Entry information : HaRboh11 (HanXRQChr10g0315961)
Entry ID 13788
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh11 (HanXRQChr10g0315961)
Name (synonym) HaRboh11 (HanXRQChr10g0315961)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh11
start..stop
S start..stop
HaRboh04 1709 0 13..913 26..930
HaRboh01 1547 0 8..913 10..917
HaRboh10 1510 0 11..913 26..928
NbRboh02 1477 0 13..913 17..939
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 233456501..233457074 574 N° 2 233457462..233457624 163 N° 3 233457737..233457785 49 N° 4 233458084..233458197 114
N° 5 233458328..233458750 423 N° 6 233458836..233459219 384 N° 7 233459303..233459398 96 N° 8 233459615..233459730 116
N° 9 233459813..233459915 103 N° 10 233460300..233460364 65 N° 11 233460463..233461007 545 N° 12 233461188..233461297 110
join(233456501..233457074,233457462..233457624,233457737..233457785,233458084..2 33458197,233458328..233458750,233458836..233459219,233459303..233459398,23345961 5..233459730,233459813..233459915,233460300..233460364,233460463..233461007,2334 61188..233461297)


exon

Literature and cross-references HaRboh11 (HanXRQChr10g0315961)
DNA ref. HanXRQ genome:   HanXRQChr10 (233456501..233461297)
Cluster/Prediction ref. HanXRQ:   HanXRQChr10g0315961
Protein sequence: HaRboh11 (HanXRQChr10g0315961)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   913
PWM (Da):   %s   102374.33 Transmb domain:   %s   o355-377i496-518o538-560i718-735o
PI (pH):   %s   9.16
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRKTSTDDVSHPDTELYGADRKSFSGPLNKRTTRKSARFNLPEDGGSNSSGSLRSRNNDDYVEITLDVGDDSVAVHSVKTAGGADVEDPELSLLAKGLEKRTSLTTSVVRNASSRIRQVSEELRKLTSFSRRPQVGNYDRSKSAATHALKGLKFISKTDGAAAWAALEKRFDDLTAGTTGLLPRSLFGECIGMNKDSNDFAGELFDALSRRRNYTGDMINKAQLKEFWDQIADQSFDSRLQTFFDMVDKDADGRISEEEVRIISLSASANKLSNIQKQADEYAALIMEELDPDNLGYIMIENLEALLLQSPTQTVRGESKNLSVMLSQKLRNADDRNIIQRGYDRFKYFLDDNWQRVWVLALWIGAMGGLFTWKYIQYKNRAAFDVMGHCVCVAKGGAEILKLNMALILLPVCRNTITWLRNKTKLGVVVPFDDNLNFHKVIAVGIVVGVTLHGIAHLTCDFPRLLRATEEEYEPMVQYFGEQPDSYWHFVKEPVGYTGIIMVVLMAIAFTLATPWLRRGRLNLPKPLNKLTGFNAFWYSHHLFIIVYAMLIVHGIKIYLTKEWYKKTTWMYIAIPILLYAGERLLRALRSTVKPVQMLKVAVYPGNVLALHMSKPQGFKYKSGQYMFVNCKAