Entry information : HaRboh02 (HanXRQChr04g0125801)
Entry ID 13778
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh02 (HanXRQChr04g0125801)
Name (synonym) HaRboh02 (HanXRQChr04g0125801)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh02
start..stop
S start..stop
HaRboh07 1620 0 2..922 1..914
VvRboh07 1391 0 2..922 1..917
PtRboh09 1357 0 9..922 5..926
EgrRboh01 1329 0 17..922 5..925
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 172845519..172846104 586 N° 2 172846190..172846349 160 N° 3 172847483..172847531 49 N° 4 172847656..172847769 114
N° 5 172847840..172848262 423 N° 6 172848369..172848752 384 N° 7 172848856..172848951 96 N° 8 172849043..172849158 116
N° 9 172849246..172849416 171 N° 10 172849493..172849844 352 N° 11 172849925..172850053 129 N° 12 172850140..172850218 79
N° 13 172850299..172850408 110  
join(172845519..172846104,172846190..172846349,172847483..172847531,172847656..1 72847769,172847840..172848262,172848369..172848752,172848856..172848951,17284904 3..172849158,172849246..172849416,172849493..172849844,172849925..172850053,1728 50140..172850218,172850299..172850408)


exon

Literature and cross-references HaRboh02 (HanXRQChr04g0125801)
DNA ref. HanXRQ genome:   HanXRQChr04 (172845519..172850408)
Cluster/Prediction ref. HanXRQ:   HanXRQChr04g0125801
Protein sequence: HaRboh02 (HanXRQChr04g0125801)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   922
PWM (Da):   %s   103954.15 Transmb domain:   %s   o359-378i494-516o543-565i722-739o
PI (pH):   %s   9.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMQSESPVSSRGGSDGRSTFSRMLDHPADHSNDSYGVGGAMLPIFLNDLRRNNNDQDLVEVTLELEDDSVILCSVTPTANHSNHHHHQHVPSQSSPAGAASRLRRKFSWLTSSSSRASSSDASVDRVITSRDARKLKAKLIRTKSSAQRALGGLRFISKTTNTDVNELWKNVEARFACLAKDDGLLAREDFAECIGMADSKEFALGVFDALARRRQQKLGKITKAELHDFWLQISDQSFDARLQIFFDMADSNEDGRITRDEIQLLVLSAAANRLSKLKEQAEEYASLIMEELDPENLGYIELWQLETLLLQREAYMNYSRPLSIASGGWSQNLNSLKPKSVVHRLTHFVKSGLVENWQRSWILLLWFLTMACLFTWKFKQYRNKAAFHVMGYCLTTAKGAAETLKLNMALILLPVCRNMLTFLRSTRARLFIPFDDNINFHKVIAFAIAVGIGLHAGNHMICDFPRLVNSSPEKFALIASDFHNKKPTYKELIVGVEGMTGISMLILMAFAFTLASRYFRKNVLKLPSPFNRLTGFNAFWFSHHLFGLVYILLLVHGSFLFLVHNWTQKTTWMYISVPILIYAAERSLRTGRSEHYSPKIMKVSILPGDVFSIIMSKPSGFRYRSGQYIFLQCPSISPFEWHPFSLTSSPGDDYLSVHIRTVGDWTQELKQVLTNDTGSSCTIGRAKFRKLGEVDSKGLPKLLLDGPYGAPAQDYRNYDVLLLVGLGIGATPFISILRDLLNNNRAVEDQTDSNTETSMSGDSLTSIASSSIASSNEKKKPRRTKSANFYWVTREPGSFEWFKGVMNEVAEIDHGQIEMHNYLTSVYEEGDARSTLITMVQALTHAKHGVDILSGTRVRTHFARPNWREVFGKVASKHPNTTIGVFYCGMPVLAKELRKLSYEMSQKTSTRFEFHKEYF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCAATCTGAGTCTCCCGTCAGTAGCCGCGGTGGCTCTGACGGAAGATCCACTTTCAGCCGGATGCTAGACCATCCGGCTGATCATTCCAATGACAGTTACGGAGTTGGAGGAGCA
ATGCTCCCTATATTCCTCAACGATCTACGTCGAAACAACAATGATCAAGATTTAGTAGAAGTCACGTTAGAACTCGAAGATGATTCGGTCATTTTATGCAGTGTGACCCCGACCGCTAAC
CATTCAAACCATCATCATCATCAACATGTTCCTTCACAGTCGTCTCCAGCTGGGGCGGCCTCCAGGCTTCGTAGGAAGTTTTCGTGGCTGACGTCTTCTTCATCGCGAGCTTCTTCTTCG
GATGCAAGTGTGGACCGGGTGATCACGTCTAGAGATGCTAGAAAATTGAAAGCTAAACTGATTCGCACGAAATCTAGCGCGCAAAGAGCGCTAGGTGGTCTTCGGTTTATAAGTAAAACT
ACAAACACCGATGTTAACGAGTTGTGGAAAAACGTTGAGGCACGGTTTGCGTGTCTGGCTAAAGATGATGGATTATTAGCTCGAGAAGATTTCGCTGAATGCATAG
GTGACGGTTAAGTT
TGATGATATGTTGTTACAATAAAACAAATTGGTCCAGTGTTTGTTAACTTATTGGTGTGTGTTTTTTGTAGGAATGGCGGATTCGAAGGAGTTTGCGTTGGGCGTATTCGATGCGTTGGC
GCGAAGAAGACAGCAGAAATTGGGGAAGATCACGAAAGCGGAGCTTCACGATTTTTGGTTACAGATTTCCGACCAGAGTTTTGACGCTCGTCTGCAGATATTCTTCGACAT
GTATGTCTC
TCAAACTCTCTTTCTGTTATTAATCTTAAATCCCAAAACCCTAAAGACGCAAAAGTTCTGGTTCGCTAGAAAAATGGAGAAAGTCGAAGTCGAACATTTAATATTCGGATGGTAAGTGGT
GGAGAGTACTACGACGACATAGTGTATTTATCTTAGAAAATCTTACTCTTAAAAAAAAAAAGTTGAACATTCAATGGTTCTTTGAGCTAGTGAAATGACTAGGCAGCCCTCAAGTTTCTT
CAACCAAAAATTTAGAGTTGAGTTTTTGGTTGAAGGGGTAGTTTGGTCATTTGGCATGCTATGTACCCGAACCGGAATGCAAGGGTGCAGAATTTTAAAGATACAATAATAAAGTCGACC
GCATATGATTATTTTTTGTTGGGTTCAGAAAAGTGATGTTATATTCTATCTTTCTTCATATTGAAGAATAAAAAAGTGTGACAGTTTTCATTTCGAATTGTTTTTGGCCTTTTGGCAACC
AACTAAAATTATTTTATTGATTTAAACTTTGCATTTCTTTTGAGATAACGACTTGCTAACTAATAGAAAACTGCATACACCATATTCTTGAGCTACACTACTGACCAATTTGTAATTTTT
