Entry information : HaRboh04 (HanXRQChr05g0155831)
Entry ID 13780
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh04 (HanXRQChr05g0155831)
Name (synonym) HaRboh04 (HanXRQChr05g0155831)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh04
start..stop
S start..stop
HaRboh11 1688 0 26..930 13..913
HaRboh01 1556 0 25..930 14..917
HaRboh10 1526 0 1..930 3..928
NbRboh02 1493 0 25..930 16..939
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 191014291..191014912 622 N° 2 191014041..191014203 163 N° 3 191013610..191013658 49 N° 4 191013257..191013370 114
N° 5 191012733..191013155 423 N° 6 191012026..191012409 384 N° 7 191011846..191011941 96 N° 8 191011619..191011734 116
N° 9 191011427..191011529 103 N° 10 191011099..191011166 68 N° 11 191010446..191010990 545 N° 12 191010075..191010184 110
complement(join(191010075..191010184,191010446..191010990,191011099..191011166,1 91011427..191011529,191011619..191011734,191011846..191011941,191012026..1910124 09,191012733..191013155,191013257..191013370,191013610..191013658,191014041..191 014203,191014291..191014912))


exon

Literature and cross-references HaRboh04 (HanXRQChr05g0155831)
DNA ref. HanXRQ genome:   HanXRQChr05 (191014912..191010075)
Cluster/Prediction ref. HanXRQ:   HanXRQChr05g0155831
Protein sequence: HaRboh04 (HanXRQChr05g0155831)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   930
PWM (Da):   %s   103800.02 Transmb domain:   %s   o371-393i513-535o555-577i735-752o
PI (pH):   %s   8.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQKMGIPDDVGDVSDGLPESTSRRSDSEVFGTDRKAFSGPLNKRGTRKSARFNVPDDAGSSIASGSLRSKNDDDEYVEVTLDVGDDSVAVHSVKTAGGADVEDPELALLAKGLGKRSSLGASMVRNASSKIRQVSEELRKMTTSFSRRTPVGRYDRSKSAATHALIGLKFISKTDGAAAWAALEKRFDDLTAGTNGLLPRALFGECIGMNKDSKDFAGELFDALSRRRNITGAVINKAQLKEFWDQIADQSFDSRLQTFFDMVDKDADGRISEEEVRIISLSASANKLSKIQTQADEYAALIMEELDPDNLGYIMIESLETLLLQSPTQTVRGESKNLSIMLSQKLRNVTDRNIIQRGYDGFKYFLQDNWQRVWVIALWIGAMAGLFTWKYIQYKNRAAFDVMGHCVCVAKGAAETLKLNMALILLPVCRNTITWLRNKTKLGVVVPFDDNLNFHKVIAVGIMIGVGLHAISHLACDFPRLLSATEEEYEPMVQYFGEQPDSYWHFVKEAEGYTGITMVVLMAIAFTLATPWLRRGRLNLPKPLKKLTGFNAFWYSHHLFIIVYTLLIVHGIKLYLTKEWYKKTTWMYLAVPILLYMCERLIRALRSSVKPVQILKVAVYPGNVLALHMSKPHGFKYKSGQYMFVNCKAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRQLKTVFSVCQPPANGKSGLLRADNQGDNPSFPKVLIDGPYGAPAQDYKKYDVVLLVGLGIGATPMISIVKDIVNNMKANQEEDEALESGNNNAMPPMSPQSKKNSASNFKTTRAYFYWVTREQGSFDWFKGVMNEVAEIDHDGVIEMHNYCTSVYEEGDARSALITMLQSLNHAKNGVDVISGTRVKSHFAKPNWRSVYKRIALTHNAQRGVFYCGAPAPVKELKQLAADFSHKTSTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAAAAATGGGTATTCCCGATGACGTCGGTGACGTCAGCGACGGGTTACCGGAGAGTACCAGCCGTCGTTCCGACTCCGAGGTTTTTGGAACCGACAGAAAGGCGTTCAGCGGGCCG
TTAAACAAGCGAGGAACTCGCAAAAGTGCACGATTTAATGTTCCCGATGATGCCGGTAGTAGCATCGCGAGTGGAAGTTTGCGGTCGAAAAACGACGATGATGAGTACGTGGAAGTTACG
TTAGATGTCGGCGATGATTCGGTTGCGGTCCACAGTGTGAAGACTGCGGGTGGCGCTGACGTGGAGGACCCAGAGTTGGCTTTGTTGGCTAAAGGGTTGGGAAAGAGGAGTTCTTTGGGC
GCGTCCATGGTGAGGAACGCGTCCTCCAAAATCCGCCAGGTGTCCGAAGAGCTTAGAAAAATGACTACGTCGTTTTCTAGACGGACACCTGTCGGACGGTATGACAGGAGTAAGTCCGCG
GCCACTCATGCTCTTATTGGGCTGAAGTTCATCAGTAAAACTGATGGGGCGGCCGCTTGGGCCGCCCTTGAGAAGCGGTTTGATGATCTCACCGCGGGTACTAACGGTTTACTTCCCCGG
GCACTTTTTGGAGAATGCATTG
GTAAACTTATAACTCAAAACTTCTTTTTTTCTTTAATTTTGTTGTGTGATTTTATTTAATTATGGTTATTTATTTACAATCCGGCAGGGATGAACAAG
GATTCGAAAGACTTTGCCGGAGAACTCTTCGATGCACTTAGCCGCAGACGGAATATCACCGGAGCCGTGATTAACAAAGCTCAGTTAAAGGAGTTTTGGGACCAAATTGCTGATCAAAGT
TTTGATTCAAGGCTCCAAACTTTCTTTGACAT
GTAAGAATTTATAATAATTTTTTGAGTAAATTGCCAAAATCGTCCCTGAGGTTTGGGCATTTTTGTCATTTTCATTCAAAACAACTTT
TTTGTACAATATAGTCCTTCACTTTTAGGATTTTTTGTCATTTTCATCCAAACATCTAATTTGTTTTATTTTTTATATCAAACATTTGGATGAAAATAGCAAAAAATCCCAACTCTCAGG
GACGATTTTGGCAAAAAAAAGTCAGACGTCTGGATGAAAATGACAGACATGCCCAAACCTCAGGGGTGATTTTGGCAATTTACACTATTTTTTTTAAATAAATGTAGTAAAATTATTTTT
GGTTTTAGTTATTGATTTGAAAAATGTTATACTAATTCAAGAACATAAATATAGGGTTGATAAAGATGCGGATGGCCGAATCAGTGAAGAGGAAGTTCGAGAGGTATGATCTATGATTTC
