Entry information : HaRboh03 (HanXRQChr05g0133941)
Entry ID 13779
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh03 (HanXRQChr05g0133941)
Name (synonym) HaRboh03 (HanXRQChr05g0133941)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh03
start..stop
S start..stop
HaRboh06 1059 0 40..813 26..827
EgrRboh06 1035 0 1..813 12..857
EglRboh06 1034 0 1..813 12..857
EguRboh06 1031 0 1..813 12..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25387589..25387937 349 N° 2 25388009..25388171 163 N° 3 25388246..25388294 49 N° 4 25388580..25388693 114
N° 5 25388755..25389558 804 N° 6 25389690..25389779 90 N° 7 25389865..25389980 116 N° 8 25390071..25390173 103
N° 9 25391030..25391103 74 N° 10 25391193..25391340 148 N° 11 25391593..25391706 114 N° 12 25392574..25392702 129
N° 13 25392796..25392874 79 N° 14 25393514..25393623 110  
join(25387589..25387937,25388009..25388171,25388246..25388294,25388580..25388693 ,25388755..25389558,25389690..25389779,25389865..25389980,25390071..25390173,253 91030..25391103,25391193..25391340,25391593..25391706,25392574..25392702,2539279 6..25392874,25393514..25393623)


exon

Literature and cross-references HaRboh03 (HanXRQChr05g0133941)
DNA ref. HanXRQ genome:   HanXRQChr05 (25387589..25393623)
Cluster/Prediction ref. HanXRQ:   HanXRQChr05g0133941
Protein sequence: HaRboh03 (HanXRQChr05g0133941)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   813
PWM (Da):   %s   93172.66 Transmb domain:   %s   o366-388i415-437o468-490i641-660o
PI (pH):   %s   9.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHDGSAAFSIDRSSVAFSIDQSSRTFLKEEVSLSVTGRLSRKSSRLGSSRQRLPPNDESRMVRQRSSAARGLDGLRFVDRVVTGKEGDAWMAIEKRFQQFSVDGKLPREKFGICIGMGNSGEFTGELFDALARRKRIDGSKGITLEQVKVFWEDLSNEDLDTRIHIFFDMCDKNGDGLLTEEEVKVLIMSASANKLSNFKKQAGTYAALIMERLDPDDYGYIEMWQLETLLKSMATPKEATMNPEDTNDLAKTMIPELYRNPWRKFMTRVFESGLEHWKVFWVLFLYLEMNVALFMWKFHQYSLMPSFQVLGYCSCTAKGSGETLKFNMALILLPVCRRTLTAIRETFLGKVLPVDENINFHKIIALAIAIGTVVHTVAHMACNFIRLSRCPLNKFKAIFGNLFVTQPSYMDLVTSIPGYTGIIMIILMAISFTFATSSFRRNVVKLPHPFNDLAGFTSFWYTHHLLIIVYFLFIVHGTFLILTVGWYRKTTWMYLLLPMLCYASERLLTTDHTMLVDTIKAIIYSGNVLALYMTKPIGFKYKSGMYLFVQCPQISRFEWHPFTITSAPGDDYLSVHIRTLGDWTKALREEFAACEPNGNLARMETNSNLTIQESQAIYPRIYIKGPYGAPAQNYRKYNVLLLIGLGIGATPFISILNDLLHHLKKKSGEILDKRAYFYWVTREQGSFEWFKGVMDDIAEHDHENIIEMHNYLTSVYEHGDMRSTLISMVQTLQHAKDGVDVVSQSRIKTHFARPNWRKVFYNLATTHEGRRIGVFYCGAQALVRQLKKLCKEFSRQNITRFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAACACGATGGAAGTGCGGCTTTCTCTATAGACCGGTCAAGTGTGGCTTTCTCTATAGACCAGTCAAGCCGAACATTTCTGAAAGAGGAAGTGAGCTTGTCAGTCACAGGCAGACTA
AGCAGGAAATCTAGCAGGTTAGGTTCTAGCCGACAGAGACTCCCGCCTAATGACGAGTCAAGGATGGTAAGGCAAAGATCAAGTGCGGCTAGAGGGCTTGATGGCTTGCGGTTTGTTGAT
AGAGTTGTGACCGGGAAAGAGGGGGACGCGTGGATGGCTATTGAGAAACGTTTTCAACAATTTTCAGTAGATGGAAAGCTGCCTAGAGAAAAATTTGGAATATGTATTG
GTTAGTTTTCG
GATCTTGAATGATTTGTTTACAAACTAATTGTTTTGATTATTTTGGTTTGTTTTCTTTAGGAATGGGCAACAGTGGCGAGTTCACAGGGGAACTGTTCGATGCACTTGCGAGGCGGAAGA
GGATTGATGGATCTAAAGGGATCACATTAGAGCAAGTAAAAGTATTCTGGGAAGATTTGTCGAATGAGGACCTTGATACCCGAATTCATATTTTCTTCGATAT
GTAAAATCGATATTCCT
TTTTTTCACATAATGTCAAACTAGAAACTCGTAACATATAACTAAAATTGAACTCAGGTGTGACAAGAATGGAGACGGGTTGCTAACTGAGGAAGAAGTAAAAGAGGTACACCGCACCCT
ACAGATAGCAAAATGGTTAAAACGGGTTTAGTAACAGCTCAAAACGATCATTTGTCAAATGATACGTAGTCATTCTAACCTGATCCGGCCTTTTTAATGCACTTTTTTCAGTTATAGTCC
TCTTCGACATGTTTGGCTACGCTGTTTTGCTTAATCTCACTTGAGAGATTAACAAAAAAAAGCCCAAAAACCATTTGTCTCGTTTTTTATGTTCTTTCCTGTCTCAATCTTAAATCTACA
TTGATTGTTTTCGGTTTTTCTCATGTGTAAGGTCCTGATAATGAGTGCATCAGCCAACAAGCTTTCAAATTTCAAGAAACAAGCCGGTACATATGCAGCTCTAATCATGGAAAGACTCGA
CCCTGATGACTACGGTTACATAGAG
GTAAAAAAAAGTTATACTTAACATGTCAACACATTTCTTTAACTTGATCATCGAATGACAGATGTGGCAACTCGAGACGTTGTTGAAAAGTATGG
CGACACCAAAGGAAGCTACCATGAACCCTGAAGACACAAACGATCTAGCCAAAACAATGATCCCAGAACTTTACAGGAACCCGTGGAGAAAATTCATGACAAGAGTGTTTGAATCGGGAC
TCGAGCACTGGAAAGTGTTTTGGGTATTATTTCTATATTTGGAAATGAACGTTGCGCTGTTTATGTGGAAATTCCACCAATATTCGTTGATGCCGTCGTTCCAAGTTTTGGGGTATTGTA
GTTGCACAGCGAAAGGTTCCGGAGAGACTCTAAAGTTTAATATGGCTCTCATTCTCCTTCCTGTATGCCGAAGAACACTTACAGCCATTAGAGAAACTTTCCTTGGGAAAGTATTACCTG
