Entry information : HaRboh01 (HanXRQChr02g0034441)
Entry ID 13777
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh01 (HanXRQChr02g0034441)
Name (synonym) HaRboh01 (HanXRQChr02g0034441)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh01
start..stop
S start..stop
HaRboh10 1704 0 3..917 16..928
HaRboh04 1563 0 14..917 25..930
HaRboh11 1538 0 10..917 8..913
CsiRboh01 1515 0 1..917 4..922
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16970165..16970762 598 N° 2 16969752..16969914 163 N° 3 16969606..16969654 49 N° 4 16968930..16969043 114
N° 5 16968409..16968831 423 N° 6 16967750..16968133 384 N° 7 16967529..16967624 96 N° 8 16967066..16967181 116
N° 9 16966635..16966737 103 N° 10 16966453..16966520 68 N° 11 16965124..16965653 530 N° 12 16964552..16964661 110
complement(join(16964552..16964661,16965124..16965653,16966453..16966520,1696663 5..16966737,16967066..16967181,16967529..16967624,16967750..16968133,16968409..1 6968831,16968930..16969043,16969606..16969654,16969752..16969914,16970165..16970 762))


exon

Literature and cross-references HaRboh01 (HanXRQChr02g0034441)
DNA ref. HanXRQ genome:   HanXRQChr02 (16970762..16964552)
Cluster/Prediction ref. HanXRQ:   HanXRQChr02g0034441
Protein sequence: HaRboh01 (HanXRQChr02g0034441)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   917
PWM (Da):   %s   103254.7 Transmb domain:   %s   o363-385i505-527o547-569i727-744o
PI (pH):   %s   9.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTENYNRHDHSHSDTEAAVGVDRNAFSGPLTVSGPLNKRTGRKSAQFYIPDGAPGSSSSSMRSNGNDDYVEITLDVRDDSVAVHSVKTAGGADVEDPELTLLAKGLEKRSSFGSSVVRNASARIRQVSEELKRLTSFSKRPVGRLDRTKSAAAHALRGLKFISKNDGGAAWAALEKRFDELTRDTGGLLPRSIFGECIGMNKDSKDFAGELFDALSRRRNITGDAINKAQLKEFWDQISDQSFDSRLQTFFDMVDKDADGRITEDEVRIISLSASANKLSNIQKQADEYAALIMEELDPDNRGYIMIEHLEMLLLQAPTQSVRGESRNLSQMLSQKLKTTHHGNPIRRWYEDLKYFLQDNWQRCWVIVLWIGIMAGLFTWKYIQYKNRAVYKVLGPCVCIAKGAAETLKLNMALILLPVCRNTITWLRNKTRLGVAVPFDDNLNFHKVIAMAITIGVGLHAISHLTCDFPRLIHATEEQYEPMQQFFGDQAHNYWHFVKEAEGYTGITMVVLMTIAFTLATPWLRRGKLNLPPFLKKLTGFNAFWYSHHLFVIVYVMLIVHGIKLYLTKEWYKKTTWMYLAVPITLYACERLIRAFRSSVKPVKILKVAVYPGNVLALHMSKPQGFKYKSGQYMFVNCAAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRQLKTVFSVCQPPRNGKSGLLRAENQEENPNFPKVLIDGPYGAPAQDYKKYDVVLLVGLGIGATPMISIVKDIVNNMKAKEEEENALEHGGTPKNKSAPTSANNFRTTRAYFYWVTREQGSFDWFKGVMNEVAEMDKNGVIEMHNYCTSVYEEGDARSALITMLQSINHAKNGVDVVSGTRVKSHFAKPNWRNVYKRIALNHSGSRGVFYCGAPAPTKELKQLALDFSHKTSTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACAGAAAACTACAACCGCCATGACCATTCCCACTCCGACACAGAAGCTGCTGTCGGAGTGGACAGGAACGCGTTCAGCGGGCCACTCACAGTAAGCGGCCCGCTGAACAAAAGA
ACTGGGCGTAAGAGCGCCCAGTTCTACATCCCAGACGGTGCTCCTGGGAGCAGTAGTAGCAGCATGCGATCCAATGGTAACGACGATTACGTCGAAATCACGTTGGATGTCCGTGACGAC
TCCGTGGCGGTTCATAGTGTCAAAACCGCGGGTGGAGCTGACGTGGAGGACCCGGAGTTGACGTTGTTGGCTAAAGGGTTGGAGAAGCGGTCGTCTTTCGGGTCGTCCGTGGTGAGAAAT
GCGTCCGCCAGGATTCGGCAAGTGTCCGAAGAGTTGAAGCGGTTGACGTCCTTTTCGAAACGACCGGTTGGTCGTTTAGACAGGACGAAATCCGCCGCCGCTCATGCGCTTAGAGGGTTA
AAGTTTATCAGTAAGAACGACGGCGGAGCTGCGTGGGCCGCCTTAGAGAAAAGGTTTGACGAACTCACCAGAGACACCGGTGGCTTACTTCCACGGTCAATTTTCGGTGAATGCATTG
GT
AAGCGATAAATCCGATACAAATAGAGGTTAACGTGCGAATGGTGCAAATAAATAGAGTAATTATTATCACGTTACATTTTTTAAATAGCGTAATAGTTATTACACTGCAAAAAATGAATT
AGAGTAGTTAAAACAAAATAGTTAATATTAAAATAACGTAATAAATAATATTTGTAAAATTAGCGTATTATTTGTATTTGATCCTAACACTAACTATAAATGTTTTTTTTTTTAATTTAA
TTTGGTAGGGATGAACAAAGATTCAAAAGATTTCGCCGGAGAATTATTCGATGCACTTTCCCGGCGACGGAATATCACCGGAGATGCAATCAACAAAGCACAGTTGAAGGAGTTTTGGGA
CCAAATTTCTGATCAAAGTTTTGATTCAAGGCTACAAACTTTCTTTGATAT
GTAAGGATTTATTAGTTTATTTATTTATTTATTAATTTTTTTTATTCATATTAATTCTGTTGTGGTGAA
TATAAATTCTGAAATATAATATATGTAGGGTTGATAAAGATGCTGATGGCAGGATCACAGAAGATGAAGTAAGAGAGGTACATACTAAGAGTTATACTGATGTTTATGGTTTGGTTTGGT
CGGTTTTGAAAAAAAATCTATATCACGTAGTTAACTACGGTTTTGGGAAATAGCAAACCAAACCGGACGGGTTGGTGGGTCGCCCGACGGCGGGTTTTATCAGTTTGACGGTTTAGTGGT