GTTTAATGCTAAGCAAGATTTCATGATATCAATTTACACGGAAGCACAAATAATTATAGGAAAACTTTTTGAGAAAAAAAAAATATATTGATATGGAATGCTACATCAACACAATCTAAA
TGGCAGGTGGAGTCAAATTTTCGAAAACTAAAATTGATTACCTAGAAATTAATTTGAATGTCTAAACAAACATGTAAATTAGTCAAATGATAGATTCACGCGTTTTTACAATCAAAAGAA
AATAAATTAAAAATGCTAAAGTTGGAAAAAAACTTCAAAATAAGGGGATTCCGATGATGAAACGTAGGCCAGAAAGTTCTATGGCGTTTGTCACATGATCCGGCATGTTGAGATGTTTCT
CTCCGTTATTTATGGGCAATGTAATTCTAAACGTGACGAAAGTTGTACTCTATTTAAATTAGACCAATTTTAGCCCATTTGCCACGTTCCAATTGATAAGTACGAGTTTGCTAGCTCTGG
GTCTCCTTAACAATCCATTCCTTTTTTCTTTCTTATGAACTTAGGGCCGACAGCAACGAAGATGGAAGAATCACAAGGGATGAGATACAAGAGGTATACATATCCGTAATTCGTACACAA
ATATTTTATCTTTTTTTATATATAATTTGATTTATAGGTTGATGGATTAGATCTTAATTAAATCATTTCTCTTACTAAATAACATTTATATATGCAGCTGCTAGTGCTTAGTGCTGCAGC
AAACAGATTGTCAAAGTTGAAAGAACAAGCAGAGGAATACGCTTCTTTGATTATGGAAGAATTAGACCCCGAAAATCTTGGCTATATTGAG
GTACAATAGCTTAAAAACTCACTCTTACA
ACAAGTTTATCAAGAAATAGTACGCAACGGTTTCTTTTCAGTTATGGCAGTTGGAAACGCTTCTACTACAAAGGGAAGCTTACATGAACTACAGTAGACCTCTGAGCATAGCAAGCGGCG
GGTGGAGTCAAAATTTGAATTCACTGAAACCTAAAAGCGTTGTTCATAGGCTAACTCATTTTGTAAAGTCGGGTTTGGTGGAAAACTGGCAAAGAAGTTGGATTTTACTGCTATGGTTTT
TAACCATGGCTTGTTTATTTACATGGAAATTTAAGCAGTATAGGAACAAGGCTGCTTTTCATGTCATGGGCTATTGTTTGACCACTGCTAAAGGGGCTGCTGAAACCCTCAAACTCAATA
TGGCTCTTATTCTTTTACCCGTTTGTAGAAACATGTTAACGTTCCTAAGGTCTACCCGAGCGCGATTGTTCATCCCTTTTGATGACAATATCAACTTTCACAAG
GTAATCGCTAATCAAG
TAATCAGTAACTACCCTTTGAATATGATCTTATGATGTCGTATATACTATATACATGCCTTGAACTTGATAAGATCCATTTGGATTGCAGGTAATTGCTTTTGCAATAGCTGTTGGCATC
GGTTTGCACGCTGGAAATCATATGATTTGCGATTTTCCTCGGTTGGTAAACTCTTCACCAGAAAAGTTTGCTCTTATAGCATCAGATTTCCATAACAAGAAGCCGACATACAAGGAACTA
ATTGTCGGTGTGGAAGGCATGACTGGAATTTCAATGCTGATATTAATGGCCTTTGCGTTCACCTTAGCTTCGCGATATTTCAGAAAAAATGTTTTGAAGCTGCCATCACCTTTCAACCGG
TTAACTGGATTCAATGCATTCTGGTTTTCACATCATCTTTTTGGTTTGGTGTACATACTGCTTTTGGTTCATGGATCATTCTTGTTTTTGGTTCATAACTGGACTCAAAAAACC
GTAAGA
TGTTTGCTTTCTTGATTTTGGAAAACAATTAGTCAATTACGATAAATATATTATATTCATTTTTTTTTCACCAAGAATATACGTTTTAATTTCCCAGACGTGGATGTACATCTCGGTTCC
