Entry information : GmarCIIBB01
Entry ID 13809
Creation 2016-06-24 (Catherine Mathe)
Last sequence changes 2016-06-24 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: GmarCIIBB01
Name GmarCIIBB01
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBB01
start..stop
S start..stop
GmarCIIBB02 665 0 1..355 1..355
HsubCIIBB08 533 0 7..354 10..360
HsubCIIBB06 533 0 15..354 19..361
GmarCIIBB06 531 0 1..352 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 727510..727558 49 N° 2 727333..727460 128 N° 3 727229..727284 56 N° 4 727037..727177 141
N° 5 726742..726987 246 N° 6 726656..726690 35 N° 7 726561..726606 46 N° 8 726434..726503 70
N° 9 726328..726373 46 N° 10 726192..726268 77 N° 11 726042..726137 96 N° 12 725925..725989 65
N° 13 725861..725873 13  
complement(join(725861..725873,725925..725989,726042..726137,726192..726268,7263 28..726373,726434..726503,726561..726606,726656..726690,726742..726987,727037..7 27177,727229..727284,727333..727460,727510..727558))


exon

Literature and cross-references GmarCIIBB01
DNA ref. JGI genome:   scaffold_20 (727558..725861)
Protein sequence: GmarCIIBB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (338)
PWM (Da):   %s   37256.77 (35274.6)  
PI (pH):   %s   4.31 (4.20) Peptide Signal:   %s   cut: 18 range:18-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFRKALILALPLFVNGLRTKRATCPDGVNTAINAQCCSLFPVVQDLVDNFFTNECGDAHGALRLLFHDAIGIGSTGGGGADGSIAVFNETELTFHANLGIDDILDEIGPFMQAHSDVLTPGDFIQLAGAVSLVQCPGAPRIQFLMGRAPPKAASPPNLVPEPFDSVQSILNRFVPLGLTLEETVAVIGGSHSVAGADDVIPELEGVPFDQTPSVFTQIFVDVQLRGTMFTGQGGNQGEVESAVAGLVRLQSDHLARDSATNCAWQSFANNQQRIQTLFASGVQKLALLGQNPSMIDCSEVIPSAIAFHGSATLPPGQTMNDIEQACATASFPILPTQPGPPTTVPAIPQV