TTGGTATGGCGGTTTGAATTGGTTTTTTTAATTCTTTTTTAAAACATTAGTTTATATATCAAAATTGTTAAAATGATAAAGATAGTTCATGACTATTATTATTATTATATATACATAATT
AGATATTTCAAAAATGAAAAAAAAATAATAAATATAAATTTGCCGGTTTCAAGTTTCAAACCGGACCAAATCGTAAATACCAACGAACCAGCAGAACCGAACCGATAAGACTCAAACCCG
TTGGTTTGCTTTGTTTGAACAGCCCTACAGTTGTGCCTCGCTTAAATACGGTGTAACAAAGTATTACACGCTATAATGTAAAACGAATGTACTCGTGTATCCTAGCTCTATTTTACGAAT
GTTTCGGGATTTCCTAACACTTGCTAATGATTGATACAGATTATCAGCCTAAGTGCTTCAGCCAACAAGTTATCAAATATTCAGAAACAAGCGGACGAATACGCAGCATTGATCATGGAA
GAATTAGACCCTGACAACCGCGGCTACATCATG
GTACAATTACAAACCACACAACAATGTTATATGTATATATATTGTTTGGTTACAACAAATTTTTTAGTTATTATTTATTAATGATTT
AATTTAACCAGATTGAACACTTGGAGATGTTATTATTACAAGCACCAACACAAAGTGTGAGGGGAGAAAGCCGAAACTTGAGCCAAATGTTGAGTCAAAAGCTGAAGACGACGCACCATG
GGAACCCGATACGAAGATGGTATGAAGATTTGAAGTACTTTTTACAGGATAACTGGCAGAGATGTTGGGTGATTGTACTCTGGATAGGAATAATGGCGGGTTTGTTTACATGGAAGTACA
TTCAATACAAAAACCGAGCCGTGTATAAAGTATTGGGCCCGTGTGTGTGCATAGCTAAAGGAGCAGCCGAGACTTTAAAGTTAAACATGGCGCTTATTTTATTACCTGTTTGTCGAAACA
CGATTACTTGGTTGAGGAACAAGACTAGGTTGGGTGTGGCGGTTCCGTTTGATGACAACCTTAATTTCCATAAG
GCAAGTTTAGTGGTCACATATTTAAACAATGCCTTTCATACTAAAT
TTAATAAGTTTCGTAGAATGGTTGTAAAAGATATCATTCTTTCAAGAGGTGACATAGTGGTAAGCTGTAGTTTACCTGGTCCCACCGGTTAACACAGTATTGGTGGGGTCCACTGAGATA
TCCCTAATGGATTCTCACGGTTCCTGAAAAAAAAAAAAAAGATACTGGTTTTTAGTGGTTGGATAATCTAATTATATTTCTAATTATTTAAGGTGATATTTTTTTATAGGTGATTGCAAT
GGCAATTACGATTGGAGTAGGGTTACACGCGATTTCCCATTTAACATGTGACTTTCCTCGATTAATACACGCGACAGAAGAACAGTATGAACCGATGCAACAGTTTTTTGGGGATCAAGC
TCATAACTATTGGCATTTTGTGAAGGAAGCCGAAGGGTATACAGGAATAACAATGGTAGTACTTATGACTATAGCTTTTACTCTAGCAACTCCATGGTTAAGGCGAGGCAAGCTCAACCT
ACCGCCATTTTTGAAGAAGTTAACAGGATTTAACGCCTTTTGGTATTCGCACCACCTTTTTGTTATCGTCTATGTGATGCTTATAGTTCATGGGATCAAACTTTACCTCACCAAGGAATG
GTACAAGAAAACG
GTTAGTTAGTTAGTTAGTTCCTTTGTGTTCTCTCCTTTTATAAAACATTTTTAACAATTCGTCCAACTAATGTATTGAAAATTCGTATTCTTAATCCTTCAACTAAA
CCATGATTTCGGATGTAGACATGGATGTACTTGGCGGTTCCAATTACGCTTTATGCATGTGAGAGATTAATAAGGGCGTTTCGTTCGAGTGTCAAGCCCGTCAAGATACTTAAGGTATAA
