Entry information : PretPxd01
Entry ID 13813
Creation 2016-06-27 (Harold Duruflé)
Last sequence changes 2016-06-27 (Harold Duruflé)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-06-27 (Harold Duruflé)
Peroxidase information: PretPxd01
Name PretPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Chordata Actinopterygii Poeciliidae Poecilia
Organism Poecilia reticulata (guppy)    [TaxId: 8081 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PretPxd01
start..stop
S start..stop
OlaPxd01 2052 0 76..1497 68..1470
OlaPxd01 858 0 2..536 66..601
GacPxd01 2033 0 277..1496 211..1434
GacPxd01 875 0 3..536 33..566
TrubPxd01 2017 0 74..1511 63..1479
TrubPxd01 857 0 3..546 64..606
DrPxd01 1957 0 277..1497 241..1464
DrPxd01 861 0 3..547 63..607
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..5 5 N° 2 2761..2832 72 N° 3 4955..5026 72 N° 4 9792..9863 72
N° 5 12704..12775 72 N° 6 13432..13503 72 N° 7 15808..15977 170 N° 8 18752..18869 118
N° 9 20551..20720 170 N° 10 22078..22350 273 N° 11 22733..23008 276 N° 12 25856..26131 276
N° 13 26469..26581 113 N° 14 27068..27224 157 N° 15 27414..27522 109 N° 16 30072..30229 158
N° 17 31367..32373 1007 N° 18 32506..33002 497 N° 19 33843..33977 135 N° 20 34082..34290 209
N° 21 35304..35415 112 N° 22 35533..35665 133 N° 23 36542..36655 114 N° 24 37860..38003 144
join(1..5,2761..2832,4955..5026,9792..9863,12704..12775,13432..13503,15808..1597 7,18752..18869,20551..20720,22078..22350,22733..23008,25856..26131,26469..26581, 27068..27224,27414..27522,30072..30229,31367..32373,32506..33002,33843..33977,34 082..34290,35304..35415,35533..35665,36542..36655,37860..38003)


exon

Literature and cross-references PretPxd01
Cluster/Prediction ref. Genebank:   103458721
Protein sequence: PretPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1511
PWM (Da):   %s   169461.58  
PI (pH):   %s   6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRDLRFNKIKDLQPGSFRRLTNLNTLLLNNNHIRRIPRGAFEDLENLKYLYLYKNEIQSIDRQAFKGLVSLEQLYLHFNSIDSLEPESFSHLPKLERLFLHNNRITQLIPGTFAHLQSMKRLRLDSNALSCDCELLWLADLLKQYAESGNAQAAATCEHPSRLQGRSVATLTAEELNEVPRITSEPRDVDVTSGNTVYFTCRAEGNPKPQIIWLRNNNALNMRDDNRLNLLEDGTLMIQDTRETDQGVYQCMAKNVAGEVKTSEVTLRYFGASRPSFVIQPQNTEVLVGESVTLECSATGQPQPRVTWTKGDRTPLPSDTRINITPSGGLYIQNVVREDGGLYTCFASNNVDTIHATARIIVQATPQFTVTPQDQSVLEGNTVDIPCEASGYPEPVIVWTRGGNVLPSDRRHAILPAGTLRITRVATQDEGQYECEAVSPVGTVRATVQLSIEQRATPQFTVTPQDQSVLEGHTVDFPCEASGYPTPLIIWTRGGSPLPSDRRHVILASGTLRITRVAAHDEGQYECEAVSTVGTVRTAVQLIIEQRVTPVFTNAPRDLTVESGQDVQIPCSARGQPRPVLTWNDGVQITESGKFHIREEGYLEVKDVGTADAGRYECVARNPIGYQAARMVLTVTVPAISREGDTFVSTSIEQAIRTVDSAIESTRRRLFDGQPRTPGELLALFRYPRDPYTVEQARAGEIFEQTLLLIQNHVNQGLMVDTNGAFRYNDLVSPRFLEMIANLSGCTAHRRNNNCSDICFHQKYRSHDGTCNNLQHPMWGASLTAFERLLKPVYDNGFNLPRGTIDRVHNGYRLPLPRLVSTTMIETETITPDSRYTHMLMQWGQFLDHDLDSTVVALSQARFSDGQLCAQVCTNDPPCFPIQFPPNDQRQLRSGARCMFFVRSSPVCGSGMTSLLMNSVYPREQINQITSYIDASNVYGSSRHESEQIRDMASHRGLLRQGIIQRTGKALLPFATGPPTECMRDENESPIPCFLAGDHRANEQLALTSMHTVWFREHNRIATELLRLNPHWDGDTIYHETRKIVGAQMQHITYNHWLPILGEAGMRILGPYAGYDPNVNAGIFNSFATAAFRFGHTLINPILYRLNEHFEPITQGHISLHRAFFSPFRIVNEGGIDPLLRGLFGVAGKMRVSSQLLNTELTEKLFSMAHAVALDLAAMNVQRGRDHGIPPYNDYRTFCNLTSAQTFDDLKNEIKNPDVREKLRRLYGTPLNIDLFPALMAEDLVPGSRLGPTLMCLLATQFKRVRDGDRFWYENPGVFAPAQLTQLKQASLARVVCDNGDNITRVQRDVFAVADLPHGYGSCDDVPQIDLRMWQDCCDCRTKGQFNALSYHFRGRRSAEHSYQEEKPDSSIQDTSPLEETQNSLSNVTLSSKLSSEPSAGDFQEFVSDMQKTITSLRKIKKLEARLHKSTCADGEGRERTDGERWRKDSCSTCECRDAQVTCFIESCPTAECKQPIKLKGACCPMCLQEDDDNKRQKADTHHK*