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAGAAAGGCACTCATCCTCGCACTTCCTCTCTTTGTCAATGGTTTGTAACCTAGAACCCAGTCGTTATTACGTGCTCATACATTTCGTAGGACTAAGGACGAAGCGGGCTAC
ATGCCCGGATGGTGTCAACACTGCAATCAACGCGCAGTGCTGCTCATTGTTCCCCGTCGTCCAAGATTTAGTAGACAACTTTTTCACCAACGAGTGTGGTGATTCG
GTTAGTCATTGTTT
GTAATTTTACCTGGAGATTCTAACGTACTCGTAGGCTCATGGTGCTCTTCGTCTCCTGTTCCACGACGCTATTGGGATTGGTTCAACAGGGTGTGTACCCTTGAGTTTACCTGTCGCCCA
TACTCACCGTTAAATAAACAGCGGTGGAGGAGCGGACGGTTCTATCGCCGTTTTCAACGAAACCGAGCTGACCTTCCACGCCAACCTCGGAATTGATGATATCCTCGACGAAATAGGCCC
ATTCATGCAAGCACACTCCGATGTCTTAACTCCGGGAGACTT
GTAGGTGTGACTATCTTTCAGGTGCCGATTTTCACCAACGGTCGTGTAGCATCCAACTTGCCGGTGCCGTCAGCCTCG
TTCAATGCCCGGGTGCACCCCGTATACAATTCCTTATGGGACGCGCCCCACCTAAGGCTGCATCACCGCCCAATCTCGTTCCTGAACCATTCGACAGTGTCCAGAGCATTCTCAATCGCT
TCGTACCCCTCGGACTCACATTGGAAGAGACCGTAGCCGTGATCGGCGGTTCTCACAGTGTCGCTGGCGCCGACGACGTTATCCCAGAACTCGAGGG
GTACGCTTTATATTCTTTTGAAA
CAAAAAACGTTGCTCACCGCGTCTGAAGAGTGCCATTCGATCAAACCCCATCTGTCTTCGACAGTAAGTCTTCATTAAACTATATAAATTTGAAATGTTCAATCGTCCACAGCCCAAATC
TTCGTCGACGTGCAACTGCGCGGCACGATGTTTACTGG
GTACGCAAATTGGTTGACTTGGTACAAAGGTTTGGCTCACCCACTGTGACAATATAGACAAGGAGGCAATCAAGGAGAGGTT
GAGTCAGCTGTCGCCGGTCTTGTGCGACTGCAATCTGACCATCTT
GTAAGCCAGTCAAGGTGTAATAATGAATCTTTACACCAAGTAACATTTCTAATTCCGCAGCTCGCTCGTGATTCG
GCAACTAACTGTGCATGGCAATCATTCGCCA
GTAAGTGACCGTTTTAATCTATTGGCCAAATCTTCGATTCTTATACGAACTGTGTGAAGACAATCAACAAAGGATTCAGACACTCTTTG
CGTCGGGTGTCCAGAAGCTTGCACTCTTGGGCCAGAACCCATCGAAG
GTTAGTGCCTCAGACATACCGCTGCATCGTACCAAAGATACTAACATTGCATAGATGATCGACTGTAGTGAAG
TCATTCCTTCAGCTATTGCGTTCCATGGATCAGCCACACTCCCACCGGGCCAGACAATGAATGATATCGAGCAAGCT
GTGAGTTTGCCTGAACGTAGTCGCCGAACACAGTGAATAACTC
TCGAATTAGTGCGCCACAGCCTCATTCCCTATCTTGCCGACTCAGCCAGGCCCGCCTACCACGGTTCCCGCTATGTACGCGATTTTCAAAGTCTCACGAGCTTCCTTACTGATGCATCCT
TCCAGTCCCCAGGTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAGAAAGGCACTCATCCTCGCACTTCCTCTCTTTGTCAATGGACTAAGGACGAAGCGGGCTACATGCCCGGATGGTGTCAACACTGCAATCAACGCGCAGTGCTGCTCATTG
TTCCCCGTCGTCCAAGATTTAGTAGACAACTTTTTCACCAACGAGTGTGGTGATTCG
GCTCATGGTGCTCTTCGTCTCCTGTTCCACGACGCTATTGGGATTGGTTCAACAGGCGGTGGA
GGAGCGGACGGTTCTATCGCCGTTTTCAACGAAACCGAGCTGACCTTCCACGCCAACCTCGGAATTGATGATATCCTCGACGAAATAGGCCCATTCATGCAAGCACACTCCGATGTCTTA
ACTCCGGGAGACTT
CATCCAACTTGCCGGTGCCGTCAGCCTCGTTCAATGCCCGGGTGCACCCCGTATACAATTCCTTATGGGACGCGCCCCACCTAAGGCTGCATCACCGCCCAATCTC
GTTCCTGAACCATTCGACAGTGTCCAGAGCATTCTCAATCGCTTCGTACCCCTCGGACTCACATTGGAAGAGACCGTAGCCGTGATCGGCGGTTCTCACAGTGTCGCTGGCGCCGACGAC
GTTATCCCAGAACTCGAGGG
AGTGCCATTCGATCAAACCCCATCTGTCTTCGACACCCAAATCTTCGTCGACGTGCAACTGCGCGGCACGATGTTTACTGGACAAGGAGGCAATCAAGGA
GAGGTTGAGTCAGCTGTCGCCGGTCTTGTGCGACTGCAATCTGACCATCTT
CTCGCTCGTGATTCGGCAACTAACTGTGCATGGCAATCATTCGCCAACAATCAACAAAGGATTCAGACA
CTCTTTGCGTCGGGTGTCCAGAAGCTTGCACTCTTGGGCCAGAACCCATCGAAG
ATGATCGACTGTAGTGAAGTCATTCCTTCAGCTATTGCGTTCCATGGATCAGCCACACTCCCACCG
GGCCAGACAATGAATGATATCGAGCAAGCT
TGCGCCACAGCCTCATTCCCTATCTTGCCGACTCAGCCAGGCCCGCCTACCACGGTTCCCGCTATTCCCCAGGTATAG

Retrieve as FASTA