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRQLKTVFSVCQPPANGKSGLLRADYQGDNPFPKVLIDGPYGAPAQDYKKYDVVLLVGLGIGATPMISIVKDIVNNMKAKQEADEALESGGNSAMPPASPLAKKNTSNNFNTTRAYFYWVTREQGSFDWFKGVMNEVAETDHNGVIEMHNYCTSVYEEGDARSALITMLQSLNHAKNGVDVVSGTRVKSHFAKPNWRSVYKRIALTHTGQRGVFYCGAPAPVKELKQLASDFSHKTSTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAAAACAAGTACGGATGACGTCAGCCACCCAGACACAGAACTGTACGGAGCCGACAGGAAATCATTCAGCGGACCGTTAAACAAACGAACAACCCGAAAAAGCGCGCGGTTTAAC
CTCCCAGAAGACGGCGGAAGCAACAGCAGCGGAAGTCTACGCTCCAGAAACAACGATGATTACGTGGAAATTACGTTAGATGTCGGCGACGATTCTGTTGCCGTACATTCTGTAAAGACT
GCTGGCGGCGCTGACGTGGAGGATCCTGAATTGTCGTTGTTGGCTAAAGGGTTGGAGAAGAGGACGTCTTTAACGACATCGGTGGTGCGAAATGCTTCGTCGAGGATTCGGCAGGTGTCC
GAGGAGCTGAGGAAGTTAACATCGTTTTCGCGGCGGCCACAGGTCGGGAATTATGACCGGTCGAAGTCCGCCGCGACTCACGCGCTTAAAGGGTTGAAGTTTATTAGTAAAACTGATGGC
GCGGCTGCGTGGGCCGCGTTAGAGAAGAGGTTTGATGACCTGACCGCTGGCACCACCGGTTTGCTTCCCCGATCACTGTTCGGAGAATGTATAG
GTAAGTTTATGGTTTGGTCGATATTG
ATTTGCTTTTTTATTTGGTTTAGTTTTTTAACGAGTGGGTACCGGTTAAAGCTTCGCCCATGGATATCAGTTCGGTTTGTTACAGTATGTCACTCGCTAGCAAAGTACTTAAGGGAAAAT
CCAAAAAATAGAGTTGTGATATTCACACATGTTTGTATCAATAAAACCATAAAAATGAATACCAATAACGGTTTGATGATAATATTGGAACCAGTACCGATATTGTTCGGTCGGAACGTC
ACGGTACCGGTATGGTAGTGGCTTATGACGCTAGAAAAATACTTTATTTGGAATACAACTTCGTTGTGAACAAAACTTATACCATAATATTGTTCTTATTGTTTTTGTAAAATTCTTGCA
GGGATGAACAAGGATTCGAACGACTTTGCGGGAGAATTGTTTGATGCACTTAGCCGGAGGCGGAATTACACCGGTGACATGATTAACAAGGCTCAGTTGAAGGAGTTTTGGGACCAAATT
GCTGATCAAAGTTTTGATTCAAGGCTTCAAACTTTCTTTGACAT
GTAAGATTTGATTATGTTTATTTATGACGATTTGACTGATTCATTAAGTGTTTCATTGAATTTGAATTGTTGGTAT
GAGAACACTTTGACTGATTCAAGAATATTAATTCAGGGTTGATAAGGACGCTGATGGTCGGATTAGTGAAGAAGAAGTTCGAGAGGTATGCTATAATTAGTATCTAACTCGTTTGCTTGT
GTTTATCTGGTCGGCCCTCGGTCCAACTGGTTAAACCGAGAACCATAGGTGCAAGTGGTTCGGGTGCAAGTGGTTCGGCTGCAAGCTATTGGACCGCGAGCCAACCAGACCAGTTGAACC
GGTGGATTGAGTTTGTGAGTTAGTTTGGTTCTAATTAATTATAAAGTAGTTGCATGTAGCATTAAATGAAAGTGTTTTTAGATCATTATGTTAATGATGAGTTTCAAGTCATATCTAACA
CGCTAATTATTTATGTTGTTCAGATTATAAGCTTGAGTGCTTCGGCTAACAAGTTATCGAACATTCAAAAACAAGCAGATGAATACGCGGCATTGATCATGGAAGAATTGGACCCGGACA
ATCTCGGTTACATCATG
GTATACTATCTTACATATTTTGTTTCAACAACATTTGACACAGTTCTTTACTGTCACGTTCAATACATATCTACAAGTGCGTTTCTATCGACAGTAGTTTCTA
