Entry information : HaRboh06 (HanXRQChr06g0176071)
Entry ID 13782
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh06 (HanXRQChr06g0176071)
Name (synonym) HaRboh06 (HanXRQChr06g0176071)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh06
start..stop
S start..stop
HaRboh03 1107 0 26..827 40..813
EgrRboh06 1096 0 6..827 9..857
EglRboh06 1094 0 6..827 9..857
EguRboh06 1093 0 6..827 9..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36871371..36871683 313 N° 2 36871107..36871269 163 N° 3 36870965..36871013 49 N° 4 36870768..36870881 114
N° 5 36869449..36870276 828 N° 6 36869265..36869357 93 N° 7 36869075..36869190 116 N° 8 36868662..36868764 103
N° 9 36868423..36868547 125 N° 10 36868186..36868333 148 N° 11 36867824..36867937 114 N° 12 36867237..36867365 129
N° 13 36867078..36867156 79 N° 14 36866872..36866981 110  
complement(join(36866872..36866981,36867078..36867156,36867237..36867365,3686782 4..36867937,36868186..36868333,36868423..36868547,36868662..36868764,36869075..3 6869190,36869265..36869357,36869449..36870276,36870768..36870881,36870965..36871 013,36871107..36871269,36871371..36871683))


exon

Literature and cross-references HaRboh06 (HanXRQChr06g0176071)
DNA ref. HanXRQ genome:   HanXRQChr06 (36871683..36866872)
EST ref. GenBank:   DY909844.1 [Fragment]
Cluster/Prediction ref. HanXRQ:   HanXRQChr06g0176071
Protein sequence: HaRboh06 (HanXRQChr06g0176071)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   827
PWM (Da):   %s   93331.72 Transmb domain:   %s   i279-301o362-384i417-439o459-481i657-674o
PI (pH):   %s   8.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGADLESVQIDPIDGRKPAGLPPMLSRTSSKATSVQKGPPPSGGGAPKMGRTTSTAAKGLNSLRFLDRTVTGKEGDAWRSIERRFNQFAVAGKLPKDKFGICLGMGDSIEFAGELYDAMARRRNIDGEEGLTKEQVRDFWEEMTKKDLDARLSIFFDMCDKNGDGILSEEEVKVLIMSASANKLSNFKNQAGTYAALIMDELDPDHRGYIEMWQLEILLTGMVLKDNGKPNQKSENTKKNQDTTNLAMSMIPQSYRHPTRRFINEGIELVQDNWKRFWVVTIFLVLNFLLFEWKFLQYSKLPTFEVMGYCVCVAKAAGETLKLNMALILLPVCRKTLTGLRETWLGKLLPFDDNINFHKLISVAIVIGVIAHTVAHMGCNFIRISTCPPATFQRVYGNLLPAQPSYKDLMLTIPGVTGVIMDVMMFFCFLLATHAFRRNVINLPWPFNNLAGFTSFWYAHHLLIIVYILLILHGYFLVFATFWYMKTTWMYLVLPMLCYASERVFTASDHNHRVNIVKAIIYTGNVLALYMSKPNGFKYRSGMYLFVKCPNISGFEWHPFSITSAPGDDYLSVHIRTLGDWTTALKNEFAACEPPPQKPQIGASASRAVKGNLVRLETKANVNVSVEEAQAIYPTIIIKGPYGAPAQDYRKYDILLLIGLGIGATPFISILKDLLNHQREAYDGKVPERAYFYWVTREQGSFEWFKGVMDDIAEYDKEHIIEMHTYLTCVHEEGDARSALIAMVQSLQHAKNGVDVVSQSRIRTHFSRPNWKRVFSTLATNHDSARIGVFYCGSQTLVKSLESIAKEFSVETSTRFEFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGGGGCTGATCTTGAAAGCGTTCAGATCGACCCAATAGATGGCCGTAAGCCTGCCGGGTTGCCACCGATGTTAAGCCGCACCTCTAGTAAGGCAACATCTGTTCAAAAGGGACCG
CCACCTTCTGGTGGAGGGGCGCCAAAAATGGGCCGCACAACATCAACGGCTGCCAAAGGGCTTAATAGCTTACGGTTTCTTGATAGAACCGTGACCGGAAAAGAAGGGGATGCATGGAGG
TCGATTGAGAGACGTTTTAATCAATTTGCTGTCGCGGGAAAGCTACCTAAAGACAAATTTGGAATCTGCCTTG
GTTAGAAATTAAAATTAGTTTGAAAAATGTTGACATGCATATAATGC
ATGCAGGTGGTATATATATATTTTCTTTGTTGAATGTTCGTTTTATGTTTGTAGGAATGGGAGATAGCATCGAATTCGCAGGGGAGTTGTATGATGCAATGGCTAGGCGTAGGAATATAG
ATGGTGAAGAAGGGCTCACTAAAGAACAAGTTAGAGATTTTTGGGAAGAGATGACAAAGAAAGACCTTGATGCTCGGCTTAGTATCTTTTTCGACAT
GTAAATAGAAATTAGCCATGTTT
GTTCGATTGCGCTTGCTTATGATAGAATCAGAATATCCAAGCTAAAGATTTTATTGATTTAATGTTTTAGGTGTGACAAGAATGGGGATGGGATATTATCAGAGGAAGAGGTAAAAGAGG
TGAGAAATTATCAAAGAAACGTTTTTATCTTCCCATTCATTGCTAAAATCTTAAACTCATGCTGAATTTTCTCGTCCTTAAGGTACTTATAATGAGCGCTTCGGCGAACAAGCTTTCGAA
TTTCAAGAACCAAGCCGGGACATATGCAGCTCTAATCATGGATGAACTAGACCCTGACCATCGTGGTTACATAGAG
GTTATATATATATATATATATATGCTATTTTTGCAATATTTGAA
GCCTGTTTGGATTTGTGTAACTTCTATAAATAACAAGTTTTTAGCATTTTATGAAAACTTCTGCTTCTTATTATCTTGGCCACTTTCATATCATTGGTAACAGAACTCATTATTTGAAAT
TAAAATTAGATTACCTCTTTATCATGCTTTTAAACTAATTTAAGAGGCGATAACTCTCAATTTTAGTCATTTTCAAACAAGCAAATATATGATTGTTGCAACTTTAAGCAACAGAATCAA
ACATAACACTATTTTCTATACCTGGTTTTGTTAGATTTAATTATCTTATTCTGATTTTCAGTATTATAGAATTACTTCAAAATACACATTCAAATTAAACACCCCTTTCACCTTGTTACT
ATTTTTCTAAACTTTGTTTCTTGGGTTAGATTCACCCACACCCTACTATGAGTGGGATCTTACTGCGTATATTTTTTTTGGGGACAGATGTGGCAACTCGAAATCCTGCTAACAGGCATG
GTATTGAAGGATAATGGCAAGCCAAACCAGAAATCAGAGAATACTAAAAAGAATCAAGATACAACGAATCTAGCAATGTCTATGATCCCACAAAGCTATCGCCACCCAACTAGAAGATTC
ATAAATGAAGGGATAGAACTTGTACAAGACAACTGGAAAAGATTTTGGGTAGTAACCATATTCCTCGTGCTTAACTTCTTACTTTTTGAATGGAAATTTCTTCAGTATAGCAAACTGCCA
ACATTTGAAGTAATGGGTTATTGTGTATGCGTAGCCAAGGCTGCGGGTGAGACCCTAAAGCTTAACATGGCTCTAATTCTCCTTCCGGTTTGTAGAAAAACACTCACAGGCTTACGAGAA
ACATGGTTAGGGAAACTTTTACCTTTTGATGATAACATCAACTTCCATAAACTTATCTCCGTCGCCATTGTGATTGGAGTTATAGCCCATACTGTAGCACACATGGGCTGCAACTTTATA