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTATCTGTTG ACAATGTATT CATGGATGTA TGGATGGATG AATAGTTTGA GTATTCTGAT TAGCAAAAGG TCAAGATCCT TGCTCATCAC CCCTCTATTT TTTGACATGG TGGATCATCC  TTTTGATCAG TCACTCCATT ATGAGGGGAA TTTGGCAGAT TCTCAGTTGC TGAAAGTAGG TCTTCCACTT CAACAGTTTA CATTACTACA GCACAACTCT CTGAATCGGC TGCTGCTGCC  AGCTTAGGGG TTCACTGGGT TCTGCGGATC TACGGACTTC TTACTGTTGT GCTGTTGGTC AAGCCTTATG AGGAATCACT TACTTCAGTC TGTAACCATT ACATCATTTG AGCTGGAAGT  GATTACACAC AATATAATCC TTTATTTATA CAGGAAAATC TCTTGAGACT TGTCATATTT ACAAGAGAGA CCTGAGAGAG AGACAAGACA GCCATGGCAA CAACATAAAA ACCATAGGTA  AATTCATAAA CTCTTTACAA GAAATAGTGA CAGTGTCATT TTGGCAACTT TTGAATTTCT ATTGGGTGAT TACCATTCTC GTTTAACACT AGAAAAACTT CATGTAACTC CTGGTCCATC  TCTTAAAGCC ACGTCTTCAT AGACAGGTCA TTTTTTCTTC ACGTAAGATC TTAAACAAAA CCAAAAGCAG TGTCATACTC TTTGGCTACG TTTACACGAG ATCGCTGCCT GGAAATTGCT  GGTATTTTCA GATGATGACA CCTTGAGTCA GCTTTGGTTG TCATGCCAGG CCGCTATATG GTGCTGTGAC TTTAATATGT TGTCAAACAC ACATGCGCTT TTAACCCTTA GCTTAGACCT  CACTAGCTTC CACCTCATGG TAAACAGTAA CCCATCTCCA TCGTCGATGA ACGAAGTGCT CAGTGTGAAA CAAAAAAGAA AAATCAGCTG GATCACAACA AAAATGTTGC AGTTTATTAA  TTGAGGAGCA GCTCTGTGTA AACAGGGCTT TTGTGTATCT GTTTGGTGTA AAAGCAAGTT TATTGGGGCA GTAGTCAGAT TACTAATCAG CTGTATACAC TTGGCTTGAG AATAAGCTGA  TTAACATCAT AAAGTTTGGT CATTTTCTAC TGTCATGTAT TAGTGTAGCA TCTTCCATCA AAAGATTGTT GATTTTGAAC ATTTTAACAG AATTTTAGGT TTCTCAACAC AGGTCATCAG  GAACCTCAGC TGTTTAGATG TGTGCCTGCT CCAGCACATC TGAATCAAAT GGCTGATTTA CATCCTTAAT ATGTCATAAA GTTTGCGAGT AAATTAATGG ATCATGTTTA ATGATCCATT  AATTGTAAAA CAAGTAAGGC ATTAGGCCTT GGGGAATAAC TTTAGGAGAC AGTGGTTTTG GTAAAAATAA AAAAAGATAC AACACTAACA TGGACAGACG GACGGATGGA TGGACAGACA  GCTTTTCAAA TTCAAGTTAA AAAAAACAAC AACTTGGAAT ATTGACAAGA AAGGTCTGTG GCAAACAGCA TATAATCACT CTATCACCCA AACAATTCAC CGTCATGAAC TTAGTTTGTG  TCAAAATCCC AAGTAAACAA AATCACTTCT TGGGAAAAAT GTCAAAGTTT AGTGCAAAAC CATACGGGGG AGTTTAACTT CAGGCTTTGT TTTTATCAGC TTGAATTATG GGTCTATCTT  CCTGTGTGGG TAATTGAGCC TGGTAGGCTG TTCATTTTCC AGCCATGTGT TTAGGCAAAG CCAGAACGGG GTCCGTCAAC CCTTTCACAG GGTTGTTAGC ATTAATTTTT TAAACTTCCC  TCTGGTTTTC TTGCTGTCAA ACCTCGTTAC TGCGGGTTAA CATACTTCTT TAATGAGTTC CACAACAAAT CTAATGAAAT TGTTGGAATT TTCTAAAACA ACACTACGGC ATTCCTTGGC 
CACTTAATTT GCTGAATGAG TTTAAAATGT TTTGCTTGCT AAATGTCCCT GACATAGTTT ATTCTATGTT TTTGCTGGCT 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTTTCAGGAC CCTCCCCAAC AACCTCACAC CCTGACAATC TAGTGTCTGG AACCCACAGG AAATCAGACA AATCAAAAGA GGAGATGGGA CTGACTCATA GCCACGGTTG ACCTCGACAA  ACTCAACAGC CTCTCAGTGT TTTTTGTTTT TTTTAAATCA GGGGAGCAAT TTTTGTTTTT TTTCTTGTTT TCCTATTTGC CCCGGCGTTC AGTTTGAAAT TGTTCAGCAA TAAGTCAACA  GGCACTCCAT GGGTTTACTT CTGTAGCAGT GAATAGATTA ATGGATTATA TAAACAGGAT GGACAAAAAG CTGTCCTCGG GCACTGAGGT GCTGTTTGCT CTCAATGGGA AAATGCAAGA  CCAGTTGCCG TTGACAAAGC AGGAAAGGGA AGTGGATGGA AAGGCGGCAG TTGTCTCAAA AATGTCTTTC TCAGGTTAGA GATACCGAAA AACTGGTGCT ATTTCCCTGT TTTTACTCCA  AGATAATCTC TAAATATGAA CCTTAAAGTA TTATCGTTTG TATACAAAGC CACCTATATA CACGCAATAT GTCTTTTATT GATGCATCAG ACTTGAGTGG ATTATTTTAT TCAAGGACTT  TTATTGAATA ATTGTCGGGT GCTTTATATT GTTGCTTTTT ACCCGTTTTT TTTCTATGTA AATGCTTACA TGTGAAAATA ATGTGAAGCC CTGCGAAAAT GTTTGTAATG CAAAAGAAAC  ATGTCTACTG ATACCTACTC TTCTGTTCGT GGGATGGCTT TTTCGTCTCT CCTGGGCCTC AGGTGAGCTG GTGCAGGGAG GCACTCATCT ATGGAGGAAA CCCAATGCAA CTCCTGCAGC  ACTGTCCTCT TCGACTCTAC GGGTCTGTCT CAATAAATTA GATTAGCATC AAAGAGTAAA TTCATATCAG TAGGGAAGCT TTTTATCTCT GATCATTTTT ATGATCCTGG GGTAATAAAA 
ACCCATAATT CTGTTCCTCG GAAAAAATCG AATCTTACCT G 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTGAGTCATTTCCTCTCTAATTTCCAGTTTTTCCTAAACAAAGACTAAGTAAGATGACAGACTGCCATAACAGTGGATAATCTTTAGTCACTGAAACGTGGAATTAACCTTTTTT
TTTTTTGCATGCTTGCAAGAAGAGAGTTAACATGGCTTTAGCTAAGACAAATTGTCCTTAAAATGTATTTTATAGTGATCAACATTTAACACGAATGCAAATGTTCATTTTTCTTTACAA
AATCTAAGATCAAGGCACCTTAATGTCACTGTGCCACTTAAACATTCCACACATAATCCAGAGTCTGTTTTCAGTGTCGCTTGTAGACTCTCAGGACTTTCTAATCAGTTGAGCATTTCC
TTCCCTTCAGACAACAGCTGAGCCAATCTTGTCCTTTCTGCCTGACCTTATTTAGCCTTCTGCAGAAAGAAACAGAGTTGTTTGAATACAATCTGAAAAGTCAGAAGTGCCGTTAACCAC