TGGATGAGAACATTAATTTCCACAAGATAATCGCGCTCGCAATCGCGATAGGAACAGTAGTTCACACCGTTGCGCACATGGCCTGCAATTTTATAAGGTTGTCAAGATGTCCTTTGAACA
AATTCAAGGCCATCTTTGGAAATTTATTTGTAACGCAACCGAGTTACATGGATTTAGTAACAAGCATCCCGGGATATACTGGAATCATCATGATTATTTTGATGGCTATTTCCTTCACCT
TTGCAACAAGTTCTTTTAGGAGAAACGTTGTTAAGTTGCCTCACCCGTTCAACGATTTAGCCGGTTTTACTTCCTTTTGGTACACTCATCATCTGTTGATCATCGTTTACTTTTTATTCA
TCGTTCATGGCACCTTCTTAATCCTCACTGTAGGATGGTACAGAAAAACA
GTACGTCACTTGACAACTTGTCTTACACTCCCACACAATTCCAGATACGCGATTTTCACACAAAATCGCG
TATATGGTGCAGTGCGTGAAACATAAGTTTGATCAAATTTTGTCAAACAACATTCTTGCAGACATGGATGTACCTGTTGCTTCCAATGTTGTGTTATGCAAGTGAGAGACTCCTTACAAC
TGACCATACAATGCTTGTTGACACCATTAAG
GTGACCCAACGATGCCATTGTTATTATCTGTTTATCGTTATAAAAATAAAATTCTTGATTATCAGTTTGTGGTATGAAAATTCAGGCTA
TCATATATAGCGGGAATGTGCTAGCACTCTACATGACCAAACCTATAGGATTCAAGTACAAGAGTGGCATGTACCTCTTTGTACAGTGTCCACAAATATCACGCTTCGAATG
GTAAGCTT
GTTATTAATTATATATTTAACGACACATTATTAAATATAAACTAATTGGATTACTAATTATAGATGTTGATTTACATGATAGGCATCCTTTTACCATCACTTCTGCGCCTGGAGATGATT
ATCTAAGTGTACATATTCGTACTCTGGGAGACTGGACGAAAGCACTACGGGAAGAATTTGCAAAG
GTCACACACTGTTTTCTAGTGAAGGGGCAATATTATGGCACTGGTTAAAAAAGGC
CAGGCTGGGTTGTATTGACCCGTAACACTTTTTTTTTCCATTTTTAGAACATTCTATAAGTGATGAATGGGTTAATTATGATTCCAAAACAATTAGTATATAATTATGATGCCTATCATA
GTAAACCATATATATATATAGAGAGAGGGTAAGTTTCATAAGAAAACTACCCTTCGTGGGAAATACTACATATGTGCGGTACTAATACATATGTAGTAACCACCACAAGTGGCCTAGTGG
TGGAGTGACTTGGGTTCTCCAATGGAGACCCAAGTTCAATTCCCATTAGTGCCACTTTGGTGGCCACCGACACCCGCTTTAAAGCCGGACCGAGGACACTCGAGGTCTCGGGTTTGAAAC
ATGTTTCTTACCCCTCTTTGATGGCTATGGGTATTTGCCGCCAGGGATCCTTGTCGGGTGGTGAACTGGGAAGGGAGATCCCTTCCGCGGTCAGGGGTACCGTGCATCTACCCTTTTTTT
AATACATATGTAGTATGATATACCACGTATATGTGGTATGTAGTTTTTTGGTTTTCTCACGCAGTACGAGTTTCTAATAATCTCTTTCCTATATATATATATTGAAAGGCATCAAAGACG
AAAATATTACAAATAATAGAGTTTGCCCACAACTCAACCCATTTGACATGTACCCAGTTTACATTAATTTTCCAATTTGACCCGTGTATGGTAATGCACATCCCAGACCGACACTTGCGT
AAGTAAAAGGGTTGAGACTATCACCTCAGCTCTACGTCAACCGTTCTATCTTAATCTAAATTCTAAAACGCAGAAATGCAGGCCTGTGAGCCGAATGGAAATCTAGCCCGAATGGAAACT
AATTCGAACTTGACCATTCAGGAATCACAAGCAAT
GTGAGTGCCACATAATCTAAGTCTACATCACCGTCTTTTTTAACATCACTTCTAATCAATTTCATGATAATATTCATTTGTTTTG