TTCTTTGAATCATGTCACGTTGACATGTCAACAGATGAACTTAAACACGACTCGTATAATTGTTCATGTTAAATATATCGATCACAACTGAGACACACTTTATATAGTTAGACCAAGATG
ATTGTATTATGGTACGGTCCATGTATCTAAACGAGTCAAACAAGTTTTGATGATTTTTTAGTTGTATCTAATTTTTTAAAAATTATTTGTATAATACGACAGATTATAAGCTTGAGTGCT
TCGGCAAACAAGTTATCAAAAATACAAACACAAGCAGATGAATATGCGGCATTGATCATGGAAGAATTGGACCCGGACAACCTTGGTTACATCATG
GTATACATTCTTAATCATTCTACT
TCAACTACATTTGATATAACTCCTTAAAAACATTAAAAAGACGATTAACAATACATTTTTGCGTTTCGAAAAACCAGATTGAGAGCTTGGAGACCCTTTTACTGCAATCGCCGACACAAA
CAGTGAGAGGCGAAAGCAAAAATCTGAGCATTATGTTGAGCCAAAAGCTCAGAAATGTGACCGATAGGAACATTATACAACGCGGGTATGATGGGTTTAAGTACTTTTTACAAGACAACT
GGCAAAGAGTTTGGGTGATTGCACTTTGGATTGGGGCGATGGCGGGTTTGTTTACTTGGAAATATATTCAGTACAAAAATCGCGCTGCGTTTGATGTAATGGGGCACTGTGTTTGTGTCG
CTAAAGGTGCGGCTGAGACGCTTAAGTTAAACATGGCTTTGATTTTGTTACCCGTGTGTCGAAACACCATCACTTGGCTTAGGAACAAGACCAAACTTGGCGTTGTGGTTCCCTTTGATG
ATAATCTCAATTTCCACAAA
GTGAGTATCTTGTGAATGTTTTGCGTATCACAACAAACAGAGGGCTTTCAGCGACAGACATATCTGTTATTGACCCCCCATGGAAGGGGGAGGCCGTCAG
TAATCACCAAGAGAATAATGACAGATACTATAAATACATTTATGTATATATAATTTGTGGTTTTGACTAACTGTCGATTATATGTCGGTGATCACTGACGGATACATCACTCGATGATGT
TTTCATCGTTGAAAGTTAATTGTCTAGTAGAATTAGATTTAATGTTCTTTGTAATTCATTAACTTCCATGTCATCTCACACTTAACTTCTATTGGTACACTAGGTGATCGCTGTCGGGAT
CATGATTGGAGTCGGGCTCCATGCGATTTCGCATTTAGCGTGTGATTTCCCTCGACTTCTTAGTGCAACCGAAGAGGAGTATGAACCAATGGTTCAATATTTCGGGGAACAACCCGATAG
CTATTGGCATTTTGTGAAGGAAGCAGAAGGGTATACCGGGATCACGATGGTGGTTTTAATGGCAATAGCCTTTACTTTAGCGACCCCGTGGCTAAGGCGTGGTAGACTGAACCTACCAAA
ACCGCTAAAGAAACTCACGGGTTTTAACGCCTTTTGGTACTCGCACCACCTATTCATTATTGTTTATACTTTGCTCATAGTTCACGGGATCAAACTTTACCTCACGAAAGAATGGTACAA
GAAGACG
GTGAGTACAAACAAACGTTATAGGATTCGCTTGTGTGTACGTTTTCGCGATTGTTGAACTTATCGTTTTCTTCTTTAATGATAGACTTGGATGTACTTGGCGGTTCCGATTTT
GCTTTATATGTGTGAGAGGTTAATCCGGGCGTTAAGATCTAGCGTCAAGCCTGTTCAGATATTAAAG
GTAACGATCACATAGTGGTCATGTCACATGTCGCATGTCACATGTCACATGTC
ACAGGGTCAGGTTGGGTTGACCTGAAACACTTGACTGACATAATTTTTGGTTTTGAAGGTGGCTGTTTACCCGGGAAACGTGTTGGCACTTCACATGTCGAAGCCTCATGGCTTTAAATA
CAAAAGTGGGCAGTACATGTTTGTGAACTGCAAGGCGGTTTCTCCATTTGAATG