ATATACAAATTTTCTTCTAATTTCCAGATCGAAAACTTGGAGGCATTGTTATTGCAATCCCCGACACAAACTGTGAGAGGCGAAAGCAAGAACTTGAGCGTGATGTTGAGCCAAAAGCTT
AGAAACGCCGATGACAGAAACATAATACAACGAGGGTACGATAGATTCAAGTACTTTCTAGACGATAACTGGCAAAGAGTTTGGGTGCTTGCACTTTGGATCGGGGCGATGGGGGGTTTG
TTTACTTGGAAATATATTCAGTACAAGAATCGGGCCGCATTTGATGTAATGGGCCATTGTGTTTGTGTGGCTAAAGGTGGAGCCGAGATTCTCAAGTTAAACATGGCTCTAATCTTATTA
CCCGTGTGTCGAAACACCATCACATGGCTTAGAAACAAGACCAAGCTCGGTGTCGTGGTTCCTTTTGATGATAATCTCAATTTCCACAAA
GTGAGTATCGCGGTCCTTAACGTTTGGTTT
TCTGTACCCCGTTAACGTTCAAACATTTTGCACTAAACTTTTTTGTGCATATTAGGTGATTGCGGTTGGGATCGTGGTTGGGGTCACGCTCCATGGAATTGCACATTTAACGTGTGATTT
CCCGCGACTGTTAAGAGCTACCGAAGAGGAATACGAGCCCATGGTTCAATATTTTGGAGAACAACCCGATAGCTATTGGCATTTTGTGAAGGAGCCCGTAGGGTATACCGGGATCATAAT
GGTGGTTTTGATGGCAATAGCCTTTACTTTAGCGACCCCGTGGCTAAGACGTGGTAGACTCAACCTACCAAAGCCGCTAAACAAGCTTACGGGCTTTAACGCCTTTTGGTACTCCCACCA
CCTGTTTATTATTGTTTACGCGATGCTTATAGTTCACGGGATCAAAATTTACCTCACGAAAGAATGGTACAAGAAGACG
GTGAGTACAAGCTTTAAAAGATATGTTGTGTGAATCTTTTG
GCGGTTATCGGGCTAACATTGTGTTTTCATTTGTAATGACAGACTTGGATGTACATCGCAATTCCAATTTTGCTTTACGCAGGCGAGAGATTACTCAGGGCGTTAAGATCTACTGTCAAG
CCCGTCCAGATGTTGAAG
GTAATAAAAACATGCGTGTACCGTACGGGTCAAAACGGGTAATGTTTTGGTACGGGTCAAGTTGGGTTAACCAAAAGTATTCTAAATTTATAAGTAAAATGA
TTTTGGAAATTTTATCGACTCGTTTGACTCTTAAGAGAAAACATAATCTAAATCGACACGTTTGTTATTAGTGTATTGGTGTTACGTTTTACTGATATGATTTGCGTATTGAAGGTGGCT
GTTTACCCCGGAAACGTGTTGGCGCTTCACATGTCAAAGCCTCAAGGATTCAAATACAAAAGCGGGCAATACATGTTCGTGAACTGCAAGGCGGTTTCTCCGTTTGAATG
GTGGGTCTTG
TGCATATTAACTGTTAAAAACACTAGTGTTTGTATCAAAAATGTTGTATAAACTAACTTAACTATGGTCCAGGCATCCGTTTTCAATAACTTCTGCACCCGGAGATGACTACCTAAGTGT
GCACATCAGAACACTCGGCGACTGGACCCGACAACTAAAAACCGTCTTCTCTCAG
GTACAGTTTCTTAGTTTGAAACTTTTAAGATGTTTTCATTCGTGACCGTTAAGGATCAAAACCGG
CCCAGAGAGTAATAGAATCAACCATGTTGGGAAAATGGACAGTTTGGGAAAATTGGGTTACGGGTCAAAATGGGTAACTTTTTTACGGGTCAAAAATATTGTTAAAAATGTTGTATAATT
TGGTAATAAAATAATTTTAGGGATAAAATGATTTTGTTAGTTGTATGTTTTTAAAAAAAATACTATGGGTGACTTTCTCTCTGTTAACCTGTTTCCTTTTTAGCTAGTTTATTTGATTTA
CGTGTTTGGCTTGTTAGCGATAAAATAACTCGTTTTTACCTGTTTTCTTTTTGGCTAACCTTATGTTTGTCGTGTTCAGGTATGTCAACCACCCGCTAATGGCAAAAGCGGACTCCTAAG
AGCCGATTACCAAGGAGACAACCC
GTAAGCTACCTCTTTTTCGTTTAACAACTTCTCGTTCTTAAAATGAAAAAATAAACCTGACCCGCTTTCTAATCTTCTTTTATCGAATATATCCAC