CTAATGTCCTGCTATTATCTCTTACAGCTGTAATATGTGAAACCGAGTCGTTTTTTTCAAATCATTAAAAACATTATAAGAATGACCTCACCAAAAATCTGTTGCACTTATGTGTGCTAT
GTGCGATAGGTGCTGCCTGAATTAGCACGTAGCCTTGTTCATTTATCCTGCTCCTCATCCCTCAGGCCCAGAGGAGGCAAGACAGTGTGTCTGCCTCAGCATGTCTGCGAAATGCGTCCT
GCAATGCTACCTTGCAGAGAATGTTACCTTAACTTGCTGCTGTGAGAGTATCTCATTTCCAAGGAAGACAACTCACTCTGAATGTGCTCGTCTCTTTCTAATTCACAGACTGGCTTAAGC
TTTCTTGATTTTAAAGATTGTACAAGTCCAACAAAAAAAAAAAATACTGCTAACGGGTGACTGTGATCCTGACAGACAACTTCAGCTAAAGTGGGTTAAGATGACACTAGACTCAGGAGC
ATTTAAGTGGGAATTTAATTCCAAAAAAGTGTGTTCATCCTTGTTTGCTGATGTCACATTGGAGATTTAAATTGTACGGTGTGTCTTCCACCAAAGTCTACAACCAAGCTGTGTCAATAA
ACGTGCCAAACAATTGGAGGAAGCGTTTGTAACTGACCTGGTTCATTGTGATACAGACTTTAGGATTTGTAAAGGTCTTCTGTTGTTTGTTTGTGAAACACTCACTGGTCAAAAATAAAC
TCTAGGATCCTGGTGAGACCACTTCACTTGTTTTTAGTATATATTTTAAATATTTTTCTGCTTTGTCTCTTAAGGTTTACCTACTCGGAGATGGTATACTATTTGCTATTTAGCAGCAAA
GTTAAGCCTCAGACTCATGCTTTCTTTCATCACTAAAAGTCAAAACAAGGTGACTTAGTGTTGCGTAAGTTTTTCCTTTTTTTATAATTGTTATTTATTAAGTTAACTAAAAGCATGCAG
AATCAAGAAACATTAAATACCCCATTGAGAAAAACAACTTCAATATTTTTTTTGCAGGAACAAAACACAAAAGCAAAAGAAAAAGTGTTTTTCTACAAAACCTAGAACATTTTAATCTCA
AGCCTTCCGTCGAGCTGATGTCTTGACAGTTTTGCAAGATAGCGAAAGTATGTTATGTCTTTCTGAACCAGGCAGAGATTGTTTACAGTGAAAAGTCAGCACTTTGAGGCAGGCTGAACT
CTTACAGGGTCAAGTGAGCTTTCTAGAAGAACGCCCAGGCCTGGAAACTGTAGTCAGTTTCTCAGATCCATCTGAACATTTTGGTCTGGTTCATTTTACACAGGATTGACAACATTAATC
TTTTGAAAGTGATCTAATATTTGGTTAGATATCTCACAATATGTGTTTAATTACCAGCTTGCATCCCTGATATATAAAGCAGAACTGTTTTTGTCCAAAATGTTAGAAAGTCATCATTCT
GCTGAGGCAGTCATTATATACAAGTGAAAAACATTGAAGACAGCTCGCAGTGTTTACAGCCGCGAAGGTCCCAGCAAGTTCATTCTGATCCTCAAAAAAAAAAACAACAACAAACCCAGG
AGCGTTTTCAGTCTCTTCAGGTCTCAGTTAATATAACCAATGTCAAAGTTCATGATGGGACACTTAGAGAGTTTTTGTCTGTTTAATGCTGTGAAATTAAAGTTCGGTCTGCAACCCAAC
TGAAAAACTTTGGTTGAGTTTGAATTAAGCTGTTCAGTAAAATGCTATAATATGATGAAATACATTTTTTTATACTTTCTTTAAATTAATAAGTCTGCATATAGTAAAATTAAGAGGGAA
GGTGTATTTTTTTTTATCTTTGATGAACATCCATTTTTCCTCTTACCTTAACTTGCTGCTGTGAAAAAAGGCCACTAGTACCACAAAAGCCTTAAAAGAAAAAAAAGTACATTTTTTTCT
ATGCTGCTAATGTCACATAATAAAGAGTGATTTTACTTCGGTTTCTAAAAGATAAGATGCAAAGTCATTATATGTCGGCTTTGTGTTCCATTTTTGCTGACTCATTCAATTAGAGAGAAA
CAGGAGACAGATTCTAAAGCCTGCTGACTGCAGCAAACAACCCTGTGCTTGTTATCTTTAAGGCAAACGTTATTGAAATCCCCCAAGAAGATTAAAGCCCTAACAAAGAAATACTTGTGA
GATGAGCATCCTGTAATACTTTGGGATTTTCCTGACAGTGATTGGGTATCACTTATCGTACTAACATAATGAAATATCCTCAACGATTAACACATTCTTTTTGTTTTTTTTTTCTTTCAG

AGACCTGAGATTCAACAAAATCAAGGATTTACAACCAGGCTCCTTCAGGCGATTAACAAACCTCAACACACT
GTAAGTCGCCCTGTCTCTGTATGAGAGGCAAGAACATTTCCAAGCTCT
TCTTCTGTGGTTTCACAAACTGGGTTCAGAATATAATTTTAGTAGAATTCCTCTTTTTTTTTTTTTTACTTCCCCCTGCATTTGTGTTTTTTCTCTTATATTTTGCACTAACACACATAT
TTAGCATACTCATATTCATAAGAAATGTTTTTTTGTCATGCTTCCTTTTTTAGTTATCTTTCCAGTTTTCAGGTGATTTCATAAGCTCCACCTTATCTAAATATTTGCTGAAGGGGTTGA
GCTGTTTCTTCATCTGTTCTTGAAGAATGCTGTGAAGTAAAAGAAATACGCCCAAAAGAAAGCAAAACATGCACTGTAAAATTTAAACAATTTTCTTTCCAGGTACACCTTGGGTAAAAC
CAGTACTGAACACACCAGCATTTCTTTTGTCAGTAAATATATTTCATAAGCAAACAAAATCACAACACACGCATAAAGTTGTCCACACATACAAATACATTTATTGCAAATTATTAAATA
AATGCGATAGAGTAAGTATTTACAAAAAGGATGTGCAAAAGCCTTAGAAAGTCAAGAAACCAGCTGAAATCTGTTTGTTTTAAATTACTGCACAGAGTTTGATTACTGAAAAGAAAAAAC
AACCTTCACGAAAAAGTCTTAGTGTAGCACAGTGTAGTAATGACAAAGGTTACGGCTGCATTTCTAAACGTCTGGATGTTCCTGTCAGTACCATTGCAGCCATAATTCTGAATTTCAGAA
CATTATTTCACCATAAGGCAGCTACACTGAGGCGCCTCTCATTGGACTTCTGGTAGAGAAGTCAAAGAAACGATCAGAGGACTTCTCCAAGAACCAATAGGTACATTTGTGACTTTTTCA
GAAGATTCCTGGGGTGGGCTGTCTGGCAGCATGTCATACTGGCTGAATTTGTATAACTGAAGGAAGGATGAATAGAGACATCCCTGATTAAAATGTAAAGAGAACAGCTCTGAATTTTCA
AGAATATTAGTCCCAAACACTTTACCATGAAAATTATTAATTGGTTTCAGTACAAATTCCACCAAAGGAATCCTAGTCCGTGGGAGAAAACCCAGACTGTGAAGCGAGATGTGCATTGAG
TGTATGATTCTCCTAAACAAAATTCATAATACCACTTTCCCTTCAGAGGTGACCCATTTAATGCAGCTTGAATATTGTAAGTTAAGTATGAATGCAGCATATTGGGGAGGTCACAGAGGT
