Entry information : HaRboh05 (HanXRQChr06g0166241)
Entry ID 13781
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh05 (HanXRQChr06g0166241)
Name (synonym) HaRboh05 (HanXRQChr06g0166241)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh05
start..stop
S start..stop
PtRboh03 1516 0 5..927 7..948
PtRboh02 1507 0 5..927 7..949
CclRboh01 1503 0 6..927 7..946
CsRboh01 1501 0 6..927 7..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5219154..5219742 589 N° 2 5219994..5220153 160 N° 3 5220241..5220289 49 N° 4 5221794..5221907 114
N° 5 5224855..5225277 423 N° 6 5225839..5226225 387 N° 7 5226302..5226397 96 N° 8 5227049..5227164 116
N° 9 5227263..5227430 168 N° 10 5227752..5227911 160 N° 11 5227986..5228189 204 N° 12 5228279..5228407 129
N° 13 5228476..5228554 79 N° 14 5228742..5228851 110  
join(5219154..5219742,5219994..5220153,5220241..5220289,5221794..5221907,5224855 ..5225277,5225839..5226225,5226302..5226397,5227049..5227164,5227263..5227430,52 27752..5227911,5227986..5228189,5228279..5228407,5228476..5228554,5228742..52288 51)


exon

Literature and cross-references HaRboh05 (HanXRQChr06g0166241)
DNA ref. HanXRQ genome:   HanXRQChr06 (5219154..5228851)
Cluster/Prediction ref. HanXRQ:   HanXRQChr06g0166241
Protein sequence: HaRboh05 (HanXRQChr06g0166241)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   927
PWM (Da):   %s   105743.08 Transmb domain:   %s   o363-382i502-524o544-566i723-740o
PI (pH):   %s   9.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTGGRHERRWASDTVPDNMLSGGSSPAYTDTSSLNPNDEFVEVTLDLQDDDTIILRSVEPATVIHVDNNTDTENIPASTSSSRSSTMRRSSSNRLRQFSQELKAFSMELRRFPWSYGRASSSNAGGLDSALAARAIRRQRAQLDRTRSGAHRALKGLRFISSNKINGVDGWNEVQNNFDKLQKDGYLYRADFAKCIGMVDSKEFALEVYDAISRRRRLKVDKISKDELYAYWTQITDESFDSRLQIFFDMVDKNEDGRITEEEVKIIMLSASANKLSRLQAQAEEYAALIMEELDPERLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLHGLRNRSPIKRMSSKFIYYLQENWKRLWIIILWILIMTGLFLWKYYQYKQRAAFDVMGYCVLTAKGAAETLKLNMAIILLPVCRNTITWLRSTRLSSFVPFDDNINFHKTIAAAIVIGVILHAGNHLACDFPRLINEDESQYDLDMSKFFGTNKPAYIDLVRGVEGVTGVIMVVCMVIAFTLATRWFRRSLVTLPKPFDRLTGFNAFWYSHHLFVIVYVLLLVHGWFLYFVKKWYKKTTWMYLAFPVLLYAGERTLRFFRSGSYTVRILKVAIYPGKVLTLQMTKPPQFRYKSGQYMFVQCPVVSPFEWHPFSITSAPNDDYLAIHVRGLGDWTQELSRVFSEVCEQPVAGKSGLLRADETTKTILPRLLIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIVKMEELFQDSTSGHSRRSDQSSGSADSSSQSKVSPSKKKSLRTTNAYFYWVTREQGSFDWFKGVMNEVAELDHRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGVDIVSGTMVRTHFARPNWKKVLSKTCTKHAGARIGVFYCGAPVLAKELSNLCHEFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGGCGGTCGTCACGAACGCCGGTGGGCGTCCGACACCGTTCCGGACAACATGTTGAGCGGCGGTTCATCTCCGGCGTACACCGATACGTCGTCGTTGAATCCAAACGATGAGTTC