GCAGCTATCCTAGAATCTACATCAAAGGACCATATGGCGCACCTGCACAAAACTACCGGAAATACAATGTCCTATTACTTATCGGTTTGGGTATTGGAGCCACCCCGTTTATCAGCATAT
TAAATGACCTCTTACATCACCTAAAAAAGTCG
GTAAGTAAACACAATGCCTACTCAAATAGTTATGTCCTACGTGTGTATAAGTAAAAAGAACATTCTAGATAACAAAAACATGCATAAT
TAAGGTAACAAACTTTTAAAAAAATGATAAACTATCTCCAACTTTAGAAAGTTTGAGCCGCTTTGTGAGCGAAAATGAACTCGTCACCCAAAATAAGAGTTACATCAAAGTTATGCAATT
TTCCTTGTATTTAAAAACCTCAAGGAGCATTCATTCTATTGCAGAAATCCGGCGAGATCCTGGATAAAAGAGCTTACTTTTATTGGGTAACAAGGGAGCAGGGTTCATTCGAATGGTTCA
AAGGTGTAATGGATGATATCGCAGAACATGATCACGAG
GTGAGTCATTAATAGGCCTGTAAACGAACCGAACGTTCATGAACTGTTCATGAACTTGTTCGGCAGGAAGTTCGTTTATGTT
CGTTTATTTAATAAACGAACGAACACGAACAAAAATATTTGTTCGTTTAATTAAATGAACGAACATGAACGCACCTTGTGTTCGTTCATTTATGTTCGTGAACATTCTTTTATGTTCGTT
TATTTATGTTCGTGAACGTTCATTTATGTTCGTTTAAATTTTAATAAATACATAAATAGTTATATTTAAATATCAGGTTTTCGAACTACTTATATAAATATAACTAATTAGTATATCTAT
GAACCCTTATTTAGATGTGTTTTCGGATGAAATGTAATATATTAGACTTGTTTCTTCAATCATGTTAACTTATTTTTATTCAAATATATTCAATTAATTTTTTTTTATGTTCGTTTATGT
TCGTGAACTGTTCGTTTAGGCTTTAAACGAACGAACATAAACGAACACGAACATGCTCGATTTCTTAATGAACGAACACGAACAAAAAAATGTGTTCGATTATATGTTCGTGTTCGTGTT
CGGTTAAAGTTAAATGAACGAACACGAACATGATGTTCGTGTTCGTTCGGTTCGTTTACAGGCCTAGTCATTAACCTTAAACTTTAGCTTTATGGTACTATCTACTTACTTAGAACCAAC
TTTCTTAGATAGGTTAAGCCTGTTTGTTCTAATTATTAGACTATATTATTATGCGCCCACGAGCTCAGTTAGGTTTCTAAGGTTACTCGTATTCTCTGTATGGTAACCCTAGAAAACCTA
ACATAGCCTGTGGGCCGGTAATAATATAGTCTAATACTAATGAGGTTTTCACATGTGAATTTCAGAACATTATTGAAATGCATAACTACCTCACAAGTGTGTATGAGCATGGTGATATGA
GATCTACACTTATATCCATGGTGCAGACTCTGCAACATGCCAAAGATGGAGTCGATGTCGTCTCTCAAAGTCGG
GTATAAACTTTCTTAAAATATATGATCAACCAACACCTAATTCAAC
GTTTTATTTCAAAAATTTATTTTCTAATCACAAACACATCACGACAGATTAAAACGCATTTTGCAAGACCAAATTGGAGAAAAGTATTCTACAACTTGGCAACTACACATGAAGGTCGTA
GGATAG
GTAAGACATCACTCATTACTACATTGGGTTTTCTTGTGATTAAAGGTGGCAATCCGGGCTCGTTTACTGGTAAATAGATTAATTTGGGTTGTGTTTATTCTCAACTGGATCTAG
TAAAAAAAAGCTAAAGGAGAACAAGCCAAAGATGCTAAAATCACACAAAGTCTATTATTATTATTATCACTTACAACCTCTTAAATCGTTGTATTCAAACTTTAGACTATTACTCCATCT
GTCTCAAAATTATCGTCCGCGTGACTATTTTTGTTTGTCCCCAAAGAAATGTTCACTTTTGAAAAATGGATAGTCAAAAATACTATTTTCGCCACGGGTAAAATCAGCATTCTACACGCT
