATTG
CATGAAGTGCGGACGTACAAAGAAGGTAAACTTAAGATCGCAGGCCTCATTCAGCATGACCAAGAAGGGTTAGAAAAAGCAGGTAACATTCGTAACGCTTGGATTGGTGTATCAAGCTTG
ATAGCCCTATTCATCCTTGAACACAATGCCATTTGTGACGCCTTAAAG
GTACATCTATATATACACACTCATTCATCTAATTAACTTAAACTTATCGGTGATTCTGAATTGCAAACTGCT
AGCTGTGATCAGAAAGAATATCCTAATCTGGATGACGAAAATCTATACCGTCATGCAAGACTAGTCACTTCCGCAGTCATGGCTAAGATTCACACTATCGACTGGACTGTCCAACTTCTT
AAAACTGACACCCTTCTTGCTGGAATGAGAGGTAATTG
GTAAGTAAGTAAATAAGTAAAATCACTTGGTTCACTAGCGACAAATCAATCAATTATGCGCATTTTTAATTTTAATTATAGA
TGATATGTACTCTTAGTGTTGTTGATAATAAACAACTAGTATTAAACCATCCACGCGTTGCGGCGGAGGCGTAAAACCATGCCAAGTTGCACCAATGCTACACTATTGTCGATGACCACC
AATATCAGAAAAACTCGCAAAAACAAAATAAATTAAAAAGAAAAAAATAACACCGAATGAAAGCAAAGTAAAATCTTTGAACCACATATGCCCGTTGGGGCGTGTTGATGTGAAGAAATT
AGATCGAAACATAAAACACAGAAAAAAAATAACTAAGATGGTCTAGGACCCGCGCCTTGCGACGAACTTGCAAACATGGAAAAATAGACGTGTTGCGACGGGCCTGTCAAACGGGAAAAA
ATTGACGAAAAAGCGTTGAACCCCATACATACGTTGCGGCGTATTAACTTGCAAAATATAGAACGAAACGTAAAACAAAAAACTTGCAAAAAGATAAAAGGTATGGGGCATCAAAGTGAA
AAATCATTTTTTTTTTTTTTTTTGAAAAACTCTTCATGCTAAGGGCATAACTCTATAAAAAACAAAAGTATTACTTATTTATTATTTACTATGGTTTCTTAAAACCATCATACAAACTTC
AATACACATAGTACAAATAACAATGCCGAGAATTGTTACAGCCAAAGTTACAACACACTTTACATAATCTTGTTGCTAAATTATAGTATATAATATATAATGACCACAAAGTACAACAAA
GACATGCACATAATACAATTAAAGCCAAAGTTACAACATACTTTGCATAATCTTATTGCAAAATTATAGTATATAATATAGGAGAAATGTACCAAAAATGTTAAAAACTCTATACCTTTA
AGTGTGAATAAGTTATTTATGTCTTCATATTTTTAAATGTGTAACTAAAGTATCTAATATGAGTATGAAAGCTTTTATAGTCTCCATTAGCTATATTATGTGGACACTTCTAGCTGTTAA
CGTTTTATTTAATTATTACATGATAGGATCTTGATAATTTAAACTATAACTTAGTGGTTGTTTATAATCTGTATCGTTGATTTACTAATAACACTCCTAACTTTTATTTCCGTTGTCAAT
GTCAATCTCACTCATGTAATCATTATAGATCATCATAGATTTACATTTGTTTTGCACTTGATTTCGCTCACAAGGAAAGTAATGAATAATCTATGATGAGTGTGCAAGTGTAGTGCTTTT
GGTAACGAAAGTGAAAGTTTGGAGAGTCGTGAATTGGTTAAATTGTCGCTATTATCATAATTATTAGCCAGTGAGTTTTTTTCTTTTTGAACGGAAAATTTGGATCACTGACGGACCACT
GCAGTATTATCATGCCACTACGGAACCACCTGATCATATCCATCTCCACAAAGCATAATGTCTATACACCAATTAAGGAGGAAACCCAATAAATATGGAACCCCCCCCCCCCCCACCTTG
TGGGAATTGAACGCAGGACCTATTGGTCCCAAAGCCTTATCCCACACACAGAATGCCACTAGACTATAAAGCTATAGCATTAGCCATTGAGTTATAATTAAGATTATTAAAATCCAGTTT