AATTTTAATATACGCAGCTGAGAGAAGTCTACGAACAGGACGTTCAGAACACTACTCCCCTAAAATCATGAAG
GTGAAAACATACTATAAATCAAGTAGACACTTTATCTATTATATTAT
TTACACAAAGTCTACTAATAATAACATGTTATTTTTCCCGTCAGGTTTCCATCCTACCAGGAGATGTATTCAGCATAATTATGTCAAAACCGAGTGGATTTAGATACCGGAGTGGACAGT
ACATATTTCTGCAATGCCCTTCAATCTCTCCATTTGAATG
GTAGGTATTACATAATGTGTACACTTTATCCATCGGTTTATAGCGCACCATGCTGTTTTTTAATAAACCTTTTCGATAAT
CTTTCAGGCATCCGTTTTCATTGACTTCATCACCAGGAGACGATTACTTGAGCGTTCACATCCGGACAGTTGGAGACTGGACCCAAGAGTTGAAGCAAGTATTAACCAATGATACTGGTT
CTTCATGTACGATTGGTCGAGCCAAATTTAGGAAGCTAGGGGAAGTGGATTCAAAAGG
GTAACTTTATCTGGCATTAAGAAACTATATGGATGATGAAAACTGAAAAAGTAAAGTGAAAA
ATTAAACAATGCAGTTTACCAAAGCTACTGTTGGACGGACCTTACGGTGCACCAGCGCAAGATTACAGGAACTATGACGTGTTACTTCTTGTTGGGCTAGGAATTGGAGCTACTCCTTTT
ATAAGTATTCTTAGAGATTTACTAAACAATAATCGGGCAGTAGAAGACCAAACAGATTCAAACACAGAAACGAGTATGTCAGGGGATAGTCTTACGAGTATAGCATCTTCAAGTATCGCA
TCGTCAAATGAAAAGAAGAAACCAAGAAGGACTAAAAGTGCAAATTTCTATTGGGTCACTAGGGAGCCCGGCTCGTTTGAATGGTTTAAAGGAGTCATGAATGAAGTTGCGGAAATTGAT
CACAAA
GTAATTAATAAACATGTTTTAATCTTGATACATGTCATTACAATATATTAATTGACTGGACTACGATTAATTTGAAACAGGGTCAAATCGAGATGCACAATTATCTTACAAGTG
TTTATGAGGAAGGTGATGCAAGATCAACTTTGATCACTATGGTTCAAGCACTTACTCATGCCAAACATGGAGTTGACATCCTATCTGGCACTAGA
GTATGATAATCCTAAATATCTTATT
CAATACTACATTAATCTAAACGCTAGAATTAATCTAATAAGAAGCGTAAGTATTGTTGCAGGTAAGGACACATTTTGCTAGGCCGAATTGGAGAGAGGTGTTTGGGAAGGTAGCATCGAA
ACATCCGAATACAACCATAG
GTAAACAAATCTCTAAAACCACGATTTAGTCTATCAATTCGAATTGTGAGTCGAAGCTTATAAATTTGTTGATTATGTAGGAGTGTTCTATTGTGGGATG
CCAGTGTTGGCTAAGGAGCTAAGGAAACTATCATATGAGATGAGCCAGAAGACATCGACACGATTTGAGTTCCACAAGGAGTACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCAATCTGAGTCTCCCGTCAGTAGCCGCGGTGGCTCTGACGGAAGATCCACTTTCAGCCGGATGCTAGACCATCCGGCTGATCATTCCAATGACAGTTACGGAGTTGGAGGAGCA
ATGCTCCCTATATTCCTCAACGATCTACGTCGAAACAACAATGATCAAGATTTAGTAGAAGTCACGTTAGAACTCGAAGATGATTCGGTCATTTTATGCAGTGTGACCCCGACCGCTAAC
CATTCAAACCATCATCATCATCAACATGTTCCTTCACAGTCGTCTCCAGCTGGGGCGGCCTCCAGGCTTCGTAGGAAGTTTTCGTGGCTGACGTCTTCTTCATCGCGAGCTTCTTCTTCG
GATGCAAGTGTGGACCGGGTGATCACGTCTAGAGATGCTAGAAAATTGAAAGCTAAACTGATTCGCACGAAATCTAGCGCGCAAAGAGCGCTAGGTGGTCTTCGGTTTATAAGTAAAACT