TCTTACATTTATGGGCTGAAATTAGGACCTTTTTACTCATTTACTTACAAAATGGGTTGCTTTGAATGTACTTTTATTTCAAATCGGTCAAATAATCTTCAATCCTTATAACCTTTTTAG
TTCAATTTTAAATTTTAGATATATATTATTGGAGTAATACTATTCTTGATCATACTTAATGCACTATATTTTTATATATAAAAAATATTATTTAAAAGCCCGCAAAGAGTATTTTTGGGT
CAACTTGCCTGACTTGTGACAGCTTCCCATCTTTATTTAAGATTTTTCCTTAATCATTTATTTGCAAGATGATATATGTAATGATATTTGATGTGTTAAAGGTGGCTGTTTATCCTGGAA
ATGTATTGGCACTTCATATGTCAAAGCCTCAAGGCTTCAAATACAAGAGTGGACAATACATGTTTGTAAATTGTGCTGCTGTCTCTCCATTTGAATG
GTGAGTGAGTTGTATCTTAATTA
AATTATATTAACAATAAGAATAATAATAATAGCAATAATAATTATAGTAATAATTCTATAATGGGAATTAATTAAATGATTAACAATAATAAGAATAATAATAATAATAATAATAATAAA
AACAATAATAATTCTATAATGGGAAATCACCTCTGCAAGTTGCGTTTTACCTTATCCCATTGGTGGGGCCCTGTGAGTGGTCCGTTAATGGGTTCACACGGTTAAAAAAAAGAAATTATC
TAAATGAAAAATGGTATATCATGTAATGCTAATGCACTAACATAAAAATCAATATGTGTCAACAGGCACCCGTTTTCCATCACTTCTGCCCCCGGTGATGACTACTTGAGTGTGCATATC
AGGACTCTTGGTGATTGGACTAGGCAACTAAAAACCGTCTTTTCAGAG
GTACATAACGTGTTATTTACTCATGTTTATTTTTAAATTTGGTAATTTAGGGTGTTCAGTGACATATGTGTT
TAGTTATATCACCTAACTTTTTTTCTATTTTGTCTTTGGTAGGTATGTCAGCCACCGCGTAATGGAAAAAGTGGGCTCCTTAGAGCTGAAAACCAAGAAGAAAATCCCAAGTGAGTTTGA
ATGTTTTTAGATTTGCATATATATTAAAGGTGGTAAGAATTAAGATGGGCGGGTTTGGTAACATGTCAAAATGGGAATGGGTTGAAAGGGGTCGAATCACATTTTGTCTTTTTTACGTTA
ACTAGCATGTCAATAGTGATTAAAAATGCATTAGTATTACATTGATGATGTAAATCCTTAAAAGAAAATGATTTAGGAGGTTGTACGGGTTGGTCCATAAATAACGCGTCGAAAACGCCT
TTTTTGCACCCAAAGCATCAAGTATTTGTGGACATCATGCAAATAAGTGACATCTAACTGATAAAAAAAAAAGTTGACAACACATCAAATGTATGAGTTTTTGGACTTTTCACTGTGGTC
CAAACATGTGAAATGAAACCACATCCTTTTTTAAGTAAAAGATATTCTTTTTGTTAAATAATATCAAGAACATTAGGAAATGTTTCTCATGTATGATTTGATGGAACCTCACCTAATTGC
TTTGGATCATGATTAATCTCAAACGGGTCGAACTTATTGAAAGTTGTCCAATGTCTATTTTTAATGTATATAACGTCTTATACGGCTCTATTCAAAGCTTCAAATTATTATCGTAATAAT
ATTGTTTTATAAATTAATCCATCAATATTTACAAAAAAATGGGAAAAGGGTGTTTGTAGGTTAACCTGATATAATCTGCACGAAAAAAACATTTTGGCCCGTTTCCCAATCCACTCGATC
TGCTCATCTTTTCGCCTCTATTTTAAAACTTAGATGTGTATTTCTAAATAAATTAATATTTTTTTACAGTTTCCCTAAAGTTTTAATCGACGGGCCATATGGTGCACCAGCGCAAGACTA