AAAAATTGTACGCCTTTATCATTGATACAAGTTTTTCAAATCAATTACGTCTTAAATGCATGGGCATTCTACAAACTAAGTGTTATACATGAAGCCAAAGGTTTTTTTGTTGGTGCACAA
TTAAGCTGGACAAAGGGAGTATTGTAATAAAATTGTTTCTGTAGTCATAATTAACGGGTTCACTATTCATATATAAATGGACATAAAGCGACGTAACCACACACATTTGCCCGCTACCAA
AAATGATCCGGTTTAAGTTAAACCTTGGTTTCCAATGAACTGCAGGTGTTTTCTACTGTGGAGCCCAAGCACTCGTAAGACAATTAAAAAAGCTCTGCAAAGAATTTAGCCGTCAAAACA
TTACTCGCTTTGATTTCCACAAGGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAACACGATGGAAGTGCGGCTTTCTCTATAGACCGGTCAAGTGTGGCTTTCTCTATAGACCAGTCAAGCCGAACATTTCTGAAAGAGGAAGTGAGCTTGTCAGTCACAGGCAGACTA
AGCAGGAAATCTAGCAGGTTAGGTTCTAGCCGACAGAGACTCCCGCCTAATGACGAGTCAAGGATGGTAAGGCAAAGATCAAGTGCGGCTAGAGGGCTTGATGGCTTGCGGTTTGTTGAT
AGAGTTGTGACCGGGAAAGAGGGGGACGCGTGGATGGCTATTGAGAAACGTTTTCAACAATTTTCAGTAGATGGAAAGCTGCCTAGAGAAAAATTTGGAATATGTATTG
GAATGGGCAAC
AGTGGCGAGTTCACAGGGGAACTGTTCGATGCACTTGCGAGGCGGAAGAGGATTGATGGATCTAAAGGGATCACATTAGAGCAAGTAAAAGTATTCTGGGAAGATTTGTCGAATGAGGAC
CTTGATACCCGAATTCATATTTTCTTCGATAT
GTGTGACAAGAATGGAGACGGGTTGCTAACTGAGGAAGAAGTAAAAGAGGTCCTGATAATGAGTGCATCAGCCAACAAGCTTTCAAAT
TTCAAGAAACAAGCCGGTACATATGCAGCTCTAATCATGGAAAGACTCGACCCTGATGACTACGGTTACATAGAG
ATGTGGCAACTCGAGACGTTGTTGAAAAGTATGGCGACACCAAAG
GAAGCTACCATGAACCCTGAAGACACAAACGATCTAGCCAAAACAATGATCCCAGAACTTTACAGGAACCCGTGGAGAAAATTCATGACAAGAGTGTTTGAATCGGGACTCGAGCACTGG
AAAGTGTTTTGGGTATTATTTCTATATTTGGAAATGAACGTTGCGCTGTTTATGTGGAAATTCCACCAATATTCGTTGATGCCGTCGTTCCAAGTTTTGGGGTATTGTAGTTGCACAGCG
AAAGGTTCCGGAGAGACTCTAAAGTTTAATATGGCTCTCATTCTCCTTCCTGTATGCCGAAGAACACTTACAGCCATTAGAGAAACTTTCCTTGGGAAAGTATTACCTGTGGATGAGAAC
ATTAATTTCCACAAGATAATCGCGCTCGCAATCGCGATAGGAACAGTAGTTCACACCGTTGCGCACATGGCCTGCAATTTTATAAGGTTGTCAAGATGTCCTTTGAACAAATTCAAGGCC
ATCTTTGGAAATTTATTTGTAACGCAACCGAGTTACATGGATTTAGTAACAAGCATCCCGGGATATACTGGAATCATCATGATTATTTTGATGGCTATTTCCTTCACCTTTGCAACAAGT
TCTTTTAGGAGAAACGTTGTTAAGTTGCCTCACCCGTTCAACGATTTAGCCGGTTTTACTTCCTTTTGGTACACTCATCATCTGTTGATCATCGTTTACTTTTTATTCATCGTTCATGGC
ACCTTCTTAATCCTCACTGTAGGATGGTACAGAAAAACA
ACATGGATGTACCTGTTGCTTCCAATGTTGTGTTATGCAAGTGAGAGACTCCTTACAACTGACCATACAATGCTTGTTGAC