GTTGAAGTCACGTTAGATCTTCAAGACGACGACACTATTATTCTACGTAGTGTGGAGCCTGCGACGGTTATCCACGTGGATAACAACACCGATACGGAGAATATTCCGGCGTCCACGTCA
TCATCCCGATCGTCAACTATGCGCCGGAGTTCGTCCAACCGGTTACGCCAGTTCTCGCAGGAGTTGAAGGCGTTTTCGATGGAGTTGCGCCGGTTTCCGTGGAGTTATGGCCGCGCGTCG
TCGTCCAACGCTGGAGGTTTGGATTCGGCCTTGGCTGCGCGCGCTATCCGGAGACAGCGCGCGCAGCTCGACCGGACTCGGTCCGGTGCTCATCGAGCTCTAAAAGGACTTAGATTCATT
AGTAGCAATAAAATTAATGGTGTGGATGGATGGAATGAAGTTCAGAATAATTTTGATAAGCTTCAGAAAGATGGATATTTGTATCGTGCTGATTTCGCGAAATGTATAG
GTCCGTTGTTT
AACGTTTTTCCATTTACTAACTTTTTTTTCGAATCTGAGCGAAGTAGAGCTGAATCTCAGTGGATCATGGCAGCAAGACCACTGTTTCTTTTACGAATCTCAGCGATGTAGAGCCGAATC
TCAGTGGATCGTGACAGCAAGGCCACTCTATCACTTACAATACCCAGTTTTAACTACTGGAGTTGTTTAACTTTTTTGAATAGATGTAAATGAATATATGATCGTTGTTTTAACTTATAG

GAATGGTGGATTCGAAGGAATTTGCGCTTGAGGTTTATGACGCGATAAGTAGAAGACGAAGGCTTAAAGTTGATAAGATTAGTAAAGACGAATTGTATGCGTATTGGACTCAAATCACCG
ATGAGAGTTTCGATTCTCGCCTCCAGATCTTCTTCGATAT
GTAAGCGTCTTGCTTTGGATTGATTAACAAATTTGGTTCGATTTGTTCGACATGACGAAATAAATATTTTGTTACGTTAA
TCTACAGGGTTGATAAGAATGAAGATGGAAGAATTACTGAAGAAGAAGTTAAGGAGGTAAATGAACATTGTTCATACATTTTCTTCTGCATTTCTTATAAGTTTTAGTTTTTTTAATCCA
AATTATTATTCATATATGAAAATTTCAAACATGTTTAGAAGGGTGGCGTGGAGAGTGGTTGAATTATGCATGTGTTGGAGGTGAATCGGTGACCATTTCTGATTTACAAAATCTTCCCAC
CCCATTATAAACAACTTCTTGTGTAGTTTTAGTTTTAAAATTTACATCAGGTTGTTTTCAAAACTAATAGTATTTCAAAAACTGATATTTGCTGTAAGACTGGGCAGTGGCAGATCCAGG
ATTTTTTTCACCGGGTTCCTTTTGCTAGATTTTCACTAATTCTCATAATTTTTTTCTAAATAATATAAAATTTCCACTATTTTTTTCCAAACCGAGGGGATTTCCGGGAACCCCCAAAAC
ACCCCTTGATCCGCCACTGAGACTGGGTGGTGTGGTCTCACGCCTCTAGGGGCTTTATCACGCTACATAAGTGTCATGTAGGCAACACATAAGTGTGGGGCCTAACGTTAACTTGCACGG
GGTAGAATAACGCCTCCAATAAAGCCCCTTTTCGCTATATTCAAAAAGACAAATAAACTCAAATTTGATTTATCTTTTGTGGGCCATCCCCTTTTCGCTATGGCTTTGACGGAGGCCAAG
GATAACGCCCCCTTGGCAGCCGGCGGGGTGGCCTAGGTGCGCCAAAATAGTTGACGTGACAGGGGACGTAAAACCACACCGTCCAACGTAAGTGTAATTCATAAGACGGTATAATATTGT
CTTTTATTCTCCCATTAAGTCATCAATATTAAAGCATTAGTTTTTTCTTTTTACACTGGATACTAAAGTTTACTTGGTTTTTGCTTTTCAACGTTTTCGGGGAATATTTATGTTAAATAA
AATGTTATAAGTTCTATAAATTAATAATAAGTGAAATGTTTTTATTTTTGTAAGTAACAATATTTAGACCGTTAATGTTAATGTATATACTTTAATATGTGACAATTTAAATAACAATAT