CGGTTAGACAACATTATTGACAGATCAGGAGCAATGTCATGGTGAAGCTTTAAACACTTAAAAGCAGTAGTAATAATAACTCTAGAAAAACATCTGCTCCTTTGCCAGATAATTATTTTT
CAATAATTTTATTTTGTGTGTTATAAATAGAATCTTTACCGGCAGATCAGGTCTTCATTGCAACAATCCTGTAAAAGCTCCATATAGTATTTTTTTCCCCTGAAAAGGCAGGAAGTAGAT
TAAGTTGTTGGAGCACAGCCATTTTCCACTCTTAGCAGATATACCTCACCTGCAGGATTCCCCAGACTGTTTTGCTTCAGTGGGCCTGTTCAGAGCTAACACTTGACGGAAAGTAGATAG
CACTGAGTGAATGTGTCCAAACCTAGTAGTACAATGCACCCCTCAAAAACTATCAAAACATATTTGTATAGCCACTGTAAAGACAGAACAGCTCTATTTTGCTCTTTTTTCCGACTTCTT
CCGCTTGCTCTGTTGAGTTCTGTAATGGCTCCTCATGGGAGTCGGCCCTGCTCTGCGTCAAGGGTTTGTCCCTCAACAGGACAAAACAAAACTCTGTCTCCAACTACCAAGATAAGTTCC
TCATATGGAACACTGGTTGTGTCTCCCCCCTAACTATTGTTACTTTCCTTGACTTTTCTGTATCTGTCGTTTAAGTGTTTCACTTTTCTTTGGTAGCGATATTTCTTCACAGATGCTGTG
ATTGTGTAAGGACTCAAACACAACATGTTGTCCGAGACTATTGAACCTAACAAGTTCATTTGACATTGCTCAAAAGTGAATTGGAAATGAAACAATTGCGACACCAAGATAATCTGCAGC
TTACTAACTTTCGCTCCCTGTCCTTCTTTCACAGTCTCCTCAACAACAATCATATACGAAGGATTCCCAGGGGAGCGTTTGAAGACCTAGAAAACCTCAAGTATCTGTAAGTTTTGCTGC
ATTTAATTTTGTTCCCTTATATGTTTAAGAGGGATGTTAATCATTGGTTCTCAAATGATGCAAAACCAATTTTTGCTTAACCTTTTGAGTATTTCTTATCCAATCTTACAGCTAAAGTAA
CTCCTGGGAGAATCTGGTGATCATTGCGCCTGACTCTTTTTCATATTTTTTTATTTATTTTTTTATGTGTGTTTGTGAAGGAGGGTATTGTTATGAATCATGCAGAATGTCATTTGGGAA
ATTATATGCCCACAGTGAAGCAAAATTCTTGCAGTGAGGACTCCAGGGTATTGCTAGAGGGAGGAGTAGCTTTATGAAAATAGTTTTTTTTTTCAAAGTATTCTTATGCCAGCTGTGTCC
TGAGCATGTTATCTATCCTTTTTATGCATGTGCAGTCAATGGGGTGGTAGCATCTTCTGCTTGGGGCAAAGAATGAGGAGAGTATCTTGCATGCATGTTGTTGTGAAAAGCAGCACTCCA
GGACCCCAGGATCTCATTTTCTCATTTTAATTGGTTGCGGGCAGCAGAAGGAGGGGCTCGCACAGAGCTCCATTCATCCACGAATCTCCATTGGGTACCAGACAGAAGGTTTTTATTTAT
AAGCATTCTGGAGTGAAAGCTGGTCACAGATAATTTTTTTTTATATGTAGCCTAATCTGATCTTGAAACAAATTCTATGTTATATTAAGGAAAAAAACAGTCTTGCATATATATATATAT
ATATATATATATAACACTTCTATATGGATGTCTATGGATGTTGGAAGAACATGGGCTATATTAAGGTCAAGGAAGTGCTAACAATGTAACATCCTACTTAAAACTGAAATAGCTATTCAC
TTTAGCTGCTATAGCAAAAAGCTAGACCTTGTAGCCATTTTCTAATTCTACTGCTTGTTGTTTGGGACCTGACTTTTCTTTGTGTGTTAGCAGACATTTGAACATACCAAAGAAAATTCT
AGTTTTTCTCGTCACCACACATAGATTGTTGTTTAACACTAGTAATTTTTAGCAGCGCTAATTGTGATGATCACTAGCCTAAGATGTTGATGAGAGTTTAAAATGCAAGCCCTAAATTAA
GTTGTCTTTGCTTTTGGATATTTGTAAAATTGTTTGTGCAGCCACTGCACTTTCACCCAAGAAGAGTGTGTGACTTTGAAACTGCTTCTAATATAAAATGGTATTGAAAGCTTACTGTAG
GAAATCAACACAATGCTGTTATCACTCTTCATAAATCGACTAATGCATTTCCATCTGGACCCAGATCTCTGTGTGTCAACTATGTGGTCATATTCAATTGATTAGAGTAGCATTGAAAGT
CCATTTATTCCAGTAACTCAATTCACTAAGTCAAACCAATTTAAAGGATTAATTACACACAAACTGTTATTTTTAAGCATTTGTTTATGTTATGTTTTATGTTACTTAGAATTTTTCACA
TATAGCTGATGAAAACCCAACATTTAACATTTATTACAAAAGACCAATTGAAAACACTTTAAACCAAAAAATGTGTGCCTAATAAATAGTATTATTAAGCTCTAGGTAGCTATTTGGAGT
AACTTAACCTGACAAATAAGCCTCATTGGAATACTTATTCTAATTTACTAAATATGACCGTATGCTGGAAAAGTTGATCTGAGTCATACATCAGCTTTTTAGTAACAAGAAGTGGTTGTT
ACTTCTTTTTGGGTGTGTTTCACTGAAAACACTTAGAACTCTGTATATAAATTAGTTATTTGCCTTAGCGGTGTGCAGAAAAGTGCTCTGACTCTGGTGGGAGACTGTTACTGGAACCAA
GTGGCTGTGCCTCTTTACTGATCAGTGCAAGCTGAGTTATTTACCAAGATGAAAAGAACTTCAGAGGACAAAGTCTGTCCCCCACTAAGTCTGTTTCCATTGACGTGAACAAATAAGTAA
AGTTTCTCTTAATCAAAACAATTCCAAAGCAAAAGTCAAGAACAGAATGTTTTTAATTGGAGTCGGCGTTCTTTGTGGGGTTTTTTATTTTAAAAATTTCAGTTTATGTCCTCTCAGAAG
GTTTCAGCTTGTTTATTTAAAGGATATTTTTAGATAACCCTTAATAGTATTGTCCTGTCAAAGGGAGGTAAATACAATACTTTGGATTACCGCCAAACTAGCTAACTTTCTGGACTTCTT
GTTAAATCTGTGAAATTAAAGAAACAGCAATTGTAAAAGTGAAAAATATTCACTTTTTTGCAAAACTGATTTCTTTGTTTTGTTTTGGCTCCAAAGCAGACCACATTTAGGTCTACAATC
ACACCATGGTTCAGTCCATTTGACCTAAAACAACTGAAATTAGATGTAATTACTGTTTCCCGAAAATGTTTGAGTCCAACTTCACAGCAGGTAGGAACAAAGAGGCTTGAGACAAGAGCA
ATTCAGCTTTTTTGTTTTCCTCTCCACTGGATTCCAAACAAGAGCCTTCAGATTCCTTACGGTCTTCCCTCATGTTTGTAATTAAATCCTGCAGCTGTTTTAGTCACTTTTAGGGAGCCC
CTCCCCATCAAAACGCAGCTGATCTGAGGACTGTACCGCTGCAGGAACCTTAGTGATTGTTGAAGGTTACATCTTCCTGCTAGTCAGAGCTTAAAGCCGGAAGTTCCCATCTAACCTCTT
CACTTTCTTCGAAGCACAGTGTAGCTTTCTCTGATTCATCTGCAATGCAGTAAAAGCTTAATGGTGAGCTTTCTTTTCTCTGTAAGAACCAGCTCAATAAACAGATCAGACTGATGTAAA