ACCATTAATTTTAAAAAAAATCAAGGTTATTATCAATATCACAAACTTATGCGCGCTATTTTAGAAAAAAAAAAAAAAAAAAACTATAACAATTTATTATTTTTATACATTTACATAAAA
TGCAAAGAAATTGTGCTGAGGTTTTATATGTTAATTTTTTGGAAAAATTTAAATGGATTAATTCAGGTATGGGATATTAGGCAAAAGATTCAAAGACACATATGGGCATGTTGGAGGCCC
CTTTTTGGGAGGTCTTGTGGGGTTAAAAAAACCGAATAATCATGGAGTACCCTACTCATTAACCGAAGAATTTGTGAGTGTTTATAGACTGCACTCTCTATTACCCGATCATCTTCTCAT
CAGAGATATTGATTCATCACCAGGTCCTAATAAGTCTCCAAAATTGAGCCACAA
GTAAGCTTTTTCACATCCTCCTAAATTCATCTTGAATATATATATATTTTTCTTTAATGACTTATA
AAATAAAATTTTGGAAATGACACTTTTCTCATTTACGAATTTAAACTCTTAGACTAATAGATTACCCTGAATCTACAGGATTGATATGGTAAATTTGATTGGGAATAAAGGGGAGAAGGA
ATTTTCCAAAATTGGATTTACGACACGAATGGTATCAATGGGACATCAAGCATGCGGGGCACTTGAGCTATGGAATTATCCGGTGTGGCTCAGGGACGTTGTGCCTCAAAACGTCGATGC
CACAGATCGAGCCGATCATGTCGATTTAGCTTCACTCGAGA
GTATGTGGCTTGCTTTCTTTCTTTCACTAAACTTAATTTGTATACTGTTAAATTAATAACCATAACTATGCAATGTTCA
AAAGGGGGTGGATCTATACACAATATATTATGAGAACACGTAGAAAAAAAAAATCATTCATTTTTCCAATCTTAATTTTTTTTTTTTAATATACGAAAATTGTTGAGATTCAAAGTTTGT
TCATTTCTCCCTCATGAAAGTAAAAAAAAATGAACAAATTTCGTGTATGTACAAAACAACATATGTGTAGCCGTGTAGGTAAATGGTTAAAAATACACACATATATATAAAGTTAGTGTA
ATGGTTTTCTTATATACATAACATACGCATTTTTATCTAAGAAGTTAAAATAAAAATAAAATGTATGAATCATTGATAAAAACAATAGTAATGACAATTTAGGTTTGTACACGTGATAAA
TCAATGTTTTGTAAACATGTGAAGATATAGTCTACAGGGATAGAGAAAGGAGTGTGCCAAGATACAATGCGTTCCGTAGATCACTTTTCTTGATCCCAATATCCAAGTGGGACAATCTAA
CGAACAATAAAGAAGTCATCGACACATTGCGCGAAGTGTATGGCGATGATGTTGAGCAACTCGATTTGTTGGTAGGAATGTTGGCCGAGAAAAAGATCAAAGGGTTTGCAATTTGCGAGA
CTGCATTTGTAATTTTCCTCATCATGGCGTCAAGGAGACTTGAAGCAGATAGATTTTTTACTAGTGATTTTAATGAAAAAGTGTATACGAGAAAAGGGTTTGAATGGGTAAACACATGCG
AGAGTTTAAAAGACGTGTTGGACCGACACTACCCGGGGATGACCAATCGGTGGATGAACTCCACAAGTGTTTTTACAGTGTGGGATGCTCCACCAGATCCTCATAATCGTATACCAATTT
ATCTTCGGCTCCCTCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTCCATTTCTGTCTTGTGCGAAATCTCTTCTTTTTTGGGTCATCAAACACTTCGTACATGCTGATTTCCGTGAACATTTTCAAAGGATGAAACCCCTGGACAGGCTTCTCTTCTTG
ATTATTCATGGTCTTGATAGGTCCGGGATGGAGTGGCACCGTTTCCCCGTGTTCTTAGGGTTGGCATACCTTCTTGCACGACGACATCTACATTACCACTATACTTTGCTTAACGTTGGA