AGGATTAGCACTTGCCCCCCAGCCACTTTTCAACGTGTTTATGGAAATTTGCTCCCAGCGCAACCATCGTACAAGGATCTAATGTTAACAATCCCAGGTGTTACGGGTGTGATCATGGAC
GTAATGATGTTCTTTTGTTTTCTACTCGCGACGCATGCTTTTAGAAGAAATGTCATAAATTTACCATGGCCGTTTAATAATTTAGCCGGTTTTACCTCCTTTTGGTATGCCCATCATCTT
CTGATTATCGTTTACATCTTGTTGATCCTGCATGGGTACTTCCTCGTGTTCGCCACTTTTTGGTACATGAAAACA
GTAAGCCAATTACCTAGTGATACCAACAGTTTACACATACCATCT
TCGATTCGACGTTTGAACCATAAATGCAAACTTAATTACATTGCAGACATGGATGTATCTTGTGCTCCCAATGTTGTGTTATGCAAGTGAGAGAGTGTTTACAGCCTCTGACCATAACCA
TCGGGTTAATATCGTTAAG
GTGACCATCAATGCATCTATTATCTCTCTTTTTAACCACCCATAATGAAATCTGATGTGTATATCTCTTTATAGGCTATCATATACACTGGAAATGTCCTA
GCTCTCTATATGAGCAAACCTAATGGATTCAAGTACAGGAGCGGGATGTACCTTTTTGTTAAATGTCCAAATATATCAGGTTTCGAATG
GTACAAATCTCTTTGATCCAGTCCAACTTAA
TATAAAAATGTCAAAGAAGTATTGTTTTACAGCGATATAAATTTAAAGAAACCAAATGTACCCTATAAAATCCTACACATGGGAATTGCTAGGAGAGTCTGCAGAATAATTTTAAAGAAA
TGATTACGAAATAACCAATACGTATACACTATCTAATAAAATGCTCAAAACCTTTCACTTTCTCACAAAACAACCACATCTTCGGTCATTAAAGGGAAAGATGGTATTTTGTTAAAGTTA
TCCCCAAGCTGAACTAAAACATGATATTGTTTATCGCAGGCATCCTTTCTCCATAACTTCTGCACCTGGAGATGATTACTTAAGTGTACATATTCGAACTTTAGGAGACTGGACAACAGC
CCTTAAAAACGAATTTGCAAAG
GTAAAACCAATTAGAGCTTCTAGGCTTCATGCACCAGTATTTGAAACTTACTGGTCAATGTTTATATACAACCTTTTTTACTGTTAATCTAAATTCTA
AAACACAGAAATGCAGGCTTGTGAGCCTCCACCACAGAAACCTCAAATTGGTGCTTCTGCTTCAAGAGCTGTAAAAGGAAACCTTGTTCGATTAGAAACCAAAGCAAACGTTAATGTTTC
TGTAGAAGAAGCGCAAGCAAT
GTAAGCATAAAAACAAGCCTAAACTATCCATTGTGTATTTTTGCATATCTTTCTCTTTAAGTTATGGTCTTGGCTTTGTCTTATTCCAGATACCCTACA
ATAATCATCAAAGGACCATATGGAGCTCCGGCTCAAGATTACAGAAAATATGACATCCTATTACTTATTGGTTTGGGTATTGGAGCAACCCCCTTCATTAGCATTTTGAAAGATCTCTTA
AACCACCAAAGGGAAGCA
GTAAGTAGTACTTCTTTTATACCATGTTACCTTATAAAGGGTTGTGCTAAAGGTACCCCACCCTCCTCTCGTTTTACTTATTGCACCCTTAAACTTGACACA
TCAGTAAATTTTTCCCTTTTCACACTATAAAACAAAAAATTATTGATCTGATGTTTTCAGAGGGGGTATGATGAAAACTTAGGAGGGGTGAGATACGTTTAGCCAACCCCTTCGTAAAAC
GAGTTATGCTAATCATATTCTCATAGGCGTATGATGGAAAAGTTCCGGAACGCGCCTACTTCTATTGGGTGACAAGGGAACAAGGATCATTTGAGTGGTTCAAAGGTGTTATGGATGATA
TTGCTGAGTATGACAAAGAG
GTAGGTTCAATTCTGGTGAACAAAACAAATGCATTATTTCATTGCTACACAAAGGAGTATCGACATATTACCCAAAAGATACATGTCAGTATTTTTTTTA
TAAAACAGTCCACACCCCCTCTAATCTTACCCTAATTCTACACCAATATCCAATATGAGACTCAAACCCTCAACCTGATAGAGAGGAACACCACTTTACACACGTTGATAACAGGGATCT