CATGCAAAGAGTTTTCTGGTTGTTTTCTTAAACAGATGCTGTTTCTTGTTAGAGAATCAAAAAGTTTTCTTTTTTTTTCACATTGCAGCAGTGTGTTGTGTTTGCATCCATTTTTGGATG
GTTATGTTTTCGTAGTGTATCAAAATATATTATCTAAAAACAATTGAAAATGAAAAGTTAAACATCTCAAAAATAACATTTTGAAAACAATTACTTTACTGATGGAACAATTTTGTGAAA
GGTAATCTGCCTTCTGATTTAATGTTGGTGAAGGAACAAATTTCATCAGAGTTGTTGAAACATTCTCCAGACATTTCAATCTGATCTATTTGAGCAAGACGCTTTTGGCTAATTTATTAG
TTAAGTTTACCTGTAGCAAAGAGGGAAAGGGCGTAAGAGTCAGAAGCGGTGGAAAGGCAGATTAATTGAATGACATGCAAGGCCATTTTTCACACTAAGTATCTTTGTATTCTTGCTGTT
GCTGGGTAACATTAGGTTTTTTGACGTTAAAGTGTCTCATCACACTTTAAGTTCAGTCTCCCTATTTTCTTTATGTATTTTGAAGTTAGATGTTGTTCATTTATTGGTCTAAACAATACG
GTTGAAGTCTGTTGAATGTGCTGGACAGATGGAGTAAACGTGGCTTTAAGTGCTTTTCAAAGTTGTAAGTTTAAGTCACAAAAATGGCTCATTTAATCCAAAATGGACATCTTGCTATTT
AGTCTACCCACAGAAGGTTAAACTTACCAATGGCGCTGCAGTCTGGGTGGCACTGTGGCTGCTGCTTGAATGACAGGCATTTTCACAATTTCTAGTGTCTATCTCAGATTTATGAACTTT
GGGATAATTTCCTGCTGACTCATTCAAAAACATGACATAGTGGTCCTTTATCTTACTATTATGTCTCTATTTAACTATTTTGTTTGATTTTAATTACAGAGCGATTCTGTTCAACCAAAG
TTTAACTCAAATTGTCTTGGTGGTTTCCTGTTCTATAAAAGAACTCAGCATTTTGTAATCTTCTTGTTTCAATGTTTTGTTTTTTTTTTTTTTKTTTTTTTTTTTGCTTTTTTTTTTATT
CTTGTTCTGGTGGAGATCTGGATTTCTCATTATGTCCCGGGTTAAAATCATGAAGTGTGTAATGGGAGATGAAAGGATGCACAGCTGGAAGCTATTGCTTTTCTAGGCTCACATTTCTTT
GACATGTATTGTGGAAGAATAACACACATGAGGAGGGCGGTTTGCCTTTCAGGGGCGCCTGGTGATCCTGAACATTGCGTTTATGATTCCAGCCTGTTGTACATTACTACATGGGACTTG
CAGCAAAACATTTCACCCACGGACATTTTTTATGTTTTTTTTATTTTTTATTACTTTGATCATTTCCCACATTTTTATTTGTTTTTGGCATTTTGGTAACTATTTAGATCACTGAAAAGA
CAGCAAATGGTTTTCTTATGGTGTGGGTATAGCAACTTACTACTTATTCTGAGTGAGCCTGTTGAGCAACTCTGAGACTATTGACTTTTCACTTCAAACTATTCTTATGGAAGGTGATTG
ATACTGAGCAAAGAAGTTGCTGTTTAATGAAACACATTGAAATGTCTATATAATATATACCTTAAATGTTTGTTGTATTAATTTGCAAGCAAGAAAAATGAGCAATTGGTCAACAACTAC
TATGGACAGCTCTTAGGCATTCACTTTGTACGATATCCCTTTATTCCTTAGTTGTATGCTTTGCATGTTTACAGAAAGATAGTGGCTTTTTTATTGTAGGCAGAAAACATTGAGTTAGAT
GAATTTGTTTATAGGTTTTTAATTCATCACCAGGAACAAAAAAATATTGTGAAAGTTGCCCTACTTAATTTTTTGGGGCAAATTAAGTTATTTTTATAAAATGCTATAGGGACTCTGTGC
TTTTTCTCTATAATTAGGGAAAATTAAGATGTGTGAGTGTTACTAATGTCACTGATTATCTCTCCTTTCAGCTATTTGTACAAGAATGAAATCCAATCAATTGACAGACAAGCATTTAAG
GGCCTTGTCTCTCTTGAGCAACT
GTAAGTGACCGAGTTCTTCATTCACCTTTTCTATTTGCTCGCAGCGTTCTGCCTTCTTCTACCCATTTGTACATGGCTTGACCCCTCTCCCCTCTCC
TGAGGATCTCTGTAAAGAAATCCCAAAGCCTGGCAAAGCTGACATGCTTATGAGTCGTACAATGCATACATCAAAGCATGCTCTTTACTTCTTAGGTAGTAGATGGGCATCATGCTGCTG
CATGCGTCGGCCCTTTCCCCGTTTTTGTTGCCACTATGCATGCCATTTGTGCACCTGACCTTTGCTGCGCTGTGACCCACTTTGACTCCCTCTGCATGAGTCGCATGGTGATCATGGCAG
CTTTGCCCCGCCCGACACCATTGAAGCTTTAAAACTTAACATGTTGCAGTGTTGTGCTGCAGCCAGGAGTATTATAGAACAAAGCTTTGACCTACGTCTGTCTTCTTGCTGCAAAAATCA
CACCTCCCCTAAGATTTGCTGTAATCTTGTGTGTGTGTGTGTTTTATTTTTTCTAGATAACGGTGCATAATGTGTGTGCTTTGTTTGTGATAAAGTTCAACTGCTTCCCATAAGTACTGA
ACATTGTGCAGTTTTGTAGCGATGCACCAATCCACTTTTTTCTCTTTTGATACTAATACAGATATCTGAGGCTCAGTATCGTCCAATACCGATCCGATACTGAAAAACAGCTCAGGCATA
TTGTCACCATACCCGATCTAGAACTTCTTTCAGTATCGGGACCGATACGGTTGTTAATATCGGATCGGTGCATCTCTACAATTTGGGGATTTGGAGACCCTTGGACTAATGTTTGGCGCC
TGCTGTAAAAGAAAAGTAACTAGAAGTTCAAACTGGAATGTTGCTTGGAAAAACATTATAAATTTTACATTTTATTCAATTTTTATGTTGTCTGCAGTCAGTGGGAACCTGAGATTGTAT
GTTTTTATTAATGTTTCAGTATGAATTGTGACTCCATGCATTAATAATAATTAAAACACATCCTAACCAACTCGGCCCATTGTTTGGCTACAATGTGAAATCATGATTGAACTTTAAATC
CCCTTGGATAGATGAGTTCAAATTAATTCACCACACCTGATTACTGATTACTGTTTTGAGACGCAAAAATGCATGAATGAATAAATTTTAACCCCCTTTGAGACAAAACAGAAGATGAGT
TTGTTTTTATTATATTTGCAGTAAAACACAATAATCCATTTAATTTAGTCGCAAACAAATTTAACTCAGTATAAATGCATTATATATTTTAGTGGGTCATCTTAACGACAATTTTTTATG
TGCTGTCCTCTTTCTTAACTCAATCACCAACAAATAACCTATGTGATAAAATTCATTTTCAGAGTCAGACCAAGCAGCTGGGCTGAATTTCCCCCCAATAAGGTCATGCTTTATGTGTTG
GTGGCAAGTTGTAAATCCCAGTAATTCTATTAAAACAGATGCCAAGGCATGAAGTCTCATTGTGACATTGTTCTGGCTGAGGAGAATCCCAAACCAGTGGTTGATGATCCTCCTGTGATT