GTGAGTCTTGTGCGTAGAAAGGGTTTAAAATGCTTGTTTTTCAAATAAATATGTCTTGTAAGTTGT
AAATTGACTTAATCATGGCTCAGGCACCCGTTTTCGATAACTTCAGCACCAGGAGATGACTACTTAAGTGTGCATATCCGAACCCTCGGTGACTGGACCCGACAACTAAAAACGGTCTTC
TCTCAG
GTATGTGTTTGAGCAACAAAATAGCGTAGTAAAAAGGATCAAGACAGATACACTTAGTAATAACTAGCTTGTCATATACTATTATAAGGTTATATAGTTTTAATAACAATTAAA
TTTTTTGACCCAAAACCGCATAACTTGTCACAGAAGTGTTAGAAATTGTCGTGATAGTTTTGTTGTAGTGATATACGTGTTTGGCCCGTTAGTCATAAAACATAACCCGTTTCCTTTTTA
ACTGACTCGGTTTTGGTCGTGTGTAGGTATGCCAACCACCAGCTAACGGTAAAAGTGGACTCCTAAGAGCTGATAACCAAGGAGACAACCCGAGGTAAGTTCTCATTGTTACAATTATAT
CGCGTTATTAAACCATCAACAACAACAATCGTTAATAAAAAAGTAACCGACACGATTCCTAACTCTTTTGATCAAATTACAGTTTCCCAAAGGTTCTAATCGACGGGCCATATGGTGCAC
CAGCACAAGACTACAAGAAATATGATGTAGTGTTGTTGGTCGGGTTAGGCATCGGTGCAACCCCTATGATCAGTATCGTTAAAGACATCGTGAACAACATGAAAGCGAACCAAGAGGAAG
ACGAGGCTTTGGAGAGCGGCAACAACAACGCAATGCCGCCAATGTCACCACAGTCGAAAAAGAACTCCGCGAGCAACTTCAAGACAACACGGGCTTACTTCTATTGGGTCACAAGGGAAC
AAGGGTCATTTGATTGGTTTAAAGGGGTGATGAACGAGGTTGCGGAAATTGATCACGATGGTGTGATCGAGATGCATAACTATTGCACAAGTGTCTACGAAGAAGGTGATGCTAGATCCG
CTTTGATCACGATGCTTCAGTCGCTAAATCATGCCAAAAATGGTGTTGATGTAATTTCGGGTACTCGGGTCAAGTCTCACTTTGCAAAGCCCAATTGGAGAAGCGTTTATAAGCGGATTG
CTCTTACTCACAACGCTCAACGTATAG
GTGAGTTATTTTCTTCTATTATTCAAGTTTTATGAAAATTATACAATTGTTAAATTAAATACGGGCCGGTTCAACCAGTTTTGACAAAATTTA
TGGATCGAGCCTTTAGCTTCCGTTTTGAAAAACGACAAACCAAACAAGCCTGGATGAGTGGGTCCGCCGGTTCAACCAAACATATATTACATTAACCCATTTTGACCCTTTACCGAATGT
GTGTTGCGCCATAAAATCTTATATAACATTTTGTTTTTTAAATTACAGGGGTATTTTATTGTGGAGCACCAGCGCCAGTCAAAGAGTTGAAACAACTTGCTGCTGACTTTTCTCACAAGA
CTAGCACCAAATTTGACTTTCACAAGGAGAACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAAAAATGGGTATTCCCGATGACGTCGGTGACGTCAGCGACGGGTTACCGGAGAGTACCAGCCGTCGTTCCGACTCCGAGGTTTTTGGAACCGACAGAAAGGCGTTCAGCGGGCCG
TTAAACAAGCGAGGAACTCGCAAAAGTGCACGATTTAATGTTCCCGATGATGCCGGTAGTAGCATCGCGAGTGGAAGTTTGCGGTCGAAAAACGACGATGATGAGTACGTGGAAGTTACG
TTAGATGTCGGCGATGATTCGGTTGCGGTCCACAGTGTGAAGACTGCGGGTGGCGCTGACGTGGAGGACCCAGAGTTGGCTTTGTTGGCTAAAGGGTTGGGAAAGAGGAGTTCTTTGGGC