CAAAAAATACGACGTGGTGTTGCTAGTCGGTTTAGGAATTGGAGCGACCCCAATGATTAGTATTGTGAAAGACATTGTGAATAACATGAAAGCCAAAGAAGAAGAAGAAAACGCATTAGA
ACATGGTGGTACACCAAAGAATAAATCGGCCCCAACGAGTGCAAATAACTTCAGAACAACCCGGGCTTATTTCTATTGGGTCACTCGGGAACAAGGTTCGTTTGATTGGTTTAAAGGTGT
TATGAATGAGGTTGCTGAAATGGACAAAAACGGTGTTATAGAGATGCATAATTATTGCACAAGTGTTTATGAGGAAGGTGACGCGAGATCTGCGTTAATTACTATGCTTCAGTCGATTAA
TCACGCTAAAAACGGTGTTGATGTTGTTTCGGGTACACGTGTTAAGTCTCATTTTGCTAAACCGAATTGGCGGAATGTTTACAAGCGAATTGCTCTTAATCACTCCGGTTCGAGAATAG
G
TTTGTCCTTCTAACTCATTCTCATTTTCTTTCTTCCTAACTTTAATTTAGATATTTTATGTAAAGGTAAAGTGACCTGAGTCGCGGGTCAGGTGGGTTGGGTAATGGGTTGAAACGGGTC
CAGTTGTATAATCGTTATAGTGTAATCAAGTCAGGGTGTTTAAACTAAAGGTGGCAACTTCGAACACGTCAAGAAAATGATTAGGTTATGGGTTGTCATATAACTCGTTTAATAAACGGG
CCTCAATTGGACCGACAAGTTTAACCTGTTTAATTAAACAAGCCGGCCCGACAACTTGGTTAATTAAACAAATAGACATGCCAACCCATTTACGACCCACCAACCCGTTTAATATATTTA
CAACTTGATTACAACCTGCCAGCCTATTTTAACCCGTTCAGATAAATCGATCGCGTTATGATTACACATTTCCCTAACTATTGTATGGTACAAATTTGCAGGGGTTTTCTATTGTGGGGC
ACCAGCACCAACAAAAGAACTGAAACAATTAGCTTTAGATTTCTCACACAAGACATCAACCAAGTTTGACTTCCACAAAGAAAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACAGAAAACTACAACCGCCATGACCATTCCCACTCCGACACAGAAGCTGCTGTCGGAGTGGACAGGAACGCGTTCAGCGGGCCACTCACAGTAAGCGGCCCGCTGAACAAAAGA
ACTGGGCGTAAGAGCGCCCAGTTCTACATCCCAGACGGTGCTCCTGGGAGCAGTAGTAGCAGCATGCGATCCAATGGTAACGACGATTACGTCGAAATCACGTTGGATGTCCGTGACGAC
TCCGTGGCGGTTCATAGTGTCAAAACCGCGGGTGGAGCTGACGTGGAGGACCCGGAGTTGACGTTGTTGGCTAAAGGGTTGGAGAAGCGGTCGTCTTTCGGGTCGTCCGTGGTGAGAAAT
GCGTCCGCCAGGATTCGGCAAGTGTCCGAAGAGTTGAAGCGGTTGACGTCCTTTTCGAAACGACCGGTTGGTCGTTTAGACAGGACGAAATCCGCCGCCGCTCATGCGCTTAGAGGGTTA
AAGTTTATCAGTAAGAACGACGGCGGAGCTGCGTGGGCCGCCTTAGAGAAAAGGTTTGACGAACTCACCAGAGACACCGGTGGCTTACTTCCACGGTCAATTTTCGGTGAATGCATTG
GG
ATGAACAAAGATTCAAAAGATTTCGCCGGAGAATTATTCGATGCACTTTCCCGGCGACGGAATATCACCGGAGATGCAATCAACAAAGCACAGTTGAAGGAGTTTTGGGACCAAATTTCT
GATCAAAGTTTTGATTCAAGGCTACAAACTTTCTTTGATAT