ACCATTAAG
GCTATCATATATAGCGGGAATGTGCTAGCACTCTACATGACCAAACCTATAGGATTCAAGTACAAGAGTGGCATGTACCTCTTTGTACAGTGTCCACAAATATCACGCTTC
GAATG
GCATCCTTTTACCATCACTTCTGCGCCTGGAGATGATTATCTAAGTGTACATATTCGTACTCTGGGAGACTGGACGAAAGCACTACGGGAAGAATTTGCAAAGGCCTGTGAGCCG
AATGGAAATCTAGCCCGAATGGAAACTAATTCGAACTTGACCATTCAGGAATCACAAGCAAT
CTATCCTAGAATCTACATCAAAGGACCATATGGCGCACCTGCACAAAACTACCGGAAA
TACAATGTCCTATTACTTATCGGTTTGGGTATTGGAGCCACCCCGTTTATCAGCATATTAAATGACCTCTTACATCACCTAAAAAAGTCG
AAATCCGGCGAGATCCTGGATAAAAGAGCT
TACTTTTATTGGGTAACAAGGGAGCAGGGTTCATTCGAATGGTTCAAAGGTGTAATGGATGATATCGCAGAACATGATCACGAG
AACATTATTGAAATGCATAACTACCTCACAAGTGTG
TATGAGCATGGTGATATGAGATCTACACTTATATCCATGGTGCAGACTCTGCAACATGCCAAAGATGGAGTCGATGTCGTCTCTCAAAGTCGG
ATTAAAACGCATTTTGCAAGACCAAAT
TGGAGAAAAGTATTCTACAACTTGGCAACTACACATGAAGGTCGTAGGATAG
GTGTTTTCTACTGTGGAGCCCAAGCACTCGTAAGACAATTAAAAAAGCTCTGCAAAGAATTTAGCCGT
CAAAACATTACTCGCTTTGATTTCCACAAGGAGAATTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACTATCTA CCATTCATTC ATGTCCATAA ACATTTCTCA CTCAGTTTAA CCAAAAGAAT TCTTACAACA TATGTCCACA AAAGTATAAT GAAACAATCA TTCTTCTTTG AAATCTAAAA  GATATACTAA AGATGGAACA CGATGGAAGT GCGGCTTTCT CTATAGACCG GTCAAGTGTG GCTTTCTCTA TAGACCAGTC AAGCCGAACA TTTCTGAAAG AGGAAGTGAG CTTGTCAGTC  ACAGGCAGAC TAAGCAGGAA ATCTAGCAGG TTAGGTTCTA GCCGACAGAG ACTCCCGCCT AATGACGAGT CAAGGATGGT AAGGCAAAGA TCAAGTGCGG CTAGAGGGCT TGATGGCTTG  CGGTTTGTTG ATAGAGTTGT GACCGGGAAA GAGGGGGACG CGTGGATGGC TATTGAGAAA CGTTTTCAAC AATTTTCAGT AGATGGAAAG CTGCCTAGAG AAAAATTTGG AATATGTATT  GGAATGGGCA ACAGTGGCGA GTTCACAGGG GAACTGTTCG ATGCACTTGC GAGGCGGAAG AGGATTGATG GATCTAAAGG GATCACATTA GAGCAAGTAA AAGTATTCTG GGAAGATTTG  TCGAATGAGG ACCTTGATAC CCGAATTCAT ATTTTCTTCG ATATGTGTGA CAAGAATGGA GACGGGTTGC TAACTGAGGA AGAAGTAAAA GAGGTCCTGA TAATGAGTGC ATCAGCCAAC  AAGCTTTCAA ATTTCAAGAA ACAAGCCGGT ACATATGCAG CTCTAATCAT GGAAAGACTC GACCCTGATG ACTACGGTTA CATAGAGATG TGGCAACTCG AGACGTTGTT GAAAAGTATG  GCGACACCAA AGGAAGCTAC CATGAACCCT GAAGACACAA ACGATCTAGC CAAAACAATG ATCCCAGAAC TTTACAGGAA CCCGTGGAGA AAATTCATGA