CTAACGAAAAAAAACAGTCACACATAAAAATGTTACAAATATAAATTAAATTAAATGGTCAGTAATCACCGACAGATTACCTACAAAATTTCTACCCGTTAAAACCGACAGTTATCGACG
AATACAGTTTCATCATTTTTGGAGGGAACGGTAGTCCGTCCGTGATACATTTTGTAGTGTTTTCATGTGTGAAGCAAAAAAGTATTGTTATAATGGGTATTTTGAATGTGAATTGCAGCA
CATAATCGAAATGCATACCTACTTGACATGTGTTCATGAAGAAGGTGATGCACGATCTGCGCTCATTGCCATGGTGCAGTCTCTACAACATGCCAAAAACGGGGTGGATGTTGTCTCCCA
AAGTCGT
GTATGTTTTCTTGAAACTGTTATCCCGTATTGTTCTTTACTTCCTAGAGAATTCTGTTTCTAATGAGTAAATCATAACAGATAAGAACACATTTTTCAAGACCTAACTGGAAG
AGGGTATTCTCCACTTTGGCAACCAACCATGATTCTGCTAGAATTG
GTAATTAGCCACCTTATTTCATAATCTAATATCTACTATCTGTTTTGATAATTTGTGATATTCTATGGATACCT
TTTGATCGTTGTTGACTTACAGGTGTGTTCTATTGTGGGAGCCAAACGCTCGTCAAATCACTAGAAAGTATTGCCAAAGAATTTTCCGTAGAAACTTCAACTCGCTTTGAATTCCACAAA
GAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGGGGCTGATCTTGAAAGCGTTCAGATCGACCCAATAGATGGCCGTAAGCCTGCCGGGTTGCCACCGATGTTAAGCCGCACCTCTAGTAAGGCAACATCTGTTCAAAAGGGACCG
CCACCTTCTGGTGGAGGGGCGCCAAAAATGGGCCGCACAACATCAACGGCTGCCAAAGGGCTTAATAGCTTACGGTTTCTTGATAGAACCGTGACCGGAAAAGAAGGGGATGCATGGAGG
TCGATTGAGAGACGTTTTAATCAATTTGCTGTCGCGGGAAAGCTACCTAAAGACAAATTTGGAATCTGCCTTG
GAATGGGAGATAGCATCGAATTCGCAGGGGAGTTGTATGATGCAATG
GCTAGGCGTAGGAATATAGATGGTGAAGAAGGGCTCACTAAAGAACAAGTTAGAGATTTTTGGGAAGAGATGACAAAGAAAGACCTTGATGCTCGGCTTAGTATCTTTTTCGACAT
GTGT
GACAAGAATGGGGATGGGATATTATCAGAGGAAGAGGTAAAAGAG
GTACTTATAATGAGCGCTTCGGCGAACAAGCTTTCGAATTTCAAGAACCAAGCCGGGACATATGCAGCTCTAATC
ATGGATGAACTAGACCCTGACCATCGTGGTTACATAGAG
ATGTGGCAACTCGAAATCCTGCTAACAGGCATGGTATTGAAGGATAATGGCAAGCCAAACCAGAAATCAGAGAATACTAAA
AAGAATCAAGATACAACGAATCTAGCAATGTCTATGATCCCACAAAGCTATCGCCACCCAACTAGAAGATTCATAAATGAAGGGATAGAACTTGTACAAGACAACTGGAAAAGATTTTGG
GTAGTAACCATATTCCTCGTGCTTAACTTCTTACTTTTTGAATGGAAATTTCTTCAGTATAGCAAACTGCCAACATTTGAAGTAATGGGTTATTGTGTATGCGTAGCCAAGGCTGCGGGT
GAGACCCTAAAGCTTAACATGGCTCTAATTCTCCTTCCGGTTTGTAGAAAAACACTCACAGGCTTACGAGAAACATGGTTAGGGAAACTTTTACCTTTTGATGATAACATCAACTTCCAT
AAACTTATCTCCGTCGCCATTGTGATTGGAGTTATAGCCCATACTGTAGCACACATGGGCTGCAACTTTATAAGGATTAGCACTTGCCCCCCAGCCACTTTTCAACGTGTTTATGGAAAT
TTGCTCCCAGCGCAACCATCGTACAAGGATCTAATGTTAACAATCCCAGGTGTTACGGGTGTGATCATGGACGTAATGATGTTCTTTTGTTTTCTACTCGCGACGCATGCTTTTAGAAGA
AATGTCATAAATTTACCATGGCCGTTTAATAATTTAGCCGGTTTTACCTCCTTTTGGTATGCCCATCATCTTCTGATTATCGTTTACATCTTGTTGATCCTGCATGGGTACTTCCTCGTG