CATGAGTGTCTAAGCCTCATGTCTGAGTTGCTGTCAGTAAATGCAGTGGCTTTGGTTTGAATCAGCCTAACCTGATGATTTATAGCCACTAATGAGGTAGGCCTAAAATAAATTCATCAT
GGCTTTACTCTCTGATCTCTGACATTTAAAAGGTTCTTTGTTGTTTTAGCTTGTTTTACCACGGCATTAGTGGGGACTCTCAGGTGAAAGCAATCCCAATTTGAAACCTTATTGATTATT
TTTATCCAACTGTCTGATTTTTTTTCTGCATTTATATTTTGTGCCTCCAATCTGAGAAAATGCAAATGCAATGCTGATTTTAGTATATTGTAGTTATCTAAACAAAACCCTTTTTTTCCC
TTTTCTACATATGTTTTTAAGTCACATTTTACTAATTAGCATTACAAAAGAACTGAATTTAATTCTATTGCATTTTAATTGGGACAAACTGGACTGTATGATATTGGATCTGAATCCAAT
AATCTGACGTTATTATTGGATTGTATTAGGTGATCTGGGCAGATTTTAATATAATTTGGTCAAATCGGATTTCATATCATATGAAAAAACTCGTCATGTAAAGTACCCTTAGTTGCCATT
TGTGTTTGTAATATGCAAAACAAAAATGTCTTGATCTTTTTTCTCTTGCATCTTGTTTATATAAAACATGATTCTCGTGCTTTATTAATAACTGCTTTATACTACTGAATTGGCTGAAAT
TAGACATAATTATGAATTTACCCATTTGTCTGCTTGACTCATCTGGGGGGTATGAATGCAGTAACAATAACCAAAGCTGAAGTTTGCTAAAAAGGCACTTGAGTTACTTTAGGGTGAGAA
GAAATAGGCTTCTGTGATCTAATTGAAAAAGTAGTTTCCCTTTACCAATAACATTTACAGTAACTGGGTACCGAGCGTAACTATTTAAATATTACTCACACTAATAAAAAATAGAAAGCA
CCCAGAATTAGTTGCTTTGACCTCATCTCAAGTGTTTGTCAGAATCTTTGCATACATCGCATACTTCAGTGATTTTCTCTTGAAAGTGTTTCTCGTGTACTTCCTTGAATTTAAAACTGC
ACCCTTAAATTTTAAACTTAAATATGTCATAAATGCCTACATGTAGACTCCTGCAGTCTGCCAAGATCCACAGTGCCGTTTTCTCGATAGTTATTTCTGACACACTATTGTCCAAATCCC
ATCCTGTTCACACCACCCCCTCCCATTCAATTCCATAGAATAATGTAACGTTTCATAATCATGAAACCTGAAATACCTATTTGTACATTTTGTTCTGTTTCAGCTACCTGCATTTCAACA
GCATCGATTCTCTGGAACCGGAATCCTTCAGCCATCTGCCGAAGTTGGAACGACT
GTAGGTGTACTCTGTGTCACCTTTTTGCCAAAATTCATAAAATATCTTTAGTTCAGACACAATAC
AGTTAAAATCTGCTCTTATGAAGCAGTAAACTGTTATATAACTGTGACTAGGTTTATAAGATTTTGTTTATTTAGCTAGCTGCAATAATTAGCATGGTTTTCTGAAGCTCCCTCCTTCTC
TTGTCTCTCATAGACTTAATGATATGTTAGGTTCTTGTTTCATTTTTTTTAAACCTGCTGTATTTGTACTTGCAGCCTTTAGTCTGTGCAAATAGATGGAACACCTGCAGGAAAGAAAAA
AAAGGAATAGGGGAAGGAAGGAATTCCCAGGTGCGCAGGCTAGCCGTTGTTGGGGAAGATTTCCATGGACACAGTCAAAGCAGAGACAAGAAAGATCTTTGAATCAGTTTCCTGAAAGGA
AGGATACAGAAATGTGTGTCAAATTGATCAAAAAGTCTCGCATATACAGGAAAATGCTTTGTTGTGTCTACAGTGGAAAAAGATGTGCTATGCCATTATTTGGAAGGACAATGATATTTG
TCCTCTTTTAAAAAACGGAAAATTAAGTCACCAAAAACAACATCCTGTCTCCACACTACTACCTGTTTTATTGGTCACTTGTTCATTTTCCCGTTTCTATCTCCCTGTCAGGTTTTTGCA
CAATAACAGAATAACACAGCTCATCCCAGGAACCTTCGCTCATCTTCAGTCCATGAAACGATT
GTAAGTGCAAAGAATCCTAAATAAAAACACATCTTTAGAGCAGCATTGAAATGCATC
GTTAAAATGACAGCATCTCGCTGATTACATTCTCCTGAAATATGGCATTTTTTAATCTTGACGTCAGATTTTTTTATGACAGTTTTATCTTCTGAGGAAAAATCAGCCCTTGTTTAAGTG
TTCTTGTTCCTCTTTTCCAACTCATAAATTTACTTCTAATGTTTGAACACGAGTTCGAGAAGAGAGTCAAAAGCCTATTTAATCACACTGACTTTGCTGTGATTTTGGCTTTTTATATAG
AAACATATGAACAATATTATACTGTGAAAAATCATTAAAGCATTGTAAAGCGTCTTTTTTAGGTGACACATTGTAGTAAAGCTGAACCAGAAAAGGAGTGCAGGCTGTGAGACCAGTTCC
CACAGTGAGAACAATCTGTCCCAGTCTCTTTCTGGTGGGCCCCACTGTTTGCACTGAGCTGGATTTGGTGGTGCCAGACACACTGTAGTTCATGAACTGTCACAAAGGAGTGTTTTTAAC
GGTGCTGCTGCTACACAGCTAATGTGATTGCAGGTCGACAGCTCTGAGGTGCATGTGTGACTGGATTGAAATCAAAACCTACTCAGGCTGCATTTCCACACGTGATGTTATTTCCACACC
TGTAAAACCAACGCAGTCCTGAACTGAATGAGCAGATTTTCTTTTACTAGGTGACAAGGTTTCCACTCTGATTTTTTTATTTTTTGGGATTGTGTCTATGAAGCCTGATTGGTTACGATG
CAGTAGAAGTAAAACATTTGGTTTTGTGTCCCGCTGAGCAACATACCTGAAGCTAATCATATACCATATTTTCCACACTATAAGGCGCACCGGATTATGAGGCGCACCTTCAATGAATGG
CCTATTTTAAAACTTTTTTAAAATATATATAAGGCGCACCGCATTATAAGGCGCATAGAATAGATGCTACAGTAGAGGCTGTAGTTACATTATGCATCCACTATATGGAGCTGCACGAAA
TTTTGCACTGTTGCTGCATTGTTTTGTTTGGAATGTCAACAAAACACTCCAACTCCGGTCAGCGACAAGAGCCTTCCGCGACTGGGCCGGGGCGTGGCCGGACGATGGTGACCCCTCTCT
GTTCGCGCATAGCATGTTTGTGGAGAACGTGGTGCTAAATGACCTGCAAACGACCTGATTCTAGACGGTCAGTTGGTAGAGAGGTCAGTCAAACTTTATTAACAAACCAGCGTTCTGACA
ACTATCCTAGCATGCACCGCGCGCTTCTTCTTCTACGGGCGAAAATGAAGTYGGCGGCTGCTTACCGYAGTTGCTAGACCTGTTRTGGCTCAATATTGGTCCATATATAAGGCGCACAGG
ATTATAAGGTGCATTGTCTGCTTTTGAAGAAATTGAAGGTTTTTAGGTGCGCCTTAAAGTGCGGAAAATACGGTACCTCTTTAGACTTCAATCGGTATTAATGATATGCATAACCCCGAT
TTAGGCCTAAACCTAAATTATATAGGCATGTTTGCCTGTCCTTTAAACAGGCAAACAACCTGATCTAGTTTTTGTTTCTAGTGGGCCCCATTGTGTTTGGAAATCAGGCAAACAGCCTGC