TTTTTGGTTTACAAGAAAGGAAATTTATGTCCACAAGTGTGACATTGGTATAAACTCAATTCTCAAACATGTGCTATGACATTATGACAATATTCCAATGCCTTTTATAAAAATTATTAT
TGATCATATTTTGGAAAAATATACCCATATATCAAATAAAGTCAAGAGTAAGTATGACACGTAAAAATATTTTAAAACTCTATAAAATTTAATATTTTCACTTTTAGCAAGATTTGTAAA
TGTTTAGAAAATTGCTAGCCTTCAGGCTGCCAATTAGTGTATTTCAACACAGTTTTACAAATATATTAAATAATAACACTAGTGATAAAGTATTAATAAAAAGTTGTACATTGAAAGTAA
ACATTTAAAGTATGCAAGTGTGTTATATGGAACTGGTATACTAAACATATAAGGGGGGTTGGTGAGGACTTTTTCTTAAACATTAGAGAAATTAAGATCAAATTTGAAAAATGTTAACAG

ATAATAATGCTAAGTGCGTCAGCAAACAAGTTATCAAGGTTACAAGCACAAGCAGAAGAGTATGCAGCTTTAATAATGGAAGAGTTGGATCCTGAAAGACTTGGCTACATTGAG
GTGTGT
GGGTTCCACCTTTTACCTTTTCACTTTAACAATATATAATTTTATATATACATATTGTTTATAAAAATTATGATTAATTTATGCCCGTTTAGAGTTATATAGGCTTTATAACTGATTGTT
GCACAAGAAAATGTCAGAGAATGTTTTTTGTTCCATGTATACGGGTCGTATAACATTTTACGACTCGTATAGAATGTTATACGACCCATATGATGTTATACGACTCAATATTTGTTAAGT
CAGATTATTCTATATGGGCGTATAACGTTATACGACCCGTATATAGGGTGTGAAATTAAGATATTAAGGTGTGACTTTATTAGGACCCTTAATTTAATTTAATGAACGTATATAACAATC
TATGTACGCCTCTTCCTATTTAAATGTTTAGTGTCGTTTTAATACTTCTTCCATTCAAGTAATAAGTCTTATTTTCTTGTATGTTATAATAATAAATAGCCATCATGAAATCATCTATTT
TGACACATCTTCTATATATCTGTTTCATTATCACATGTGGGTATTTTATACAAGTAGTTAATAATTAGGTATGTTAATTATAATTTATGTTAAGGTCAATCACCCTATTTCTTAAACCGT
TGGACAGCCAAGAAAATCAAGAGATTGGAATTTGTCTTGTACTTTCGTTTATCCATGTTCTAGATTAGTAGATTCTTGTAGTACATAAATTGAAATTATAAGGCCGCCCGGGGCGGTTAC
GTTATACAAAGTATAACGCGTTATACAAGCTGCCATTCCCACCGCCACCATATAAATTAACGCGTGATGGATTTTTGAAAGTATAACGCGTGGAAAAATTAACGCCGTGATGGTTTGGTT
TTGTGAGTGGAATTGTTGGTTGGGGGGAAATTGTTGGGTGTGGTGATGAGTGATGACCACCCCTACTAAAAATGGTTGTGAGTGATGGGAAAATGGTCGATGACATGGCGAAACTTGATT
GGTGCTTGTGAGTGATAAATTCTATCACTAGTGAACCACCCCTAGTCCCCTAAGGGTGAAGGGGGTGCTCACCTAATAGGTGAGTCCCCTCTCTTACGCCAAACCAATCCCCGTGTGCCA
CGTCAACTCCCCTCTTAAACTCCCCTAACACTCCAATTTGATGGCGCCACTCCCCTCTTAGGTGAATTGGTTTTTTTTTTTTTAAAAAAAAAAAAAGAAAATCATTGATTGGATGGCAGC
TCCCTCTCTCCTCTCTCTCTCCTCCCTCTCTCCTCCCCCCTCTTCGGCAGCTCCACCCCGTTTTAGTCCCTCTCTCTCTTCACCGCTGGAGTTGGCGGCACATTACCGATTAGGCAGGAG
GGGTCCCCGATTGCAAATCGGTGGGTACCCCGCCCACCCTAACTTTTAAAATTTTACATATCATCTATGCTATGTGCTTAATTAATACCCCATATTTAACCCAAAGTTAGATGAAAAAAA
ATAATATGAGAGAGAGTTATATATATTTGACTTTGGAATAAATATTAATAGAAGGTGAGGTGTCCTCATCAAAAATATTTAGCCATGTGAAATAGAATAATGAAGTTGAAATATTTATTG
TAGTAGGATGAACATGATAGAATTCATGAAACCAGGGAATATTGCCTAAAAGGATATAATATATTTTTTTTTTCACTTAATTAAATCAAGTTGTGTATGTTAGATTTCAAAGTAGTGGTT
AGGCAAAAAGCCTAAGCTAAAATCAGATAAATACATACATTGTTGTTCAACTGTCCCATGAAGAATTAAGAATGAATATAACAACATTGGAACACACATGATTCTCTTTTGGTTGTTCAA