AGTTTCCCAAAGGTTCTAATCGACGGGCCATATGGTGCACCAGCACAAGACTACAAGAAATACGACGTCGTGTTGCTAGTGGGCTTAGGCATTGGTGCCACCCCAATGATCAGCATCGTT
AAGGACATCGTGAATAACATGAAAGCGAAACAGGAGGCAGACGAGGCCTTGGAAAGCGGTGGCAACAGCGCGATGCCGCCAGCATCACCGCTGGCGAAAAAGAACACCTCAAACAACTTC
AACACAACTCGGGCTTACTTCTATTGGGTAACTAGAGAACAAGGGTCGTTTGACTGGTTCAAAGGGGTCATGAATGAGGTTGCGGAAACAGATCATAACGGTGTGATCGAGATGCATAAT
TACTGCACAAGTGTTTATGAAGAAGGTGATGCTCGGTCAGCTTTGATCACCATGCTTCAGTCGCTAAATCATGCCAAAAATGGTGTTGATGTTGTTTCGGGTACTCGGGTCAAGTCGCAT
TTTGCAAAGCCCAACTGGAGAAGTGTTTATAAGCGTATCGCTCTTACTCACACCGGTCAACGTATTG
GTGAGTTTTCTTTTATTATTGTTATTTCATATATCGACCCGTTTACTTGTAAA
CAGGCCGTGCTATGACTTTTATCCCAAACGTGTCAAAAAAAATGAACTTTCTATACTAATCTTCATAAAATTATGTTTATTTTAAATAGTTATTTTTCTGATATTAGAATTTTTATTAAA
ATTACAGGGGTATTCTATTGTGGAGCACCTGCACCAGTCAAAGAGTTGAAACAACTTGCTTCAGACTTTTCGCACAAGACTAGCACCAAATTTGACTTTCACAAGGAGAACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAAAACAAGTACGGATGACGTCAGCCACCCAGACACAGAACTGTACGGAGCCGACAGGAAATCATTCAGCGGACCGTTAAACAAACGAACAACCCGAAAAAGCGCGCGGTTTAAC
CTCCCAGAAGACGGCGGAAGCAACAGCAGCGGAAGTCTACGCTCCAGAAACAACGATGATTACGTGGAAATTACGTTAGATGTCGGCGACGATTCTGTTGCCGTACATTCTGTAAAGACT
GCTGGCGGCGCTGACGTGGAGGATCCTGAATTGTCGTTGTTGGCTAAAGGGTTGGAGAAGAGGACGTCTTTAACGACATCGGTGGTGCGAAATGCTTCGTCGAGGATTCGGCAGGTGTCC
GAGGAGCTGAGGAAGTTAACATCGTTTTCGCGGCGGCCACAGGTCGGGAATTATGACCGGTCGAAGTCCGCCGCGACTCACGCGCTTAAAGGGTTGAAGTTTATTAGTAAAACTGATGGC
GCGGCTGCGTGGGCCGCGTTAGAGAAGAGGTTTGATGACCTGACCGCTGGCACCACCGGTTTGCTTCCCCGATCACTGTTCGGAGAATGTATAG
GGATGAACAAGGATTCGAACGACTTT
GCGGGAGAATTGTTTGATGCACTTAGCCGGAGGCGGAATTACACCGGTGACATGATTAACAAGGCTCAGTTGAAGGAGTTTTGGGACCAAATTGCTGATCAAAGTTTTGATTCAAGGCTT
CAAACTTTCTTTGACAT
GGTTGATAAGGACGCTGATGGTCGGATTAGTGAAGAAGAAGTTCGAGAGATTATAAGCTTGAGTGCTTCGGCTAACAAGTTATCGAACATTCAAAAACAAGCA
GATGAATACGCGGCATTGATCATGGAAGAATTGGACCCGGACAATCTCGGTTACATCATG
ATCGAAAACTTGGAGGCATTGTTATTGCAATCCCCGACACAAACTGTGAGAGGCGAAAGC
AAGAACTTGAGCGTGATGTTGAGCCAAAAGCTTAGAAACGCCGATGACAGAAACATAATACAACGAGGGTACGATAGATTCAAGTACTTTCTAGACGATAACTGGCAAAGAGTTTGGGTG
CTTGCACTTTGGATCGGGGCGATGGGGGGTTTGTTTACTTGGAAATATATTCAGTACAAGAATCGGGCCGCATTTGATGTAATGGGCCATTGTGTTTGTGTGGCTAAAGGTGGAGCCGAG
ATTCTCAAGTTAAACATGGCTCTAATCTTATTACCCGTGTGTCGAAACACCATCACATGGCTTAGAAACAAGACCAAGCTCGGTGTCGTGGTTCCTTTTGATGATAATCTCAATTTCCAC