ACAAACACCGATGTTAACGAGTTGTGGAAAAACGTTGAGGCACGGTTTGCGTGTCTGGCTAAAGATGATGGATTATTAGCTCGAGAAGATTTCGCTGAATGCATAG
GAATGGCGGATTCG
AAGGAGTTTGCGTTGGGCGTATTCGATGCGTTGGCGCGAAGAAGACAGCAGAAATTGGGGAAGATCACGAAAGCGGAGCTTCACGATTTTTGGTTACAGATTTCCGACCAGAGTTTTGAC
GCTCGTCTGCAGATATTCTTCGACAT
GGCCGACAGCAACGAAGATGGAAGAATCACAAGGGATGAGATACAAGAGCTGCTAGTGCTTAGTGCTGCAGCAAACAGATTGTCAAAGTTGAAA
GAACAAGCAGAGGAATACGCTTCTTTGATTATGGAAGAATTAGACCCCGAAAATCTTGGCTATATTGAG
TTATGGCAGTTGGAAACGCTTCTACTACAAAGGGAAGCTTACATGAACTAC
AGTAGACCTCTGAGCATAGCAAGCGGCGGGTGGAGTCAAAATTTGAATTCACTGAAACCTAAAAGCGTTGTTCATAGGCTAACTCATTTTGTAAAGTCGGGTTTGGTGGAAAACTGGCAA
AGAAGTTGGATTTTACTGCTATGGTTTTTAACCATGGCTTGTTTATTTACATGGAAATTTAAGCAGTATAGGAACAAGGCTGCTTTTCATGTCATGGGCTATTGTTTGACCACTGCTAAA
GGGGCTGCTGAAACCCTCAAACTCAATATGGCTCTTATTCTTTTACCCGTTTGTAGAAACATGTTAACGTTCCTAAGGTCTACCCGAGCGCGATTGTTCATCCCTTTTGATGACAATATC
AACTTTCACAAG
GTAATTGCTTTTGCAATAGCTGTTGGCATCGGTTTGCACGCTGGAAATCATATGATTTGCGATTTTCCTCGGTTGGTAAACTCTTCACCAGAAAAGTTTGCTCTTATA
GCATCAGATTTCCATAACAAGAAGCCGACATACAAGGAACTAATTGTCGGTGTGGAAGGCATGACTGGAATTTCAATGCTGATATTAATGGCCTTTGCGTTCACCTTAGCTTCGCGATAT
TTCAGAAAAAATGTTTTGAAGCTGCCATCACCTTTCAACCGGTTAACTGGATTCAATGCATTCTGGTTTTCACATCATCTTTTTGGTTTGGTGTACATACTGCTTTTGGTTCATGGATCA
TTCTTGTTTTTGGTTCATAACTGGACTCAAAAAACC
ACGTGGATGTACATCTCGGTTCCAATTTTAATATACGCAGCTGAGAGAAGTCTACGAACAGGACGTTCAGAACACTACTCCCCT
AAAATCATGAAG
GTTTCCATCCTACCAGGAGATGTATTCAGCATAATTATGTCAAAACCGAGTGGATTTAGATACCGGAGTGGACAGTACATATTTCTGCAATGCCCTTCAATCTCTCCA
TTTGAATG
GCATCCGTTTTCATTGACTTCATCACCAGGAGACGATTACTTGAGCGTTCACATCCGGACAGTTGGAGACTGGACCCAAGAGTTGAAGCAAGTATTAACCAATGATACTGGT
TCTTCATGTACGATTGGTCGAGCCAAATTTAGGAAGCTAGGGGAAGTGGATTCAAAAGG
TTTACCAAAGCTACTGTTGGACGGACCTTACGGTGCACCAGCGCAAGATTACAGGAACTAT
GACGTGTTACTTCTTGTTGGGCTAGGAATTGGAGCTACTCCTTTTATAAGTATTCTTAGAGATTTACTAAACAATAATCGGGCAGTAGAAGACCAAACAGATTCAAACACAGAAACGAGT
ATGTCAGGGGATAGTCTTACGAGTATAGCATCTTCAAGTATCGCATCGTCAAATGAAAAGAAGAAACCAAGAAGGACTAAAAGTGCAAATTTCTATTGGGTCACTAGGGAGCCCGGCTCG