GCGTCCATGGTGAGGAACGCGTCCTCCAAAATCCGCCAGGTGTCCGAAGAGCTTAGAAAAATGACTACGTCGTTTTCTAGACGGACACCTGTCGGACGGTATGACAGGAGTAAGTCCGCG
GCCACTCATGCTCTTATTGGGCTGAAGTTCATCAGTAAAACTGATGGGGCGGCCGCTTGGGCCGCCCTTGAGAAGCGGTTTGATGATCTCACCGCGGGTACTAACGGTTTACTTCCCCGG
GCACTTTTTGGAGAATGCATTG
GGATGAACAAGGATTCGAAAGACTTTGCCGGAGAACTCTTCGATGCACTTAGCCGCAGACGGAATATCACCGGAGCCGTGATTAACAAAGCTCAGTTA
AAGGAGTTTTGGGACCAAATTGCTGATCAAAGTTTTGATTCAAGGCTCCAAACTTTCTTTGACAT
GGTTGATAAAGATGCGGATGGCCGAATCAGTGAAGAGGAAGTTCGAGAGATTATA
AGCTTGAGTGCTTCGGCAAACAAGTTATCAAAAATACAAACACAAGCAGATGAATATGCGGCATTGATCATGGAAGAATTGGACCCGGACAACCTTGGTTACATCATG
ATTGAGAGCTTG
GAGACCCTTTTACTGCAATCGCCGACACAAACAGTGAGAGGCGAAAGCAAAAATCTGAGCATTATGTTGAGCCAAAAGCTCAGAAATGTGACCGATAGGAACATTATACAACGCGGGTAT
GATGGGTTTAAGTACTTTTTACAAGACAACTGGCAAAGAGTTTGGGTGATTGCACTTTGGATTGGGGCGATGGCGGGTTTGTTTACTTGGAAATATATTCAGTACAAAAATCGCGCTGCG
TTTGATGTAATGGGGCACTGTGTTTGTGTCGCTAAAGGTGCGGCTGAGACGCTTAAGTTAAACATGGCTTTGATTTTGTTACCCGTGTGTCGAAACACCATCACTTGGCTTAGGAACAAG
ACCAAACTTGGCGTTGTGGTTCCCTTTGATGATAATCTCAATTTCCACAAA
GTGATCGCTGTCGGGATCATGATTGGAGTCGGGCTCCATGCGATTTCGCATTTAGCGTGTGATTTCCCT
CGACTTCTTAGTGCAACCGAAGAGGAGTATGAACCAATGGTTCAATATTTCGGGGAACAACCCGATAGCTATTGGCATTTTGTGAAGGAAGCAGAAGGGTATACCGGGATCACGATGGTG
GTTTTAATGGCAATAGCCTTTACTTTAGCGACCCCGTGGCTAAGGCGTGGTAGACTGAACCTACCAAAACCGCTAAAGAAACTCACGGGTTTTAACGCCTTTTGGTACTCGCACCACCTA
TTCATTATTGTTTATACTTTGCTCATAGTTCACGGGATCAAACTTTACCTCACGAAAGAATGGTACAAGAAGACG
ACTTGGATGTACTTGGCGGTTCCGATTTTGCTTTATATGTGTGAG
AGGTTAATCCGGGCGTTAAGATCTAGCGTCAAGCCTGTTCAGATATTAAAG
GTGGCTGTTTACCCGGGAAACGTGTTGGCACTTCACATGTCGAAGCCTCATGGCTTTAAATACAAAAGT
GGGCAGTACATGTTTGTGAACTGCAAGGCGGTTTCTCCATTTGAATG
GCACCCGTTTTCGATAACTTCAGCACCAGGAGATGACTACTTAAGTGTGCATATCCGAACCCTCGGTGACTGG
ACCCGACAACTAAAAACGGTCTTCTCTCAG
GTATGCCAACCACCAGCTAACGGTAAAAGTGGACTCCTAAGAGCTGATAACCAAGGAGACAACCCGAGTTTCCCAAAGGTTCTAATCGAC
GGGCCATATGGTGCACCAGCACAAGACTACAAGAAATATGATGTAGTGTTGTTGGTCGGGTTAGGCATCGGTGCAACCCCTATGATCAGTATCGTTAAAGACATCGTGAACAACATGAAA