CTGCTGTCTTTAGGAAGGAAAATATACAACACAAATTCTTAAAAGTCTATAAATTACTAACTTTAGGTTAAAATACTGTTTTAAAACAAAATAAAACATTATCCTCAAGCATTTTATATA
TTAGTTAGTATTTCACTATTTTGATTGTTTTCTATATTGATAAATCAAATTAATCTTATGGATCAAAGTAGAAAGTACAACCTTTTCACATCGTTAAATCTTGCATCTGTCAGATGTCTT
TTGGCTTAGTGGCACCAGATGTTTATGACTATATCACCAACAAAGTGGTGCGGATTCAAATCTCACAAAGTGAACAATAGGTGGATTCTAAAAGTATATTTTAGATTAGTGTGTGTTCGT
CGTTAAAATAATAAAATATTCCATCTAAGATGATGAAGTTGTTTTATTCTTTAGAAAAGAGTAAATAACGATTTTGGCCCCTATGGTTATATCACTTTTACTCTTTTAGCCCAAAAAGGA
ATGTTTTAACATTTGAGCCTCCAACGTCTTTTTTTCTAACCCTGTTGGCCCCTAACACTAACCCCATTCATTTACTTTTAGGGGCCAAAAGGGTTAGAGAAAAGACGTTGGGGGCTCAGA
TGTTAAAAAATTCATTTTTGGACTATATAACCGCAGAGGCCAAAATCATAATTTAATTTTTAGAAAATGAAAGTTAGTGACATTTTTATTCAACAATGTATCCTAATAATTCCTTTTCTT
TTCTGTCACTTTTTTCCACTTCTCTTCCATACCTCATCTTAGCATCTTGACACATGTTCAGCCAGGTTGCTATCATTCTCATTCACATTATTTGTTCTCATCATTGGGTTTGTGGTATAG
TCCCTCATTTACGCGTATCCTCCACTATCCCATGTGTATAAAGTGGTCAACCATATATTCTTATCATGACTTATGAATACCATAAAAACACAAAAAAAAAAAAAAAAAAAATCAACATTT
CACTCTCATTTGTGTGTACATAAAACATTCATAGTTATACCATAACACTTTACATTTATGTAGTCAAATGTAAAGAAACTTTAGCTTTGATAATCATCTTAATTATATTGCATATTTGCA
TAAACATTTGAATTAGCTAATTAATTTTTAATAAAAATGATTTTTTGTTATGATTATCCAGCTATGGCAACTCGAAACACTTCTCTTACAAAAGGACACTTACCTCAACTACAGTCAAGC
TTTGAGCTACACGAGCCAAGCGTTGAGTCAGAACCTACACGGGTTAAGAAATCGGAGCCCGATAAAGAGAATGAGTTCCAAATTTATTTACTATCTACAAGAAAACTGGAAAAGACTATG
GATTATTATCTTATGGATTTTGATTATGACTGGTTTGTTCCTTTGGAAATACTATCAGTACAAACAACGGGCTGCTTTTGACGTTATGGGCTACTGTGTACTTACGGCTAAAGGCGCAGC
CGAAACTCTCAAACTTAATATGGCTATCATATTATTGCCGGTGTGCAGGAACACTATTACTTGGCTGAGGTCCACCAGGTTGTCTTCTTTCGTACCGTTTGATGACAACATCAACTTTCA
CAAG
GTCAATATTTTTATTTATATTTCTACTTCTGTTTTAGCTAGATCATGGATTACAATTGGTTTGGGTTGAGACACGCCATTTTCATTATGGTTGAATTGGGTCGAGTCAGGTTGACA
CGCAAACACTTTTTGCCCGTTTTTTCGTATAATCAAAGTAACAATATTTTTAATAACAATAATCTAAAATTTTGAATAAAATGATTAAGTAGGTGTTATGCATACTTAGAACTTAAACAA
ATTTTAGTGTGTTTGGCCCATCCGGCCCATTTGCCACTTTTATTAAAAATAAATAAATTTATTTGGTCCATGTTAAATTCTACTATCCTACATAAATCACAACCCATATAGAATTGTCAT
TAAAAAAATTGGATTACTTAATACGAAAATTACATAAGAACGGCAGGTAAACAGACAACAAGTTGCGCCACAACCCATATCTATCCATTGATACGTACGTGAATTGTCTAGTTTTAGTTA
AATTAATTTTGTATGATATTTTTCTTTTTTTTATTTGTATGATGAAAAATGAAAATGTGATAATCGGTCTCACTTGCATTTGCAGACCATAGCCGCAGCGATTGTAATCGGTGTAATACT
CCACGCGGGTAACCATTTGGCATGTGATTTCCCAAGGCTTATAAACGAAGACGAAAGTCAGTACGATCTTGACATGAGTAAATTCTTCGGTACAAACAAACCAGCCTACATAGACCTGGT