AAAAATCAGGCGGGTGAAAGGTTTAATCCTGCTGAGTTTCCCTATAGGACAGCCAACGGAAAGTTTAATGATCCTTCCAACGAAGATGCTGGCAGTATAGAAAGTTTTTTCGGACGAAAC
ATAGCGCCACTTGATTGCAGAAAAGGG
CTATTGAAGCCAAACCCTATGAAGGTGGCAACAAAGCTTCTGGCACGCAAACAATTCATAGACACCGGAAAACAGTTAAACCTAATTGCTGTT
TCATGGATACAATTCATGACTCATGACTGGATGGATCATCTTGAGTCAACACAACAG
ATTGAGCTGAAGGCGTCCGAAAAAGTGGCGAATCAGTGCCCTCTAAGATCTTTCAAGTTTTAC
AAGACTGAAAGAGTCAATACTTGCTTAGATAATATCAAGGAAGGCCATCTTAATATTAGAACATCGTGGTG
GGACGGAAGCGCGATATACGGAAGTAACTCTTCGCAATTGCATGAAGTG
CGGACGTACAAAGAAGGTAAACTTAAGATCGCAGGCCTCATTCAGCATGACCAAGAAGGGTTAGAAAAAGCAGGTAACATTCGTAACGCTTGGATTGGTGTATCAAGCTTGATAGCCCTA
TTCATCCTTGAACACAATGCCATTTGTGACGCCTTAAAG
AAAGAATATCCTAATCTGGATGACGAAAATCTATACCGTCATGCAAGACTAGTCACTTCCGCAGTCATGGCTAAGATTCAC
ACTATCGACTGGACTGTCCAACTTCTTAAAACTGACACCCTTCTTGCTGGAATGAGAGGTAATTG
GTATGGGATATTAGGCAAAAGATTCAAAGACACATATGGGCATGTTGGAGGCCCC
TTTTTGGGAGGTCTTGTGGGGTTAAAAAAACCGAATAATCATGGAGTACCCTACTCATTAACCGAAGAATTTGTGAGTGTTTATAGACTGCACTCTCTATTACCCGATCATCTTCTCATC
AGAGATATTGATTCATCACCAGGTCCTAATAAGTCTCCAAAATTGAGCCACAA
GATTGATATGGTAAATTTGATTGGGAATAAAGGGGAGAAGGAATTTTCCAAAATTGGATTTACGACA
CGAATGGTATCAATGGGACATCAAGCATGCGGGGCACTTGAGCTATGGAATTATCCGGTGTGGCTCAGGGACGTTGTGCCTCAAAACGTCGATGCCACAGATCGAGCCGATCATGTCGAT
TTAGCTTCACTCGAGA
TCTACAGGGATAGAGAAAGGAGTGTGCCAAGATACAATGCGTTCCGTAGATCACTTTTCTTGATCCCAATATCCAAGTGGGACAATCTAACGAACAATAAAGAA
GTCATCGACACATTGCGCGAAGTGTATGGCGATGATGTTGAGCAACTCGATTTGTTGGTAGGAATGTTGGCCGAGAAAAAGATCAAAGGGTTTGCAATTTGCGAGACTGCATTTGTAATT
TTCCTCATCATGGCGTCAAGGAGACTTGAAGCAGATAGATTTTTTACTAGTGATTTTAATGAAAAAGTGTATACGAGAAAAGGGTTTGAATGGGTAAACACATGCGAGAGTTTAAAAGAC
GTGTTGGACCGACACTACCCGGGGATGACCAATCGGTGGATGAACTCCACAAGTGTTTTTACAGTGTGGGATGCTCCACCAGATCCTCATAATCGTATACCAATTTATCTTCGGCTCCCT
CATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTCCAT TTCTGTCTTG TGCGAAATCT CTTCTTTTTT GGGTCATCAA ACACTTCGTA CATGCTGATT TCCGTGAACA TTTTCAAAGG ATGAAACCCC TGGACAGGCT TCTCTTCTTG  ATTATTCATG GTCTTGATAG GTCCGGGATG GAGTGGCACC GTTTCCCCGT GTTCTTAGGG TTGGCATACC TTCTTGCACG ACGACATCTA CATTACCACT ATACTTTGCT TAACGTTGGA  AAAAATCAGG CGGGTGAAAG GTTTAATCCT GCTGAGTTTC CCTATAGGAC AGCCAACGGA AAGTTTAATG ATCCTTCCAA