CCTAACAGTGATCTAAACCTCAGGCTCTAGCATATATTGTCAAGCCGAAGTCGAACTATCGATGCATGGTCACATTCATTTTCAACCACATCCTTCAAAGACGAGCTCCTATGAAACCCC
TCCTGCTGCAGTACATGTCATGGTGTTTTTGTCATGTGTGATTTGCAATGTGTAGTAAACACAACGATCAAGACATAGACGAACAACTATCACGAGTTGACAACTTCAGATGAGGAGGAA
ATAATGACTGATGAGCTGCAACATCTTATTTTACTTTTAATTTTGTCGAAGCCTAAAAAAAAAAAAATAATAGAAGGTGTTGATGGGATGTTCTCCTGCTGCATCGTACCAGAAGTGACA
TGGGGGAGTTTATTGTTTTGGTTCATGAGGACATACTGATGAACCAAAATGGCCCTCGGACCATTGCTCGTCCAAAATATCCATGCTGCTCTCACGCTGAAGAAGTCTATTATGATCTTA
GAACTTTCAACCGTTTTGATTTTATTGATAATTAGGGTCTAACAGCATTAGTTTCCGCAAACAATTCAACTGAAATTAGATAATAATGAGCACAAAACTCCTACATATGTTTGAGTCACA
TAAAGATGTGTACACATTTTTCAGTGATGTTTCCAGAGGCCCTTTTACGTCTTCTGATTTGCTCTTTGCCTCTGTCCATGTTTGCAGGCGGCTGGACTCTAACGCTTTAAGCTGTGACTG
TGAGCTGCTGTGGCTGGCCGACCTGCTGAAGCAGTACGCCGAGTCAGGAAACGCCCAGGCTGCTGCCACCTGCGAGCATCCCAGTCGACTCCAGGGCCGATCAGTGGCCACCCTCACTGC
TGAGGAGCTCAATTGCG
GTACAGACAGAAGAAAAAAATAAACACTTTATTTTGATTTGTCTTCATGTTGCTTCTTCAAACCAGCTTTTAGCCCTTTGTAGCAGTAATGTTTTCACCTCAG
TGGTATTTTATAGCACCTGGGAAAAGTATTCATAGTCCTGGAACTTTGTGACATTTCATTATGGTACAACCAAACAATAGTGTATTTTTACAAAATAAAAAAAAAATATCTAGATTTCCA
AAGGTAGGAGAGAAAGAGTGCCAATAGTAGTCAACAGTGTTTGTTTAATTTTGAAACTGAGAAAAAAAAATTAAATCTGGTAAGTGAAGTCATGCACACAAACAAAGATATTCTCCTGTG
TACTGTTCAAAAAATATTTACCTTATATGTAAGCACTGTTGCTCTGTGGGTCCCAAATACCACTGTTCCACAGAAAGTTATTGGGTCTATGCTAACTCAACTTCTCATGCAAAGTTTCAT
TGCAACTTCCATCCAATTTGTTTTTTTCTTTCTTTAGCATTTGATAAAGTCATTGTTAAAACATACAGACAATAGCTTAGCCTTCCTTCCTGCTAGCAGCACCTGTGTTGAATCAGGTAT
AAACTGCTTAATCTAACCACACACTGCAGATGTACACACAGGTGCATGTTTCGGTTCTTTGTCTTAGCTCTGCAGCTGTTTTGCTCCTGGAAAAATCTACCCATCTGGAGGAAATGTCAA
TCTGTGGTCACTGCAACAACAAGCAGATGTTCACTTTATCAGTGAGAGGGGATAAAAGTTGATCTTATTTTGCATCTTAAGTAGAAAGGATGTTTACAGCACAAATATTAAATTTAATAA
GCCTATGCAATGTTCTCACTATCATGAGAAGTTTGGAACAGCATGGACTGTGCTTATGTTTTTTTTTTTTTTTAAAGTTTGTCAAAGAAAGAAATGGAAACATATCCAAAATGTTATAAA
AGAGATCAAAAATATTTAATAATTTAAAGTCTGAAGAAGTCAGTCATTTTGAATTTTAAAATGTGTAGAAACCCTTGACATAGAGAAACATCTGCATTCGTACTTGTGACAGAAGTCCTC
CTGGTTCTACCTGTGCTGCAGTCTATGCATTAGAAAAGCTCTTTCATTTGAACCTTTCAATCGACTTGCATAAGTTTTACACTTACAAAAGAAATGTCAAATTATTTGCTGAGTAGGGAT
GGTTTTTGCTTTTATGTAAAAGCAATAATTATTTATACTGCTGCTAATTTATTGCGCATTGAAGTTATTTAATAATAATCTCTACCATTTCTTTTCTATTTAATTTTAATTCTCAAACTT
AAGCAAAGACGAGAATTAACTTTCACAGCATTGAGTATTTTTTCAAGTGCTAATTTTGCAGAATATTACACATTTTTGATGTGCTGTTCTTTCTAGAATTGACAATGGAAGTATGACAAG
CTATTGGATGGTTAATAATCCGTTCTCTAATTTATCTGTTTTGGATGAGATAATAACAGTAAGTTTATTCACACTTGTTTGCGACAAAAGTGGAAGAGAAAATGCAGATAATTCCATAAT
CAGTCTGATTCCATGCGGGCTCCAGAACTAAATCCACTTGTTGTAAACCTGTATTTTCTCCAGCTCCCTCTGAATCCCTCAGTCTGAACCAGGCAACTGTATCTTAACCGCAGTTTAATC
ACAGAAGCTAACTTTAATGGCCTTAACGTGCCCACTCCTGCCTGCTGTATCCCTCCCATTCCCTAAAATCCAGGAGAAGAATGTCTTCCTGAAAACATGGTGAAAGTCATTCTATACCTC
CTTCCATCTGTCTTTTCCTTCATGGTCCACTTCAGACCCTATATGCAGGGTGGTACGCTGCCTAGTAAGAGCTGCAGTCCAACTTCCATCCCCTTAGATTTGAGATGTTATGGTGTTTGT
ACTGATTGACTTGCTGGTGGATGCGAAACAGTCGTCATCGCAGCGGTTGCTTGTGTGAGAACTTTGGAGGAAATTGCTTAGAGGAGTTGCTTCTGACCTGAATTGGTGAGCAGACACTGT
GAAAGTGGGAGGCTGAATCTCCCTTTGGGACATGGGAACTGTTCCTGTTTGTTGCTTCTGTGTGTCTTAGATTTCACATGCTTGTGGTGACCATTAATCTAGATCACCACCGAGTACAGG
AAGTACATCCTGTTGGAAACTTCTGGAATTTGGCATCTGAATTAGCTAAGAGATTCTTCCAGCATGGATGTAAGAACAGGTCTGGTTCGGCAGAGGCCCCGTACAGTTGTGGTAAGAAAT
AAGTTTACCATCTGTTGTTATGGAAAACTAATTCGAGATACATTATCTCCTGTTGACACAATAACATCTATCATCTTGGGGATGCGGTTGTTCCTGCCCCCTCACCCTACGAATGGTTAT
GAGGCTGTTTCCAAACAATTTGGGTTTGTCAATCTGCACTTAGGAATTAGTCTTAGCAAATGTAGAAAATGGCGAGAAAAGACCTGAGCTGCACACAACTGTGAGCACAATGTCCTTCAG
ATGGGAGAGCTTAAAGCAGAGATGTTTGGCTGGACTGCAGATTTATATATATGAAGAAAACCCAACACAGAATATCAGCACAAACGCTCCCACGCCAACTTTGTGGTTTGGTTTGGAGAC
ACAAGACCTGTGCAGGCTAAAGCCATTAAACTGACTCTGAACTTTTCTGTATATTACTGTATTATTAGGGTTATAGAAATGTGAAATTAAAGCATGGGCTTTGATTAGTGTGATTGTCAT