GCGAACCAAGAGGAAGACGAGGCTTTGGAGAGCGGCAACAACAACGCAATGCCGCCAATGTCACCACAGTCGAAAAAGAACTCCGCGAGCAACTTCAAGACAACACGGGCTTACTTCTAT
TGGGTCACAAGGGAACAAGGGTCATTTGATTGGTTTAAAGGGGTGATGAACGAGGTTGCGGAAATTGATCACGATGGTGTGATCGAGATGCATAACTATTGCACAAGTGTCTACGAAGAA
GGTGATGCTAGATCCGCTTTGATCACGATGCTTCAGTCGCTAAATCATGCCAAAAATGGTGTTGATGTAATTTCGGGTACTCGGGTCAAGTCTCACTTTGCAAAGCCCAATTGGAGAAGC
GTTTATAAGCGGATTGCTCTTACTCACAACGCTCAACGTATAG
GGGTATTTTATTGTGGAGCACCAGCGCCAGTCAAAGAGTTGAAACAACTTGCTGCTGACTTTTCTCACAAGACTAGC
ACCAAATTTGACTTTCACAAGGAGAACTTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCACACACC CCCCTTCAAC TCATATTTTC AAGCTTCAAT CACCAAACAT CATCTAATCT TTTCTTATTT TAAAACGTTT TTGAGTTCCG AATCGAATCG AATGCAAAAA ATGGGTATTC  CCGATGACGT CGGTGACGTC AGCGACGGGT TACCGGAGAG TACCAGCCGT CGTTCCGACT CCGAGGTTTT TGGAACCGAC AGAAAGGCGT TCAGCGGGCC GTTAAACAAG CGAGGAACTC  GCAAAAGTGC ACGATTTAAT GTTCCCGATG ATGCCGGTAG TAGCATCGCG AGTGGAAGTT TGCGGTCGAA AAACGACGAT GATGAGTACG TGGAAGTTAC GTTAGATGTC GGCGATGATT  CGGTTGCGGT CCACAGTGTG AAGACTGCGG GTGGCGCTGA CGTGGAGGAC CCAGAGTTGG CTTTGTTGGC TAAAGGGTTG GGAAAGAGGA GTTCTTTGGG CGCGTCCATG GTGAGGAACG  CGTCCTCCAA AATCCGCCAG GTGTCCGAAG AGCTTAGAAA AATGACTACG TCGTTTTCTA GACGGACACC TGTCGGACGG TATGACAGGA GTAAGTCCGC GGCCACTCAT GCTCTTATTG  GGCTGAAGTT CATCAGTAAA ACTGATGGGG CGGCCGCTTG GGCCGCCCTT GAGAAGCGGT TTGATGATCT CACCGCGGGT ACTAACGGTT TACTTCCCCG GGCACTTTTT GGAGAATGCA  TTGGGATGAA CAAGGATTCG AAAGACTTTG CCGGAGAACT CTTCGATGCA CTTAGCCGCA GACGGAATAT CACCGGAGCC GTGATTAACA AAGCTCAGTT AAAGGAGTTT TGGGACCAAA  TTGCTGATCA AAGTTTTGAT TCAAGGCTCC AAACTTTCTT TGACATGGTT GATAAAGATG CGGATGGCCG AATCAGTGAA GAGGAAGTTC GAGAGATTAT AAGCTTGAGT GCTTCGGCAA  ACAAGTTATC AAAAATACAA ACACAAGCAG ATGAATATGC GGCATTGATC ATGGAAGAAT TGGACCCGGA CAACCTTGGT TACATCATGA TTGAGAGCTT GGAGACCCTT TTACTGCAAT  CGCCGACACA AACAGTGAGA GGCGAAAGCA AAAATCTGAG CATTATGTTG AGCCAAAAGC TCAGAAATGT GACCGATAGG AACATTATAC AACGCGGGTA TGATGGGTTT AAGTACTTTT  TACAAGACAA CTGGCAAAGA GTTTGGGTGA TTGCACTTTG