AAA
GTGATTGCGGTTGGGATCGTGGTTGGGGTCACGCTCCATGGAATTGCACATTTAACGTGTGATTTCCCGCGACTGTTAAGAGCTACCGAAGAGGAATACGAGCCCATGGTTCAATAT
TTTGGAGAACAACCCGATAGCTATTGGCATTTTGTGAAGGAGCCCGTAGGGTATACCGGGATCATAATGGTGGTTTTGATGGCAATAGCCTTTACTTTAGCGACCCCGTGGCTAAGACGT
GGTAGACTCAACCTACCAAAGCCGCTAAACAAGCTTACGGGCTTTAACGCCTTTTGGTACTCCCACCACCTGTTTATTATTGTTTACGCGATGCTTATAGTTCACGGGATCAAAATTTAC
CTCACGAAAGAATGGTACAAGAAGACG
ACTTGGATGTACATCGCAATTCCAATTTTGCTTTACGCAGGCGAGAGATTACTCAGGGCGTTAAGATCTACTGTCAAGCCCGTCCAGATGTTG
AAG
GTGGCTGTTTACCCCGGAAACGTGTTGGCGCTTCACATGTCAAAGCCTCAAGGATTCAAATACAAAAGCGGGCAATACATGTTCGTGAACTGCAAGGCGGTTTCTCCGTTTGAATGG
CATCCGTTTTCAATAACTTCTGCACCCGGAGATGACTACCTAAGTGTGCACATCAGAACACTCGGCGACTGGACCCGACAACTAAAAACCGTCTTCTCTCAG
GTATGTCAACCACCCGCT
AATGGCAAAAGCGGACTCCTAAGAGCCGATTACCAAGGAGACAACCC
TTTCCCAAAGGTTCTAATCGACGGGCCATATGGTGCACCAGCACAAGACTACAAGAAATACGACGTCGTGTTG
CTAGTGGGCTTAGGCATTGGTGCCACCCCAATGATCAGCATCGTTAAGGACATCGTGAATAACATGAAAGCGAAACAGGAGGCAGACGAGGCCTTGGAAAGCGGTGGCAACAGCGCGATG
CCGCCAGCATCACCGCTGGCGAAAAAGAACACCTCAAACAACTTCAACACAACTCGGGCTTACTTCTATTGGGTAACTAGAGAACAAGGGTCGTTTGACTGGTTCAAAGGGGTCATGAAT
GAGGTTGCGGAAACAGATCATAACGGTGTGATCGAGATGCATAATTACTGCACAAGTGTTTATGAAGAAGGTGATGCTCGGTCAGCTTTGATCACCATGCTTCAGTCGCTAAATCATGCC
AAAAATGGTGTTGATGTTGTTTCGGGTACTCGGGTCAAGTCGCATTTTGCAAAGCCCAACTGGAGAAGTGTTTATAAGCGTATCGCTCTTACTCACACCGGTCAACGTATTG
GGGTATTC
TATTGTGGAGCACCTGCACCAGTCAAAGAGTTGAAACAACTTGCTTCAGACTTTTCGCACAAGACTAGCACCAAATTTGACTTTCACAAGGAGAACTTTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGCACACCG TTGACTTATT CTCCCACAAA CACACACCAA TAACTCGGAG CCTTCTTCCC TTCCCGAACA AAAAGACGAA ACAAGATAGA TACAGAAGCC TGTCTAAATG GACTGGTTTC  AACAACTCTT TTACCTTCCA AAAGCCATCC CTATTTCTTC CTTTATATAA ACTCTAATTC CAAACGCCAT CTTCATACAT AGATCCTCTC AAAAACTTCA TCCAGATCTC ACACAACCCA  AACTTCATCT AAACCAATTA TTATTAATAT AATTACTTCT TCATAACTTT GCTAGCTGTT TACAGTTGTT GGATATTTGT TTCTTCTTCA TAATTATCAT AACTTTGTAT ATTATTATTG  TTGGGTTCGA TACTTCTGGT TTTTCTATCT TCAAAACTTT TATAAATCCA CAAAATGAGA AAAACAAGTA CGGATGACGT CAGCCACCCA GACACAGAAC TGTACGGAGC CGACAGGAAA  TCATTCAGCG GACCGTTAAA CAAACGAACA ACCCGAAAAA GCGCGCGGTT TAACCTCCCA GAAGACGGCG GAAGCAACAG CAGCGGAAGT CTACGCTCCA