CCGGGGGGTGGAGGGTGTGACCGGAGTTATAATGGTGGTTTGCATGGTGATTGCCTTCACACTCGCAACCAGATGGTTCAGGCGGAGCCTAGTGACGCTACCAAAGCCGTTTGATAGGCT
CACTGGCTTCAACGCCTTCTGGTATTCACATCACTTGTTTGTTATCGTTTATGTTTTGCTACTAGTCCATGGGTGGTTCCTGTATTTTGTGAAGAAGTGGTACAAAAAGACG
GTATAATA
GCTAACTTGTTGCTTATTAATTTAACAACCAAAAACTACATGATAACTGTGACATAATGTTGTTTCAGACGTGGATGTACCTTGCATTTCCGGTTTTGCTTTATGCGGGTGAAAGAACGC
TCAGATTTTTCCGATCAGGTTCCTATACTGTCCGGATTCTAAAG
GTTAGCAAAACCAACCATGTGGAGCTTGCTAGATGGGTGGGTCGGGTAAGAGGTCAAAACCATATAAGTTGAAAGG
GTCACCTTTAGTGGTCAGACTCAGAATGGGCCTGATAGGATTTGTTCAGCAACAAATTACTTTCTTTTGTCCATTTTCTAACTTTTTTAGATTAATACTTTCTGAGTTATTTATGCTTAA
AATAAATCAAACGTTTTTTATAATAAAACAATATGTAATGTAGCAGGAATAGATTTTTGGCCGCTTTCTGCGCGGCTGGGCTCGTCGCTTTAAGCTAATTATTTATTTAACTTGTAAGTG
GGTCAAAACTACAAATGCCAACCATGTGTAGATACAAACCGGTTAATTTCTATAACCGGCTATGATGGTTAATTTCAACTTTACTTTAACAGGTTATTGCTTTTAACTGGTCCGGTTAAT
CACTTTAACCGGTTCGGTTAATAACCTGTTTTTTTTTTCGGTTAATTAACCTTTTTTTGCCTTTTTTTTTAATTTTTGGGGTTTTTTTTGGCTAACCGGTTCCTAAACTTCATAATTAAC
CACTAACCGGTTCTGGTTCTAATTAATCAACCTGTTTTTTGCCCATGTGTTTAATAATTTTTTTTATCTTTTTTTGTTATTGTGACAATATTTAGGTTGCAATATATCCGGGTAAAGTTC
TCACATTGCAAATGACCAAGCCTCCCCAGTTTCGATACAAGAGTGGACAATACATGTTTGTGCAATGCCCGGTTGTATCGCCATTCGAATG
GTAATTATTTTTTTTCTTAAAATGACGAT
TTAATATACAAATAACGGTCAAGATAATTACTAATTATGCTGCCTTACATTATTTATTTTTGTTTCCAGGCATCCATTTTCGATTACTTCTGCTCCAAACGATGATTATCTCGCAATTCA
CGTAAGGGGGCTTGGTGATTGGACGCAAGAATTAAGTAGAGTATTCTCGGAGGTCTGTGAACAACCCGTGGCTGGCAAAAGCGGGCTGCTCAGAGCCGATGAAACTACCAAAACAAT
GTA
TATAACTAACTATATATCCATTTACCATTTTACCTACCCTACTTTAATTTATTGCTACCGGATGGCAAGATGGGTGGGTCAGATCGGACTGGGTTGACCTACAAACACTTTATGTTTAAT
TTATAAATAATTAACGTGCTAATTATAATATTACAAAGATAATGTCTTTAAATAAATGCCATTTAGAAGGTTAACATGTATCGATTTTAAATAGATGTGTGACAACTTTCGACCCGCTTC
ATCCAGACCAATTTTGTTGACCCTTTAGTTACCACATAAGATGGGCATGTATGTCTTTTAATATTAAACTGATTTCAGCTTGCCAAGACTGTTGATTGACGGGCCGTATGGCGCACCAGC
ACAAGACTACCGTAAATACGACGTTCTTTTGCTTGTTGGACTCGGCATTGGAGCAACGCCTTTTATTAGTATTCTTAAAGATTTGCTTAACAACATTGTTAAAATGGAGGAACTAGAA
GT
AAGGAACTTTTACTAGTAGCATTGGACTTGATTTGTACGAATCGAGTGATTAATATTTAAACTTGATATTAGTTTCAGGACTCAACATCGGGCCACAGTAGGCGATCGGATCAGAGCTCT
GGGAGTGCTGACTCATCCTCTCAGAGTAAAGTTTCTCCAAGTAAGAAGAAAAGCTTGAGGACTACAAATGCTTACTTTTATTGGGTGACTAGAGAACAAGGTTCGTTTGATTGGTTCAAA
GGAGTCATGAATGAAGTTGCGGAACTTGATCACCGG
GTATATATATTAATCAAGTCTATTAAAATAAATAATTTTGTTTAGAAGATTTCAAATAATTTATAAACAAATTGGGTGGCAATG
TGTAGGGTGTGATAGAGATGCATAACTATCTAACCAGCGTCTACGAAGAAGGTGATGCTCGATCAGCTCTCATCACCATGGTCCAAGCTCTCAATCATGCCAAAAACGGGGTTGACATTG