TTTGAATGGTTTAAAGGAGTCATGAATGAAGTTGCGGAAATTGATCACAAA
GGTCAAATCGAGATGCACAATTATCTTACAAGTGTTTATGAGGAAGGTGATGCAAGATCAACTTTGATC
ACTATGGTTCAAGCACTTACTCATGCCAAACATGGAGTTGACATCCTATCTGGCACTAGA
GTAAGGACACATTTTGCTAGGCCGAATTGGAGAGAGGTGTTTGGGAAGGTAGCATCGAAA
CATCCGAATACAACCATAG
GAGTGTTCTATTGTGGGATGCCAGTGTTGGCTAAGGAGCTAAGGAAACTATCATATGAGATGAGCCAGAAGACATCGACACGATTTGAGTTCCACAAGGAG
TACTTCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATAGTTT ATAATGGCAA GGTGGAAGTT GGAAAAGATA GGGGGTTAAA GAAACAAGAC TCAACTACTC TCAACACATA AGCGTTGAAT TCGTGTGCTC CCATCGTTTG CTTGTTTCAC  AAATCCCTTT TCACTATGTG GTTTTCTTTC CATACATGTT GATGCAAATT CACGTTTATA TGTTTAACAC AATTTTAAGC AATCTACAAC AATGATGCAA TCTGAGTCTC CCGTCAGTAG  CCGCGGTGGC TCTGACGGAA GATCCACTTT CAGCCGGATG CTAGACCATC CGGCTGATCA TTCCAATGAC AGTTACGGAG TTGGAGGAGC AATGCTCCCT ATATTCCTCA ACGATCTACG  TCGAAACAAC AATGATCAAG ATTTAGTAGA AGTCACGTTA GAACTCGAAG ATGATTCGGT CATTTTATGC AGTGTGACCC CGACCGCTAA CCATTCAAAC CATCATCATC ATCAACATGT  TCCTTCACAG TCGTCTCCAG CTGGGGCGGC CTCCAGGCTT CGTAGGAAGT TTTCGTGGCT GACGTCTTCT TCATCGCGAG CTTCTTCTTC GGATGCAAGT GTGGACCGGG TGATCACGTC  TAGAGATGCT AGAAAATTGA AAGCTAAACT GATTCGCACG AAATCTAGCG CGCAAAGAGC GCTAGGTGGT CTTCGGTTTA TAAGTAAAAC TACAAACACC GATGTTAACG AGTTGTGGAA  AAACGTTGAG GCACGGTTTG CGTGTCTGGC TAAAGATGAT GGATTATTAG CTCGAGAAGA TTTCGCTGAA TGCATAGGAA TGGCGGATTC GAAGGAGTTT GCGTTGGGCG TATTCGATGC  GTTGGCGCGA AGAAGACAGC AGAAATTGGG GAAGATCACG AAAGCGGAGC TTCACGATTT TTGGTTACAG ATTTCCGACC AGAGTTTTGA CGCTCGTCTG CAGATATTCT TCGACATGGC  CGACAGCAAC GAAGATGGAA GAATCACAAG GGATGAGATA CAAGAGCTGC TAGTGCTTAG TGCTGCAGCA AACAGATTGT CAAAGTTGAA AGAACAAGCA GAGGAATACG CTTCTTTGAT  TATGGAAGAA TTAGACCCCG AAAATCTTGG CTATATTGAG TTATGGCAGT TGGAAACGCT TCTACTACAA AGGGAAGCTT ACATGAACTA CAGTAGACCT CTGAGCATAG CAAGCGGCGG  GTGGAGTCAA AATTTGAATT CACTGAAACC TAAAAGCGTT GTTCATAGGC TAACTCATTT TGTAAAGTCG GGTTTGGTGG AAAACTGGCA AAGAAGTTGG ATTTTACTGC TATGGTTTTT  AACCATGGCT TGTTTATTTA CATGGAAATT TAAGCAGTAT AGGAACAAGG CTGCTTTTCA TGTCATGGGC TATTGTTTGA CCACTGCTAA