GAAACAACGA TGATTACGTG  GAAATTACGT TAGATGTCGG CGACGATTCT GTTGCCGTAC ATTCTGTAAA GACTGCTGGC GGCGCTGACG TGGAGGATCC TGAATTGTCG TTGTTGGCTA AAGGGTTGGA GAAGAGGACG  TCTTTAACGA CATCGGTGGT GCGAAATGCT TCGTCGAGGA TTCGGCAGGT GTCCGAGGAG CTGAGGAAGT TAACATCGTT TTCGCGGCGG CCACAGGTCG GGAATTATGA CCGGTCGAAG  TCCGCCGCGA CTCACGCGCT TAAAGGGTTG AAGTTTATTA GTAAAACTGA TGGCGCGGCT GCGTGGGCCG CGTTAGAGAA GAGGTTTGAT GACCTGACCG CTGGCACCAC CGGTTTGCTT  CCCCGATCAC TGTTCGGAGA ATGTATAGGG ATGAACAAGG ATTCGAACGA CTTTGCGGGA GAATTGTTTG ATGCACTTAG CCGGAGGCGG AATTACACCG GTGACATGAT TAACAAGGCT  CAGTTGAAGG AGTTTTGGGA CCAAATTGCT GATCAAAGTT TTGATTCAAG GCTTCAAACT TTCTTTGACA TGGTTGATAA GGACGCTGAT GGTCGGATTA GTGAAGAAGA AGTTCGAGAG  ATTATAAGCT TGAGTGCTTC GGCTAACAAG TTATCGAACA TTCAAAAACA AGCAGATGAA TACGCGGCAT TGATCATGGA AGAATTGGAC CCGGACAATC TCGGTTACAT CATGATCGAA  AACTTGGAGG CATTGTTATT GCAATCCCCG ACACAAACTG TGAGAGGCGA AAGCAAGAAC TTGAGCGTGA TGTTGAGCCA AAAGCTTAGA AACGCCGATG ACAGAAACAT AATACAACGA  GGGTACGATA GATTCAAGTA CTTTCTAGAC GATAACTGGC AAAGAGTTTG GGTGCTTGCA CTTTGGATCG GGGCGATGGG GGGTTTGTTT ACTTGGAAAT ATATTCAGTA CAAGAATCGG  GCCGCATTTG ATGTAATGGG CCATTGTGTT TGTGTGGCTA AAGGTGGAGC CGAGATTCTC AAGTTAAACA TGGCTCTAAT CTTATTACCC GTGTGTCGAA ACACCATCAC ATGGCTTAGA  AACAAGACCA AGCTCGGTGT CGTGGTTCCT TTTGATGATA ATCTCAATTT CCACAAAGTG ATTGCGGTTG GGATCGTGGT TGGGGTCACG CTCCATGGAA TTGCACATTT AACGTGTGAT  TTCCCGCGAC TGTTAAGAGC TACCGAAGAG GAATACGAGC CCATGGTTCA ATATTTTGGA GAACAACCCG ATAGCTATTG GCATTTTGTG AAGGAGCCCG TAGGGTATAC CGGGATCATA  ATGGTGGTTT TGATGGCAAT AGCCTTTACT TTAGCGACCC CGTGGCTAAG ACGTGGTAGA CTCAACCTAC CAAAGCCGCT AAACAAGCTT ACGGGCTTTA ACGCCTTTTG GTACTCCCAC  CACCTGTTTA TTATTGTTTA CGCGATGCTT ATAGTTCACG GGATCAAAAT TTACCTCACG AAAGAATGGT ACAAGAAGAC GACTTGGATG TACATCGCAA TTCCAATTTT GCTTTACGCA  GGCGAGAGAT TACTCAGGGC GTTAAGATCT ACTGTCAAGC CCGTCCAGAT GTTGAAGGTG GCTGTTTACC CCGGAAACGT GTTGGCGCTT CACATGTCAA AGCCTCAAGG ATTCAAATAC  AAAAGCGGGC AATACATGTT CGTGAACTGC AAGGCGGTTT CTCCGTTTGA ATGGCATCCG TTTTCAATAA CTTCTGCACC CGGAGATGAC TACCTAAGTG TGCACATCAG AACACTCGGC  GACTGGACCC GACAACTAAA AACCGTCTTC TCTCAGGTAT GTCAACCACC CGCTAATGGC AAAAGCGGAC TCCTAAGAGC CGATTACCAA GGAGACAACC CTTTCCCAAA GGTTCTAATC  GACGGGCCAT