GGTTGATAAAGATGCTGATGGCAGGATCACAGAAGATGAAGTAAGAGAGATTATCAGCCTAAGTGCTTCAGCCAACAAG
TTATCAAATATTCAGAAACAAGCGGACGAATACGCAGCATTGATCATGGAAGAATTAGACCCTGACAACCGCGGCTACATCATG
ATTGAACACTTGGAGATGTTATTATTACAAGCACCA
ACACAAAGTGTGAGGGGAGAAAGCCGAAACTTGAGCCAAATGTTGAGTCAAAAGCTGAAGACGACGCACCATGGGAACCCGATACGAAGATGGTATGAAGATTTGAAGTACTTTTTACAG
GATAACTGGCAGAGATGTTGGGTGATTGTACTCTGGATAGGAATAATGGCGGGTTTGTTTACATGGAAGTACATTCAATACAAAAACCGAGCCGTGTATAAAGTATTGGGCCCGTGTGTG
TGCATAGCTAAAGGAGCAGCCGAGACTTTAAAGTTAAACATGGCGCTTATTTTATTACCTGTTTGTCGAAACACGATTACTTGGTTGAGGAACAAGACTAGGTTGGGTGTGGCGGTTCCG
TTTGATGACAACCTTAATTTCCATAAG
GTGATTGCAATGGCAATTACGATTGGAGTAGGGTTACACGCGATTTCCCATTTAACATGTGACTTTCCTCGATTAATACACGCGACAGAAGAA
CAGTATGAACCGATGCAACAGTTTTTTGGGGATCAAGCTCATAACTATTGGCATTTTGTGAAGGAAGCCGAAGGGTATACAGGAATAACAATGGTAGTACTTATGACTATAGCTTTTACT
CTAGCAACTCCATGGTTAAGGCGAGGCAAGCTCAACCTACCGCCATTTTTGAAGAAGTTAACAGGATTTAACGCCTTTTGGTATTCGCACCACCTTTTTGTTATCGTCTATGTGATGCTT
ATAGTTCATGGGATCAAACTTTACCTCACCAAGGAATGGTACAAGAAAACG
ACATGGATGTACTTGGCGGTTCCAATTACGCTTTATGCATGTGAGAGATTAATAAGGGCGTTTCGTTCG
AGTGTCAAGCCCGTCAAGATACTTAAG
GTGGCTGTTTATCCTGGAAATGTATTGGCACTTCATATGTCAAAGCCTCAAGGCTTCAAATACAAGAGTGGACAATACATGTTTGTAAATTGT
GCTGCTGTCTCTCCATTTGAATG
GCACCCGTTTTCCATCACTTCTGCCCCCGGTGATGACTACTTGAGTGTGCATATCAGGACTCTTGGTGATTGGACTAGGCAACTAAAAACCGTCTTT
TCAGAG
GTATGTCAGCCACCGCGTAATGGAAAAAGTGGGCTCCTTAGAGCTGAAAACCAAGAAGAAAATCCCAATTTCCCTAAAGTTTTAATCGACGGGCCATATGGTGCACCAGCGCAA
GACTACAAAAAATACGACGTGGTGTTGCTAGTCGGTTTAGGAATTGGAGCGACCCCAATGATTAGTATTGTGAAAGACATTGTGAATAACATGAAAGCCAAAGAAGAAGAAGAAAACGCA
TTAGAACATGGTGGTACACCAAAGAATAAATCGGCCCCAACGAGTGCAAATAACTTCAGAACAACCCGGGCTTATTTCTATTGGGTCACTCGGGAACAAGGTTCGTTTGATTGGTTTAAA
GGTGTTATGAATGAGGTTGCTGAAATGGACAAAAACGGTGTTATAGAGATGCATAATTATTGCACAAGTGTTTATGAGGAAGGTGACGCGAGATCTGCGTTAATTACTATGCTTCAGTCG
ATTAATCACGCTAAAAACGGTGTTGATGTTGTTTCGGGTACACGTGTTAAGTCTCATTTTGCTAAACCGAATTGGCGGAATGTTTACAAGCGAATTGCTCTTAATCACTCCGGTTCGAGA
ATAG