AGGGGCTGCT GAAACCCTCA AACTCAATAT  GGCTCTTATT CTTTTACCCG TTTGTAGAAA CATGTTAACG TTCCTAAGGT CTACCCGAGC GCGATTGTTC ATCCCTTTTG ATGACAATAT CAACTTTCAC AAGGTAATTG CTTTTGCAAT  AGCTGTTGGC ATCGGTTTGC ACGCTGGAAA TCATATGATT TGCGATTTTC CTCGGTTGGT AAACTCTTCA CCAGAAAAGT TTGCTCTTAT AGCATCAGAT TTCCATAACA AGAAGCCGAC  ATACAAGGAA CTAATTGTCG GTGTGGAAGG CATGACTGGA ATTTCAATGC TGATATTAAT GGCCTTTGCG TTCACCTTAG CTTCGCGATA TTTCAGAAAA AATGTTTTGA AGCTGCCATC  ACCTTTCAAC CGGTTAACTG GATTCAATGC ATTCTGGTTT TCACATCATC TTTTTGGTTT GGTGTACATA CTGCTTTTGG TTCATGGATC ATTCTTGTTT TTGGTTCATA ACTGGACTCA  AAAAACCACG TGGATGTACA TCTCGGTTCC AATTTTAATA TACGCAGCTG AGAGAAGTCT ACGAACAGGA CGTTCAGAAC ACTACTCCCC TAAAATCATG AAGGTTTCCA TCCTACCAGG  AGATGTATTC AGCATAATTA TGTCAAAACC GAGTGGATTT AGATACCGGA GTGGACAGTA CATATTTCTG CAATGCCCTT CAATCTCTCC ATTTGAATGG CATCCGTTTT CATTGACTTC  ATCACCAGGA GACGATTACT TGAGCGTTCA CATCCGGACA GTTGGAGACT GGACCCAAGA GTTGAAGCAA GTATTAACCA ATGATACTGG TTCTTCATGT ACGATTGGTC GAGCCAAATT  TAGGAAGCTA GGGGAAGTGG ATTCAAAAGG TTTACCAAAG CTACTGTTGG ACGGACCTTA CGGTGCACCA GCGCAAGATT ACAGGAACTA TGACGTGTTA CTTCTTGTTG GGCTAGGAAT  TGGAGCTACT CCTTTTATAA GTATTCTTAG AGATTTACTA AACAATAATC GGGCAGTAGA AGACCAAACA GATTCAAACA CAGAAACGAG TATGTCAGGG GATAGTCTTA CGAGTATAGC  ATCTTCAAGT ATCGCATCGT CAAATGAAAA GAAGAAACCA AGAAGGACTA AAAGTGCAAA TTTCTATTGG GTCACTAGGG AGCCCGGCTC GTTTGAATGG TTTAAAGGAG TCATGAATGA  AGTTGCGGAA ATTGATCACA AAGGTCAAAT CGAGATGCAC AATTATCTTA CAAGTGTTTA TGAGGAAGGT GATGCAAGAT CAACTTTGAT CACTATGGTT CAAGCACTTA CTCATGCCAA  ACATGGAGTT GACATCCTAT CTGGCACTAG AGTAAGGACA CATTTTGCTA GGCCGAATTG GAGAGAGGTG TTTGGGAAGG TAGCATCGAA ACATCCGAAT ACAACCATAG GAGTGTTCTA  TTGTGGGATG CCAGTGTTGG CTAAGGAGCT AAGGAAACTA TCATATGAGA TGAGCCAGAA GACATCGACA CGATTTGAGT TCCACAAGGA GTACTTCTGA ACTAAAACAG TCCGTATAAT  GTTATACATA CTTATATATT TTTTTTTATA CATTTGAATT TAAAAGAATG TAAATTTGTA CACCACGCAG CAGCTAGTGT AGGTAAACCT GTATAATTAG AGCAATACAA TTATAAGAAA 
GTGAGAAACC GATAATATAC TCCTTCCATT TAGTTATACA AAGATTTTAA CAAGCTAAGA GCTCTA 

Retrieve as FASTA