TTCGCCACTTTTTGGTACATGAAAACA
ACATGGATGTATCTTGTGCTCCCAATGTTGTGTTATGCAAGTGAGAGAGTGTTTACAGCCTCTGACCATAACCATCGGGTTAATATCGTTAAG
GCTATCATATACACTGGAAATGTCCTAGCTCTCTATATGAGCAAACCTAATGGATTCAAGTACAGGAGCGGGATGTACCTTTTTGTTAAATGTCCAAATATATCAGGTTTCGAATGGCAT
CCTTTCTCCATAACTTCTGCACCTGGAGATGATTACTTAAGTGTACATATTCGAACTTTAGGAGACTGGACAACAGCCCTTAAAAACGAATTTGCAAAG
GCTTGTGAGCCTCCACCACAG
AAACCTCAAATTGGTGCTTCTGCTTCAAGAGCTGTAAAAGGAAACCTTGTTCGATTAGAAACCAAAGCAAACGTTAATGTTTCTGTAGAAGAAGCGCAAGCAAT
ATACCCTACAATAATC
ATCAAAGGACCATATGGAGCTCCGGCTCAAGATTACAGAAAATATGACATCCTATTACTTATTGGTTTGGGTATTGGAGCAACCCCCTTCATTAGCATTTTGAAAGATCTCTTAAACCAC
CAAAGGGAAGCA
GCGTATGATGGAAAAGTTCCGGAACGCGCCTACTTCTATTGGGTGACAAGGGAACAAGGATCATTTGAGTGGTTCAAAGGTGTTATGGATGATATTGCTGAGTATGAC
AAAGAG
CACATAATCGAAATGCATACCTACTTGACATGTGTTCATGAAGAAGGTGATGCACGATCTGCGCTCATTGCCATGGTGCAGTCTCTACAACATGCCAAAAACGGGGTGGATGTT
GTCTCCCAAAGTCGT
ATAAGAACACATTTTTCAAGACCTAACTGGAAGAGGGTATTCTCCACTTTGGCAACCAACCATGATTCTGCTAGAATTGGTGTGTTCTATTGTGGGAGCCAAACG
CTCGTCAAATCACTAGAAAGTATTGCCAAAGAATTTTCCGTAGAAACTTCAACTCGCTTTGAATTCCACAAAGAGAACTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTCTCATTA ACATCATATT CTCCATCCTT ACTTCCTTCC TTCCTTCCCA TTTTCTGAAA CCAAAACAAA ATATTTTTCA CTTTTATGGT AGGAAAGTAA ACTTGAAACA CGATGAAAGG  GGCTGATCTT GAAAGCGTTC AGATCGACCC AATAGATGGC CGTAAGCCTG CCGGGTTGCC ACCGATGTTA AGCCGCACCT CTAGTAAGGC AACATCTGTT CAAAAGGGAC CGCCACCTTC  TGGTGGAGGG GCGCCAAAAA TGGGCCGCAC AACATCAACG GCTGCCAAAG GGCTTAATAG CTTACGGTTT CTTGATAGAA CCGTGACCGG AAAAGAAGGG GATGCATGGA GGTCGATTGA  GAGACGTTTT AATCAATTTG CTGTCGCGGG AAAGCTACCT AAAGACAAAT TTGGAATCTG CCTTGGAATG GGAGATAGCA TCGAATTCGC AGGGGAGTTG TATGATGCAA TGGCTAGGCG  TAGGAATATA GATGGTGAAG AAGGGCTCAC TAAAGAACAA GTTAGAGATT TTTGGGAAGA GATGACAAAG AAAGACCTTG ATGCTCGGCT TAGTATCTTT TTCGACATGT GTGACAAGAA  TGGGGATGGG ATATTATCAG AGGAAGAGGT AAAAGAGGTA CTTATAATGA GCGCTTCGGC GAACAAGCTT TCGAATTTCA AGAACCAAGC CGGGACATAT GCAGCTCTAA TCATGGATGA  ACTAGACCCT GACCATCGTG GTTACATAGA GATGTGGCAA CTCGAAATCC TGCTAACAGG CATGGTATTG AAGGATAATG GCAAGCCAAA CCAGAAATCA GAGAATACTA AAAAGAATCA  AGATACAACG AATCTAGCAA TGTCTATGAT CCCACAAAGC TATCGCCACC CAACTAGAAG ATTCATAAAT GAAGGGATAG AACTTGTACA AGACAACTGG