CAAGAGTGTT TGAATCGGGA  CTCGAGCACT GGAAAGTGTT TTGGGTATTA TTTCTATATT TGGAAATGAA CGTTGCGCTG TTTATGTGGA AATTCCACCA ATATTCGTTG ATGCCGTCGT TCCAAGTTTT GGGGTATTGT  AGTTGCACAG CGAAAGGTTC CGGAGAGACT CTAAAGTTTA ATATGGCTCT CATTCTCCTT CCTGTATGCC GAAGAACACT TACAGCCATT AGAGAAACTT TCCTTGGGAA AGTATTACCT  GTGGATGAGA ACATTAATTT CCACAAGATA ATCGCGCTCG CAATCGCGAT AGGAACAGTA GTTCACACCG TTGCGCACAT GGCCTGCAAT TTTATAAGGT TGTCAAGATG TCCTTTGAAC  AAATTCAAGG CCATCTTTGG AAATTTATTT GTAACGCAAC CGAGTTACAT GGATTTAGTA ACAAGCATCC CGGGATATAC TGGAATCATC ATGATTATTT TGATGGCTAT TTCCTTCACC  TTTGCAACAA GTTCTTTTAG GAGAAACGTT GTTAAGTTGC CTCACCCGTT CAACGATTTA GCCGGTTTTA CTTCCTTTTG GTACACTCAT CATCTGTTGA TCATCGTTTA CTTTTTATTC  ATCGTTCATG GCACCTTCTT AATCCTCACT GTAGGATGGT ACAGAAAAAC AACATGGATG TACCTGTTGC TTCCAATGTT GTGTTATGCA AGTGAGAGAC TCCTTACAAC TGACCATACA  ATGCTTGTTG ACACCATTAA GGCTATCATA TATAGCGGGA ATGTGCTAGC ACTCTACATG ACCAAACCTA TAGGATTCAA GTACAAGAGT GGCATGTACC TCTTTGTACA GTGTCCACAA  ATATCACGCT TCGAATGGCA TCCTTTTACC ATCACTTCTG CGCCTGGAGA TGATTATCTA AGTGTACATA TTCGTACTCT GGGAGACTGG ACGAAAGCAC TACGGGAAGA ATTTGCAAAG  GCCTGTGAGC CGAATGGAAA TCTAGCCCGA ATGGAAACTA ATTCGAACTT GACCATTCAG GAATCACAAG CAATCTATCC TAGAATCTAC ATCAAAGGAC CATATGGCGC ACCTGCACAA  AACTACCGGA AATACAATGT CCTATTACTT ATCGGTTTGG GTATTGGAGC CACCCCGTTT ATCAGCATAT TAAATGACCT CTTACATCAC CTAAAAAAGT CGAAATCCGG CGAGATCCTG  GATAAAAGAG CTTACTTTTA TTGGGTAACA AGGGAGCAGG GTTCATTCGA ATGGTTCAAA GGTGTAATGG ATGATATCGC AGAACATGAT CACGAGAACA TTATTGAAAT GCATAACTAC  CTCACAAGTG TGTATGAGCA TGGTGATATG AGATCTACAC TTATATCCAT GGTGCAGACT CTGCAACATG CCAAAGATGG AGTCGATGTC GTCTCTCAAA GTCGGATTAA AACGCATTTT  GCAAGACCAA ATTGGAGAAA AGTATTCTAC AACTTGGCAA CTACACATGA AGGTCGTAGG ATAGGTGTTT TCTACTGTGG AGCCCAAGCA CTCGTAAGAC AATTAAAAAA GCTCTGCAAA  GAATTTAGCC GTCAAAACAT TACTCGCTTT GATTTCCACA AGGAGAATTT CTAAAGAGAG ATTAAATGTA CAAGTTGTTT TCATTCCGGC ATAATGGCAT ATAGAGTTCA CTTGTAGGTC 
TGCAGCCTTG TAGTTCCAAA TTGGTAGAAT AATCAAGAAC AATGTTAAAT CTTCTATAAT AGAACACTTT TTCGGTGATT CTAATTAGCA CAAAGAAATT GTCATGCAT 

Retrieve as FASTA