TATCCGGAACAATG
GTAAGATCAATATCATTTTATAATATTCTTATATAACACCTTCCTTAATAACGAATTTTCATTAACAGGTTCGGACCCATTTCGCAAGGCCAAATTGGAAGAAAGT
TTTGTCCAAAACTTGTACAAAACATGCCGGTGCTAGGATAG
GTGAGTATATTCATCGTCACAATCGATATACATAGTTTGGGCTTTATGTTTGTGACAAGATGTCAAACAGGTTGAGCAA
CGTGTCAAAACACATGCGTGTTCAACCGTGTTATTGTTACTCTCTTGGTCCCACCATTATATTTTACTTTGTCCTTAAAGAAGTAATATTTGGTGTTTTGTGGAGCAGGTGTGTTCTACT
GTGGCGCGCCGGTGCTAGCCAAAGAACTGAGTAACCTATGTCACGAGTTTAACCAAAAAGGTTCAACAAAATTTGAATTCCATAAGGAACACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGGCGGTCGTCACGAACGCCGGTGGGCGTCCGACACCGTTCCGGACAACATGTTGAGCGGCGGTTCATCTCCGGCGTACACCGATACGTCGTCGTTGAATCCAAACGATGAGTTC
GTTGAAGTCACGTTAGATCTTCAAGACGACGACACTATTATTCTACGTAGTGTGGAGCCTGCGACGGTTATCCACGTGGATAACAACACCGATACGGAGAATATTCCGGCGTCCACGTCA
TCATCCCGATCGTCAACTATGCGCCGGAGTTCGTCCAACCGGTTACGCCAGTTCTCGCAGGAGTTGAAGGCGTTTTCGATGGAGTTGCGCCGGTTTCCGTGGAGTTATGGCCGCGCGTCG
TCGTCCAACGCTGGAGGTTTGGATTCGGCCTTGGCTGCGCGCGCTATCCGGAGACAGCGCGCGCAGCTCGACCGGACTCGGTCCGGTGCTCATCGAGCTCTAAAAGGACTTAGATTCATT
AGTAGCAATAAAATTAATGGTGTGGATGGATGGAATGAAGTTCAGAATAATTTTGATAAGCTTCAGAAAGATGGATATTTGTATCGTGCTGATTTCGCGAAATGTATAG
GAATGGTGGAT
TCGAAGGAATTTGCGCTTGAGGTTTATGACGCGATAAGTAGAAGACGAAGGCTTAAAGTTGATAAGATTAGTAAAGACGAATTGTATGCGTATTGGACTCAAATCACCGATGAGAGTTTC
GATTCTCGCCTCCAGATCTTCTTCGATAT
GGTTGATAAGAATGAAGATGGAAGAATTACTGAAGAAGAAGTTAAGGAGATAATAATGCTAAGTGCGTCAGCAAACAAGTTATCAAGGTTA
CAAGCACAAGCAGAAGAGTATGCAGCTTTAATAATGGAAGAGTTGGATCCTGAAAGACTTGGCTACATTGAG
CTATGGCAACTCGAAACACTTCTCTTACAAAAGGACACTTACCTCAAC
TACAGTCAAGCTTTGAGCTACACGAGCCAAGCGTTGAGTCAGAACCTACACGGGTTAAGAAATCGGAGCCCGATAAAGAGAATGAGTTCCAAATTTATTTACTATCTACAAGAAAACTGG
AAAAGACTATGGATTATTATCTTATGGATTTTGATTATGACTGGTTTGTTCCTTTGGAAATACTATCAGTACAAACAACGGGCTGCTTTTGACGTTATGGGCTACTGTGTACTTACGGCT
AAAGGCGCAGCCGAAACTCTCAAACTTAATATGGCTATCATATTATTGCCGGTGTGCAGGAACACTATTACTTGGCTGAGGTCCACCAGGTTGTCTTCTTTCGTACCGTTTGATGACAAC
ATCAACTTTCACAAG
ACCATAGCCGCAGCGATTGTAATCGGTGTAATACTCCACGCGGGTAACCATTTGGCATGTGATTTCCCAAGGCTTATAAACGAAGACGAAAGTCAGTACGATCTT
GACATGAGTAAATTCTTCGGTACAAACAAACCAGCCTACATAGACCTGGTCCGGGGGGTGGAGGGTGTGACCGGAGTTATAATGGTGGTTTGCATGGTGATTGCCTTCACACTCGCAACC
AGATGGTTCAGGCGGAGCCTAGTGACGCTACCAAAGCCGTTTGATAGGCTCACTGGCTTCAACGCCTTCTGGTATTCACATCACTTGTTTGTTATCGTTTATGTTTTGCTACTAGTCCAT
GGGTGGTTCCTGTATTTTGTGAAGAAGTGGTACAAAAAGACG
ACGTGGATGTACCTTGCATTTCCGGTTTTGCTTTATGCGGGTGAAAGAACGCTCAGATTTTTCCGATCAGGTTCCTAT