CGAAGATGCT GGCAGTATAG AAAGTTTTTT CGGACGAAAC  ATAGCGCCAC TTGATTGCAG AAAAGGGCTA TTGAAGCCAA ACCCTATGAA GGTGGCAACA AAGCTTCTGG CACGCAAACA ATTCATAGAC ACCGGAAAAC AGTTAAACCT AATTGCTGTT  TCATGGATAC AATTCATGAC TCATGACTGG ATGGATCATC TTGAGTCAAC ACAACAGATT GAGCTGAAGG CGTCCGAAAA AGTGGCGAAT CAGTGCCCTC TAAGATCTTT CAAGTTTTAC  AAGACTGAAA GAGTCAATAC TTGCTTAGAT AATATCAAGG AAGGCCATCT TAATATTAGA ACATCGTGGT GGGACGGAAG CGCGATATAC GGAAGTAACT CTTCGCAATT GCATGAAGTG  CGGACGTACA AAGAAGGTAA ACTTAAGATC GCAGGCCTCA TTCAGCATGA CCAAGAAGGG TTAGAAAAAG CAGGTAACAT TCGTAACGCT TGGATTGGTG TATCAAGCTT GATAGCCCTA  TTCATCCTTG AACACAATGC CATTTGTGAC GCCTTAAAGA AAGAATATCC TAATCTGGAT GACGAAAATC TATACCGTCA TGCAAGACTA GTCACTTCCG CAGTCATGGC TAAGATTCAC  ACTATCGACT GGACTGTCCA ACTTCTTAAA ACTGACACCC TTCTTGCTGG AATGAGAGGT AATTGGTATG GGATATTAGG CAAAAGATTC AAAGACACAT ATGGGCATGT TGGAGGCCCC  TTTTTGGGAG GTCTTGTGGG GTTAAAAAAA CCGAATAATC ATGGAGTACC CTACTCATTA ACCGAAGAAT TTGTGAGTGT TTATAGACTG CACTCTCTAT TACCCGATCA TCTTCTCATC  AGAGATATTG ATTCATCACC AGGTCCTAAT AAGTCTCCAA AATTGAGCCA CAAGATTGAT ATGGTAAATT TGATTGGGAA TAAAGGGGAG AAGGAATTTT CCAAAATTGG ATTTACGACA  CGAATGGTAT CAATGGGACA TCAAGCATGC GGGGCACTTG AGCTATGGAA TTATCCGGTG TGGCTCAGGG ACGTTGTGCC TCAAAACGTC GATGCCACAG ATCGAGCCGA TCATGTCGAT  TTAGCTTCAC TCGAGATCTA CAGGGATAGA GAAAGGAGTG TGCCAAGATA CAATGCGTTC CGTAGATCAC TTTTCTTGAT CCCAATATCC AAGTGGGACA ATCTAACGAA CAATAAAGAA  GTCATCGACA CATTGCGCGA AGTGTATGGC GATGATGTTG AGCAACTCGA TTTGTTGGTA GGAATGTTGG CCGAGAAAAA GATCAAAGGG TTTGCAATTT GCGAGACTGC ATTTGTAATT  TTCCTCATCA TGGCGTCAAG GAGACTTGAA GCAGATAGAT TTTTTACTAG TGATTTTAAT GAAAAAGTGT ATACGAGAAA AGGGTTTGAA TGGGTAAACA CATGCGAGAG TTTAAAAGAC  GTGTTGGACC GACACTACCC GGGGATGACC AATCGGTGGA TGAACTCCAC AAGTGTTTTT ACAGTGTGGG ATGCTCCACC AGATCCTCAT AATCGTATAC CAATTTATCT TCGGCTCCCT  CATTGAATTA TTTTGTTTTA TGTATATTTT TTAGAATGGC AACTTATGCA CCATCTATCT ACTCCTAATT TTACTTCACA ATATACATTA TGGGACTCGA ATTGCTTTAG GTACTTTCTT 
TTTTTAGTAC GTTGTTGATC TAGACTAGCT AGGAAGGTGT TCTATTAAAA AGGGGTGGCA ACATGATCAA CCGAGAACAC ATCCCCAATT TGTATGTAAC GGTTACTTTT ACT 

Retrieve as FASTA