AAAAGATTTT GGGTAGTAAC  CATATTCCTC GTGCTTAACT TCTTACTTTT TGAATGGAAA TTTCTTCAGT ATAGCAAACT GCCAACATTT GAAGTAATGG GTTATTGTGT ATGCGTAGCC AAGGCTGCGG GTGAGACCCT  AAAGCTTAAC ATGGCTCTAA TTCTCCTTCC GGTTTGTAGA AAAACACTCA CAGGCTTACG AGAAACATGG TTAGGGAAAC TTTTACCTTT TGATGATAAC ATCAACTTCC ATAAACTTAT  CTCCGTCGCC ATTGTGATTG GAGTTATAGC CCATACTGTA GCACACATGG GCTGCAACTT TATAAGGATT AGCACTTGCC CCCCAGCCAC TTTTCAACGT GTTTATGGAA ATTTGCTCCC  AGCGCAACCA TCGTACAAGG ATCTAATGTT AACAATCCCA GGTGTTACGG GTGTGATCAT GGACGTAATG ATGTTCTTTT GTTTTCTACT CGCGACGCAT GCTTTTAGAA GAAATGTCAT  AAATTTACCA TGGCCGTTTA ATAATTTAGC CGGTTTTACC TCCTTTTGGT ATGCCCATCA TCTTCTGATT ATCGTTTACA TCTTGTTGAT CCTGCATGGG TACTTCCTCG TGTTCGCCAC  TTTTTGGTAC ATGAAAACAA CATGGATGTA TCTTGTGCTC CCAATGTTGT GTTATGCAAG TGAGAGAGTG TTTACAGCCT CTGACCATAA CCATCGGGTT AATATCGTTA AGGCTATCAT  ATACACTGGA AATGTCCTAG CTCTCTATAT GAGCAAACCT AATGGATTCA AGTACAGGAG CGGGATGTAC CTTTTTGTTA AATGTCCAAA TATATCAGGT TTCGAATGGC ATCCTTTCTC  CATAACTTCT GCACCTGGAG ATGATTACTT AAGTGTACAT ATTCGAACTT TAGGAGACTG GACAACAGCC CTTAAAAACG AATTTGCAAA GGCTTGTGAG CCTCCACCAC AGAAACCTCA  AATTGGTGCT TCTGCTTCAA GAGCTGTAAA AGGAAACCTT GTTCGATTAG AAACCAAAGC AAACGTTAAT GTTTCTGTAG AAGAAGCGCA AGCAATATAC CCTACAATAA TCATCAAAGG  ACCATATGGA GCTCCGGCTC AAGATTACAG AAAATATGAC ATCCTATTAC TTATTGGTTT GGGTATTGGA GCAACCCCCT TCATTAGCAT TTTGAAAGAT CTCTTAAACC ACCAAAGGGA  AGCAGCGTAT GATGGAAAAG TTCCGGAACG CGCCTACTTC TATTGGGTGA CAAGGGAACA AGGATCATTT GAGTGGTTCA AAGGTGTTAT GGATGATATT GCTGAGTATG ACAAAGAGCA  CATAATCGAA ATGCATACCT ACTTGACATG TGTTCATGAA GAAGGTGATG CACGATCTGC GCTCATTGCC ATGGTGCAGT CTCTACAACA TGCCAAAAAC GGGGTGGATG TTGTCTCCCA  AAGTCGTATA AGAACACATT TTTCAAGACC TAACTGGAAG AGGGTATTCT CCACTTTGGC AACCAACCAT GATTCTGCTA GAATTGGTGT GTTCTATTGT GGGAGCCAAA CGCTCGTCAA  ATCACTAGAA AGTATTGCCA AAGAATTTTC CGTAGAAACT TCAACTCGCT TTGAATTCCA CAAAGAGAAC TTCTAATAAT CCAATGTACT TAAAAAGTTT TGGTTACGAG AAATCAACTT  GTACATCTAG AAGTCCTTGG TTAGGGTTTG GAATCTTGAT TGAAGTTCCA ACGCTTGTGA TATCGGGCGT GTTTGTATGT TCGTATTTAT GATCATCTGC AATAGGAATA CCTAGTGTTG  ATAGAAAAGG ATAGTTTTAA TTCATACTTT TATTGATATC GTTTTAGTGA AACGCAAAAC GGGTTTGGGT TTGTTTTAGT TAATAGTTAA TTGGTCAAGA CTTATATTAT GTTTATTATT 
AATAAAACTC TATGTGGATC GAT 

Retrieve as FASTA