GGGTTTTCTATTGTGGGGCACCAGCACCAACAAAAGAACTGAAACAATTAGCTTTAGATTTCTCACACAAGACATCAACCAAGTTTGACTTCCACAAAGAAAATTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTATTGAC TTATTTTTAT TCCGCCACAG ACACGGTTTC ACCATATAAG TGGAATCCTT CTCATTCTTC CCCACATTTC TTCATTCCAA ATTCAACTCA CTTTGCATTC CATTCCATTC  CAATGGGTAC AGAAAACTAC AACCGCCATG ACCATTCCCA CTCCGACACA GAAGCTGCTG TCGGAGTGGA CAGGAACGCG TTCAGCGGGC CACTCACAGT AAGCGGCCCG CTGAACAAAA  GAACTGGGCG TAAGAGCGCC CAGTTCTACA TCCCAGACGG TGCTCCTGGG AGCAGTAGTA GCAGCATGCG ATCCAATGGT AACGACGATT ACGTCGAAAT CACGTTGGAT GTCCGTGACG  ACTCCGTGGC GGTTCATAGT GTCAAAACCG CGGGTGGAGC TGACGTGGAG GACCCGGAGT TGACGTTGTT GGCTAAAGGG TTGGAGAAGC GGTCGTCTTT CGGGTCGTCC GTGGTGAGAA  ATGCGTCCGC CAGGATTCGG CAAGTGTCCG AAGAGTTGAA GCGGTTGACG TCCTTTTCGA AACGACCGGT TGGTCGTTTA GACAGGACGA AATCCGCCGC CGCTCATGCG CTTAGAGGGT  TAAAGTTTAT CAGTAAGAAC GACGGCGGAG CTGCGTGGGC CGCCTTAGAG AAAAGGTTTG ACGAACTCAC CAGAGACACC GGTGGCTTAC TTCCACGGTC AATTTTCGGT GAATGCATTG  GGATGAACAA AGATTCAAAA GATTTCGCCG GAGAATTATT CGATGCACTT TCCCGGCGAC GGAATATCAC CGGAGATGCA ATCAACAAAG CACAGTTGAA GGAGTTTTGG GACCAAATTT  CTGATCAAAG TTTTGATTCA AGGCTACAAA CTTTCTTTGA TATGGTTGAT AAAGATGCTG ATGGCAGGAT CACAGAAGAT GAAGTAAGAG AGATTATCAG CCTAAGTGCT TCAGCCAACA  AGTTATCAAA TATTCAGAAA CAAGCGGACG AATACGCAGC ATTGATCATG GAAGAATTAG ACCCTGACAA CCGCGGCTAC ATCATGATTG AACACTTGGA GATGTTATTA TTACAAGCAC  CAACACAAAG TGTGAGGGGA GAAAGCCGAA ACTTGAGCCA AATGTTGAGT CAAAAGCTGA AGACGACGCA CCATGGGAAC CCGATACGAA GATGGTATGA AGATTTGAAG TACTTTTTAC  AGGATAACTG GCAGAGATGT TGGGTGATTG TACTCTGGAT AGGAATAATG GCGGGTTTGT TTACATGGAA GTACATTCAA TACAAAAACC GAGCCGTGTA TAAAGTATTG GGCCCGTGTG  TGTGCATAGC TAAAGGAGCA GCCGAGACTT TAAAGTTAAA CATGGCGCTT ATTTTATTAC CTGTTTGTCG AAACACGATT ACTTGGTTGA GGAACAAGAC TAGGTTGGGT GTGGCGGTTC  CGTTTGATGA CAACCTTAAT TTCCATAAGG TGATTGCAAT GGCAATTACG ATTGGAGTAG GGTTACACGC GATTTCCCAT TTAACATGTG ACTTTCCTCG ATTAATACAC GCGACAGAAG  AACAGTATGA ACCGATGCAA CAGTTTTTTG GGGATCAAGC TCATAACTAT