ACTGTCCGGATTCTAAAG
GTTGCAATATATCCGGGTAAAGTTCTCACATTGCAAATGACCAAGCCTCCCCAGTTTCGATACAAGAGTGGACAATACATGTTTGTGCAATGCCCGGTTGTA
TCGCCATTCGAATG
GCATCCATTTTCGATTACTTCTGCTCCAAACGATGATTATCTCGCAATTCACGTAAGGGGGCTTGGTGATTGGACGCAAGAATTAAGTAGAGTATTCTCGGAGGTC
TGTGAACAACCCGTGGCTGGCAAAAGCGGGCTGCTCAGAGCCGATGAAACTACCAAAACAAT
CTTGCCAAGACTGTTGATTGACGGGCCGTATGGCGCACCAGCACAAGACTACCGTAAA
TACGACGTTCTTTTGCTTGTTGGACTCGGCATTGGAGCAACGCCTTTTATTAGTATTCTTAAAGATTTGCTTAACAACATTGTTAAAATGGAGGAACTAGAA
TTTCAGGACTCAACATCG
GGCCACAGTAGGCGATCGGATCAGAGCTCTGGGAGTGCTGACTCATCCTCTCAGAGTAAAGTTTCTCCAAGTAAGAAGAAAAGCTTGAGGACTACAAATGCTTACTTTTATTGGGTGACT
AGAGAACAAGGTTCGTTTGATTGGTTCAAAGGAGTCATGAATGAAGTTGCGGAACTTGATCACCGG
GGTGTGATAGAGATGCATAACTATCTAACCAGCGTCTACGAAGAAGGTGATGCT
CGATCAGCTCTCATCACCATGGTCCAAGCTCTCAATCATGCCAAAAACGGGGTTGACATTGTATCCGGAACAATG
GTTCGGACCCATTTCGCAAGGCCAAATTGGAAGAAAGTTTTGTCC
AAAACTTGTACAAAACATGCCGGTGCTAGGATAG
GTGTGTTCTACTGTGGCGCGCCGGTGCTAGCCAAAGAACTGAGTAACCTATGTCACGAGTTTAACCAAAAAGGTTCAACAAAATTT
GAATTCCATAAGGAACACTTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACTGATTCAC TACTATAATT CCTCATTTTC TCTACTCATT TCATCTCTTA CAAACTAAAC AAACAAATTA ACAAAAACCG TTTTTTGTCA TGACCGGCGG TCGTCACGAA CGCCGGTGGG  CGTCCGACAC CGTTCCGGAC AACATGTTGA GCGGCGGTTC ATCTCCGGCG TACACCGATA CGTCGTCGTT GAATCCAAAC GATGAGTTCG TTGAAGTCAC GTTAGATCTT CAAGACGACG  ACACTATTAT TCTACGTAGT GTGGAGCCTG CGACGGTTAT CCACGTGGAT AACAACACCG ATACGGAGAA TATTCCGGCG TCCACGTCAT CATCCCGATC GTCAACTATG CGCCGGAGTT  CGTCCAACCG GTTACGCCAG TTCTCGCAGG AGTTGAAGGC GTTTTCGATG GAGTTGCGCC GGTTTCCGTG GAGTTATGGC CGCGCGTCGT CGTCCAACGC TGGAGGTTTG GATTCGGCCT  TGGCTGCGCG CGCTATCCGG AGACAGCGCG CGCAGCTCGA CCGGACTCGG TCCGGTGCTC ATCGAGCTCT AAAAGGACTT AGATTCATTA GTAGCAATAA AATTAATGGT GTGGATGGAT  GGAATGAAGT TCAGAATAAT TTTGATAAGC TTCAGAAAGA TGGATATTTG TATCGTGCTG ATTTCGCGAA ATGTATAGGA ATGGTGGATT CGAAGGAATT TGCGCTTGAG GTTTATGACG  CGATAAGTAG AAGACGAAGG CTTAAAGTTG ATAAGATTAG TAAAGACGAA TTGTATGCGT ATTGGACTCA AATCACCGAT GAGAGTTTCG ATTCTCGCCT CCAGATCTTC TTCGATATGG  TTGATAAGAA TGAAGATGGA AGAATTACTG AAGAAGAAGT TAAGGAGATA ATAATGCTAA GTGCGTCAGC AAACAAGTTA TCAAGGTTAC AAGCACAAGC AGAAGAGTAT GCAGCTTTAA  TAATGGAAGA GTTGGATCCT GAAAGACTTG GCTACATTGA GCTATGGCAA CTCGAAACAC TTCTCTTACA AAAGGACACT TACCTCAACT ACAGTCAAGC TTTGAGCTAC ACGAGCCAAG  CGTTGAGTCA GAACCTACAC GGGTTAAGAA ATCGGAGCCC GATAAAGAGA ATGAGTTCCA AATTTATTTA CTATCTACAA GAAAACTGGA AAAGACTATG GATTATTATC