GATTGGGGCG ATGGCGGGTT TGTTTACTTG GAAATATATT CAGTACAAAA ATCGCGCTGC GTTTGATGTA ATGGGGCACT  GTGTTTGTGT CGCTAAAGGT GCGGCTGAGA CGCTTAAGTT AAACATGGCT TTGATTTTGT TACCCGTGTG TCGAAACACC ATCACTTGGC TTAGGAACAA GACCAAACTT GGCGTTGTGG  TTCCCTTTGA TGATAATCTC AATTTCCACA AAGTGATCGC TGTCGGGATC ATGATTGGAG TCGGGCTCCA TGCGATTTCG CATTTAGCGT GTGATTTCCC TCGACTTCTT AGTGCAACCG  AAGAGGAGTA TGAACCAATG GTTCAATATT TCGGGGAACA ACCCGATAGC TATTGGCATT TTGTGAAGGA AGCAGAAGGG TATACCGGGA TCACGATGGT GGTTTTAATG GCAATAGCCT  TTACTTTAGC GACCCCGTGG CTAAGGCGTG GTAGACTGAA CCTACCAAAA CCGCTAAAGA AACTCACGGG TTTTAACGCC TTTTGGTACT CGCACCACCT ATTCATTATT GTTTATACTT  TGCTCATAGT TCACGGGATC AAACTTTACC TCACGAAAGA ATGGTACAAG AAGACGACTT GGATGTACTT GGCGGTTCCG ATTTTGCTTT ATATGTGTGA GAGGTTAATC CGGGCGTTAA  GATCTAGCGT CAAGCCTGTT CAGATATTAA AGGTGGCTGT TTACCCGGGA AACGTGTTGG CACTTCACAT GTCGAAGCCT CATGGCTTTA AATACAAAAG TGGGCAGTAC ATGTTTGTGA  ACTGCAAGGC GGTTTCTCCA TTTGAATGGC ACCCGTTTTC GATAACTTCA GCACCAGGAG ATGACTACTT AAGTGTGCAT ATCCGAACCC TCGGTGACTG GACCCGACAA CTAAAAACGG  TCTTCTCTCA GGTATGCCAA CCACCAGCTA ACGGTAAAAG TGGACTCCTA AGAGCTGATA ACCAAGGAGA CAACCCGAGT TTCCCAAAGG TTCTAATCGA CGGGCCATAT GGTGCACCAG  CACAAGACTA CAAGAAATAT GATGTAGTGT TGTTGGTCGG GTTAGGCATC GGTGCAACCC CTATGATCAG TATCGTTAAA GACATCGTGA ACAACATGAA AGCGAACCAA GAGGAAGACG  AGGCTTTGGA GAGCGGCAAC AACAACGCAA TGCCGCCAAT GTCACCACAG TCGAAAAAGA ACTCCGCGAG CAACTTCAAG ACAACACGGG CTTACTTCTA TTGGGTCACA AGGGAACAAG  GGTCATTTGA TTGGTTTAAA GGGGTGATGA ACGAGGTTGC GGAAATTGAT CACGATGGTG TGATCGAGAT GCATAACTAT TGCACAAGTG TCTACGAAGA AGGTGATGCT AGATCCGCTT  TGATCACGAT GCTTCAGTCG CTAAATCATG CCAAAAATGG TGTTGATGTA ATTTCGGGTA CTCGGGTCAA GTCTCACTTT GCAAAGCCCA ATTGGAGAAG CGTTTATAAG CGGATTGCTC  TTACTCACAA CGCTCAACGT ATAGGGGTAT TTTATTGTGG AGCACCAGCG CCAGTCAAAG AGTTGAAACA ACTTGCTGCT GACTTTTCTC ACAAGACTAG CACCAAATTT GACTTTCACA 
AGGAGAACTT TTAACTTTAG AGATAATTTA ATCATTTATT AAATAAAATT ATTTTAATTG TTGAAATTTG TATGTATGAC CCAATTCGGA CCTAGTATCT CGT 

Retrieve as FASTA