TGGCATTTTG TGAAGGAAGC CGAAGGGTAT ACAGGAATAA CAATGGTAGT ACTTATGACT ATAGCTTTTA  CTCTAGCAAC TCCATGGTTA AGGCGAGGCA AGCTCAACCT ACCGCCATTT TTGAAGAAGT TAACAGGATT TAACGCCTTT TGGTATTCGC ACCACCTTTT TGTTATCGTC TATGTGATGC  TTATAGTTCA TGGGATCAAA CTTTACCTCA CCAAGGAATG GTACAAGAAA ACGACATGGA TGTACTTGGC GGTTCCAATT ACGCTTTATG CATGTGAGAG ATTAATAAGG GCGTTTCGTT  CGAGTGTCAA GCCCGTCAAG ATACTTAAGG TGGCTGTTTA TCCTGGAAAT GTATTGGCAC TTCATATGTC AAAGCCTCAA GGCTTCAAAT ACAAGAGTGG ACAATACATG TTTGTAAATT  GTGCTGCTGT CTCTCCATTT GAATGGCACC CGTTTTCCAT CACTTCTGCC CCCGGTGATG ACTACTTGAG TGTGCATATC AGGACTCTTG GTGATTGGAC TAGGCAACTA AAAACCGTCT  TTTCAGAGGT ATGTCAGCCA CCGCGTAATG GAAAAAGTGG GCTCCTTAGA GCTGAAAACC AAGAAGAAAA TCCCAATTTC CCTAAAGTTT TAATCGACGG GCCATATGGT GCACCAGCGC  AAGACTACAA AAAATACGAC GTGGTGTTGC TAGTCGGTTT AGGAATTGGA GCGACCCCAA TGATTAGTAT TGTGAAAGAC ATTGTGAATA ACATGAAAGC CAAAGAAGAA GAAGAAAACG  CATTAGAACA TGGTGGTACA CCAAAGAATA AATCGGCCCC AACGAGTGCA AATAACTTCA GAACAACCCG GGCTTATTTC TATTGGGTCA CTCGGGAACA AGGTTCGTTT GATTGGTTTA  AAGGTGTTAT GAATGAGGTT GCTGAAATGG ACAAAAACGG TGTTATAGAG ATGCATAATT ATTGCACAAG TGTTTATGAG GAAGGTGACG CGAGATCTGC GTTAATTACT ATGCTTCAGT  CGATTAATCA CGCTAAAAAC GGTGTTGATG TTGTTTCGGG TACACGTGTT AAGTCTCATT TTGCTAAACC GAATTGGCGG AATGTTTACA AGCGAATTGC TCTTAATCAC TCCGGTTCGA  GAATAGGGGT TTTCTATTGT GGGGCACCAG CACCAACAAA AGAACTGAAA CAATTAGCTT TAGATTTCTC ACACAAGACA TCAACCAAGT TTGACTTCCA CAAAGAAAAT TTCTAAGAGG  TTTTCAAAGC CCTCAAGAAA TCATAAAAAG TCAAACTTTC TAGAATCACA CACCCACCAC ACCCACACCC ACCCCACCCC ACCCTCTCTC ATGTGTACAG AGATATGAAG ATCAAGGCTA  CAATAATGTT TTTTTTTTTT AATTTTATTT TTGTGTTACA TTTTTTATTT TTTAATATAG TAATGAGAAT TGTGTAGAGA TAGTGCAAGG ATAGTGACAT CCATAATTGT TGTGGCTGCC  AGCAAGGTAG TGGGATATAA TATTATTTAA TTATGTTCAA GAAAAAGAAA CCATCATCAA GATCAAGATA GATGTTAATG GATGTTGTCA TCCTTTCATC ATGTTGGTTG GGTTGTAAAA 
TTAAGCTAAT TTTGTTTTTT TAATTTAAGT TTATGTTGTT GAATAGTGTT CATGGTGTTT TGGGCTAGGG TAACT 

Retrieve as FASTA