TTATGGATTT  TGATTATGAC TGGTTTGTTC CTTTGGAAAT ACTATCAGTA CAAACAACGG GCTGCTTTTG ACGTTATGGG CTACTGTGTA CTTACGGCTA AAGGCGCAGC CGAAACTCTC AAACTTAATA  TGGCTATCAT ATTATTGCCG GTGTGCAGGA ACACTATTAC TTGGCTGAGG TCCACCAGGT TGTCTTCTTT CGTACCGTTT GATGACAACA TCAACTTTCA CAAGACCATA GCCGCAGCGA  TTGTAATCGG TGTAATACTC CACGCGGGTA ACCATTTGGC ATGTGATTTC CCAAGGCTTA TAAACGAAGA CGAAAGTCAG TACGATCTTG ACATGAGTAA ATTCTTCGGT ACAAACAAAC  CAGCCTACAT AGACCTGGTC CGGGGGGTGG AGGGTGTGAC CGGAGTTATA ATGGTGGTTT GCATGGTGAT TGCCTTCACA CTCGCAACCA GATGGTTCAG GCGGAGCCTA GTGACGCTAC  CAAAGCCGTT TGATAGGCTC ACTGGCTTCA ACGCCTTCTG GTATTCACAT CACTTGTTTG TTATCGTTTA TGTTTTGCTA CTAGTCCATG GGTGGTTCCT GTATTTTGTG AAGAAGTGGT  ACAAAAAGAC GACGTGGATG TACCTTGCAT TTCCGGTTTT GCTTTATGCG GGTGAAAGAA CGCTCAGATT TTTCCGATCA GGTTCCTATA CTGTCCGGAT TCTAAAGGTT GCAATATATC  CGGGTAAAGT TCTCACATTG CAAATGACCA AGCCTCCCCA GTTTCGATAC AAGAGTGGAC AATACATGTT TGTGCAATGC CCGGTTGTAT CGCCATTCGA ATGGCATCCA TTTTCGATTA  CTTCTGCTCC AAACGATGAT TATCTCGCAA TTCACGTAAG GGGGCTTGGT GATTGGACGC AAGAATTAAG TAGAGTATTC TCGGAGGTCT GTGAACAACC CGTGGCTGGC AAAAGCGGGC  TGCTCAGAGC CGATGAAACT ACCAAAACAA TCTTGCCAAG ACTGTTGATT GACGGGCCGT ATGGCGCACC AGCACAAGAC TACCGTAAAT ACGACGTTCT TTTGCTTGTT GGACTCGGCA  TTGGAGCAAC GCCTTTTATT AGTATTCTTA AAGATTTGCT TAACAACATT GTTAAAATGG AGGAACTAGA ATTTCAGGAC TCAACATCGG GCCACAGTAG GCGATCGGAT CAGAGCTCTG  GGAGTGCTGA CTCATCCTCT CAGAGTAAAG TTTCTCCAAG TAAGAAGAAA AGCTTGAGGA CTACAAATGC TTACTTTTAT TGGGTGACTA GAGAACAAGG TTCGTTTGAT TGGTTCAAAG  GAGTCATGAA TGAAGTTGCG GAACTTGATC ACCGGGGTGT GATAGAGATG CATAACTATC TAACCAGCGT CTACGAAGAA GGTGATGCTC GATCAGCTCT CATCACCATG GTCCAAGCTC  TCAATCATGC CAAAAACGGG GTTGACATTG TATCCGGAAC AATGGTTCGG ACCCATTTCG CAAGGCCAAA TTGGAAGAAA GTTTTGTCCA AAACTTGTAC AAAACATGCC GGTGCTAGGA  TAGGTGTGTT CTACTGTGGC GCGCCGGTGC TAGCCAAAGA ACTGAGTAAC CTATGTCACG AGTTTAACCA AAAAGGTTCA ACAAAATTTG AATTCCATAA GGAACACTTT TAAGGTGATA  TAACAATCAC AAATGTAAAT GTACAGTTAT AGTAAGAAAA AAGGGATAAT ATTTGTTTCA TGCCACCAAG AACAACTATC ATCCTTTATT ATTAGATGGT TTACACCAAA GGATATTATT  GCATTATGCG GATACACGTG GCGATAATCG AGTGGTGACA ATTGGCGCGG TGGCAGTGGT GGGATCAATA TCCACTACCT ATCTAGAAGG TTGACATTTG GAGTTGGAGA TGGTGGATGA  CATGAATCAA GATTCTTCTA GAAGTAATTG AAGGTGGTGG AATCCACCTT GAATTGTTTA TCTACTTTTT TATTATTATT ATATTTTTTA TACACTTACA TTTCTATACT TTGATTATAT 
TTAGTTATAC AACGATAATT ATATCAAAAT ACAATTAAGT TAACTCATGT ACGTCATCCA AA 

Retrieve as FASTA