ATGGTGCACC AGCACAAGAC TACAAGAAAT ACGACGTCGT GTTGCTAGTG GGCTTAGGCA TTGGTGCCAC CCCAATGATC AGCATCGTTA AGGACATCGT GAATAACATG  AAAGCGAAAC AGGAGGCAGA CGAGGCCTTG GAAAGCGGTG GCAACAGCGC GATGCCGCCA GCATCACCGC TGGCGAAAAA GAACACCTCA AACAACTTCA ACACAACTCG GGCTTACTTC  TATTGGGTAA CTAGAGAACA AGGGTCGTTT GACTGGTTCA AAGGGGTCAT GAATGAGGTT GCGGAAACAG ATCATAACGG TGTGATCGAG ATGCATAATT ACTGCACAAG TGTTTATGAA  GAAGGTGATG CTCGGTCAGC TTTGATCACC ATGCTTCAGT CGCTAAATCA TGCCAAAAAT GGTGTTGATG TTGTTTCGGG TACTCGGGTC AAGTCGCATT TTGCAAAGCC CAACTGGAGA  AGTGTTTATA AGCGTATCGC TCTTACTCAC ACCGGTCAAC GTATTGGGGT ATTCTATTGT GGAGCACCTG CACCAGTCAA AGAGTTGAAA CAACTTGCTT CAGACTTTTC GCACAAGACT  AGCACCAAAT TTGACTTTCA CAAGGAGAAC TTTTGACCTC AAAAAGAAAA GTCAAATGAA CTTTTATAGA AATTTTGTAT ATCATCCAAT ACTAAGGCAT TTTAATTTTT TTATTGTATA  TTTTTATTTA GATAAAAGAT TCTTTGTACG TTTATAAATC TGTATAATAA ATATGTTAAT CATTATCAAT TATTTTTTTC TAATAATATG TGACGTTCTA GAGTTGGTGA GGTCGTTTTC  AAGATCGAAA ATGATTGAAC TTTAAATTGC TATTGTATGG GTATAATTCC TTTTTTGGTA GATGAATACA TTGATTTTCT AATATATATT TATTTGTGTA AATGCAAAAT TCAATGCTTG  TTATACTTGA TTTATATCTA CATATTTTAT GCCGATATTG CTTACTTTAT CCTTGTAGTA AGTATCGTAT ACAATCTATA GGGTACATAC ACTTTCATAC AAAGCCATAT AAAGGCATAT  ATCAACAATT CTTGCACCCC CGTATGATCA TGTTAAAATA ACAATTCAAC ATTAATCTGT CATATCTTTT GTATATTATT TTATTTCTTA CTTGATATGT TTATATTTTT CATGGGCCTG  TGAGGTGAGT GCTGTTGGGC TAATGATGAA GTGCTGGATG GGCTTATTAA AGAAGATGTG TGGGCTTATA GATGTTGTTG GAGCATGTGG GCCTATGTCT TGAAGCCAGT GTTATATACA  CAAAAGATAA GCACTCTCTT CAATCTCTCT CTCAGTTCTA TTATTGCTCT TCATTCTCTC TCTACGAACG CTCTATACTT AGGGTTTCTT GTTTGTGAGT TGCGGGATTT GGGGATCATT  CTGATCATCT TTTAGAGCAG ATTATCACGT TGATGATCTG CGTAGGTTGA GAGTTTCTGT TTCTTGTAGA ATTTGGTGAT TCTTAGTCGG TAATCTGTGC TGACTGATTC TTGTATTTGA  TCGGTAAAAT ATATGCCAAC TAGTGCTATA ATATAGTGAT TTTTGTTCTT GATATTGTGT TTGTGACATG GTAGTGCTCT TGGGGTTATC TTCTTCCGTT GTGGTTTTCT AGGGTTTGAT  CTGCCAGATC TGGTTAGATC TAAGTTGATT GTTGGCGATC TTAGGAGTCT TGGTGGTTCT GTGCTTCTGC CGATTCCATA TTGTGTGCTT CTCGCTTTCT TGGAGTTTGT GCTCGGCAAG  AAGACTGAAA CCCTAATTTC TAGGGTTTCT TGTATTTCAA AAAGGGTTCT TGTTGGTCTC TATTGAAGGG CAAACCAATA GAACTTGATT ATTTGTCTTC TTATCTGGTG CTTGTCTAAA 
TGAAGGTTAC AAGTCTGATT TGCTGGAGTT A 

Retrieve as FASTA