TCATTTTTCTTGTTGAATTTTCTTGTTGCAGAGGTACCGAGGATCACCTCAGAGCCCCGGGATGTCGATGTTACATCAGGAAACACTGTTTACTTCACCTGTAGGGCTGAGGGAAACCCC
AAACCTCAGATTATCTGGCTCAGGAACAA
GTAAGATTTATCAAAACCTTAAAAAGATGAATTAAGAAAACTGAGACCAATAGTTAGTTTTTAAAAGAAAATGTACTCTATCCTAGTGATT
TATGTATTTTCTATGGATTATTGCAATTTTGAGGTGTTGGCTTCTCGCAAACCTTTCTGTTATTTACATGTTGTCTAAGATTTTATTGCACTTTTAGCTTGGCAGAAGGATGAGAAGAAA
AAGGAGTTATGTAACGAACAACCTGGAGTTGGGAATAAAACTCAGGACAGCTGCAAAGAAAAATATGGCGTCTGAAAACGTTGTTCTACCTTTGAGCCATGTGATGGCTTCATCTGTGTT
TAGCACAATAATCTACAACTGAAACTAGATGTAAATAACTCTGTAAATTGACAATGACCATATTATTTAGATGTTTACATCAAAGAATTAACACATATTATATGTTATGTTTACCATATC
CAATACTTGATTAGTTTTACTTCCCTCAACTGTGTCTTTTATCTTTTGTTCCATTGAGAATAACGAAGATTTTTTGGAATATTTTTTTAAATCAAATAATATTACAAGAACACAGAAAAT
ACACTATAAAACCCATCCATCCATTTAGAACAGGGGTCCCCACATTTTTTCCTGTGAGGGCCACATAACTTCCCCCTTCTCTGGTGGGGGGCCGGAGTCAGTTTGTAACAGAAAAGGTGT
GACGATTGCAGGAGTGCCTAAATGTAAAAATGTATTGTTTTCCAGAAAACACAATCAAATAACATTCTCTGGGTTCTTCACAGAACAAAAGTCAGGAAATAAATAATAACACTATTAATG
AAATAAATGATAACCAAATAACCCTCTCTGGGTTCTTCACAGAAAAAAATCCAGGAAGGATTATAGTCCGTATTTTCCGCACTATGAGGCACACCGGACTATAAGCCACAACCCCAAAGT
AAAAAAAACAGTAAACATACACATATAAGCCACTCCAGGTTTTCCACAGCGATGCAGCATCAGCAGAGGAGGGCAGACACCCAACATTTGAGTAATAACAGGTCAATTGAATAACACATT
TATTACAGTTGAAAAAGAAAAAGTTGCCAAGTTTAGATTTAACTGAACTGATTACGGTAGTTTCCGAACGGTAACTGTAACAGTAAAAGTGCTGATCCTTCGGGTCTGCTGCTAGCATGT
GCTAAATGAAAATAGGCACTTTCCTTCTTCTTCTTCTTCTTTAGATTTCAACAGCAACTTGCATCCATTATTGTTGCACTACTGCCATCTACTGGATCCTAATGCCTCTACCTCAAATTC
TCATAATGATCCCAGTATTATTTAAAAAAAATGAAAAATCTTCTTTTTCCCCTCAATGCTATTTAACTGATCAACAACATTCTCAAATTTCAATTCCCTATTAAAATGTAATTCAGTTTT
AATGGGTGCTTTCCTCTTTTATTTCCAATTTTGACTTCCAATGATTCACTTCCCGCTAAAGAGCCCCCTAGTGGTTGAAGAAAAATCCACTTATAAGCGGCTCATAGTCCGAAAAATGGT
ATATGAAAAAAAAATCTGAATGCTCTCTGGTATTGTTCAGGGTACCGGACCAAATGTGGAGGCGGGCCGGATCCGGCCCGCAAGCCGTAGTTTGGGGACTACTGATTTAGAATAAACAAT
ATTTGCATGTTTTGTTTTGTTTGTTTGCAGCAATGCTTTAAATATGCGAGATGACAATCGTCTGAATCTCCTGGAAGATGGGACACTGATGATTCAAGACACCAGAGAGACTGACCAGGG
AGTTTACCAGTGCATGGCCAAAAATGTAGCCGGGGAAGTCAAGACTTCAGAGGTCACGCTTCGATACTTTGGAGCCCCCT
GTAAGTGCACTACTTTCCTTTCTCTACCAGGTTATTATGC
AATTGTAATATAAAAAAAACAACAACAAGCACTTTTCTGTTTTCTTATCAAGAGCAAAGTGAGCCAATCAAGTCAGATGACATAGACAAACTGGAAACCACTGTCCCTGTCCTGTGAATG
TAATTATGAAAAGTGAAGAAGGCTTGGCTTGGAAGCAAAAAATACAAAAAAAAACAGATTTGATTAATAAGCAGCATAAAATGTAGGTCGTCCACATGGGCCAATACTTAGGATGCAATC
AATAGATTTTTATAAAAATTTTGTGCATTTTTATAAAAATGTACCTGTTGTGTTTTTTAAGGAAGGCATCTAAAATCGTCTTACCAATAAAAGTCTGATTGATCTCTAAATAATCCTTAA
CTATAGATAAAGACAATGCAGTGTCTTTCAAAGTATGCATAACAGTTTTTCTTTTACTTTATGTAAACTTATTGTGTCAAAAAAACAAATATGAAGCAAAAAAACTGATAACAGAATATT
TTTGTGCATGTTTTGGTTGAAACTGAGCCCATCAGAAGTTTCTGAGAACTGATGTGCATTTCCTGTCTCTGTGATGGTAAACCACACATCCCTTGCTGCAAACATATTTTCTTCATTCCA
CTGTAATCACTGACCAAATAAGGACACATATCCACTCCATTTTCTTTCAATAAACATTGAAAACTGTTTGGTATTGGTCAAGCTGTTTTCAGTTTTGAGTCAATGAACACAAAGGTGGTC
TTTGTAACTGAGCTACAATACGGTTTTCTAGAACTTTTAAAGTTGTTGCCAACAACAAATACATCACTCTGTTTTGGTTGCTTAAAATGTTTCATGTTGCCTTTCAAAACTTGAACTCTA
AGTTTGTTTTTGTTTTGCTTCTGTTGGATTTTATATATATATTTTTTGGACATACTGTGGAGTTAAGTTCTGGCAGTAATTTAGGTACTTGATATTGATACCCTAAACACTGACGCATGT
TGAAATCTGAAAATTGTACTAAAGTTCAAGCTCAATGCAGGCCAATATTATCTGATACTCATATTGTGGCTGATATCATGAGGATTTCCGATATCAATATTGGATCAGGACACCCCTATT
TATAAAGCTGTCTGATTCTATATTTAGCTTGCTATTTAGCTTTGTGAAGTAACAGGTTGTCATAATTTGGATTTGTATTGATTTTTGTAGCATTTGGAACAGAAAAAACTTTGCCCTAAC
AAAACATAATGGTGTCATCTGCAAAGAAGAAAATATATTCTAATGTTGACGAAGTTTGTAGAAGTTATCTTGATCCTCGTTTCAACTTTCCTCCACCTTCTTCTCTTGTTCTTCCAGCCC
GGCCAAGTTTTGTCATTCAACCCCAGAACACGGAGGTGCTGGTGGGTGAGAGCGTGACCCTGGAATGCAGCGCCACCGGTCAGCCACAGCCAAGAGTCACGTGGACGAAGGGTGACCGCA
CGCCGCTGCCCAGTGACACTCGCATCAACATCACTCCATCTGGGGGGCTTTACATCCAGAATGTTGTCCGAGAGGATGGAGGACTATACACGTGCTTCGCCTCCAATAATGTGGATACCA
TACATGCTACAGCACGCATCATTGTCCAAG
GTAAAGCTTTTAGATTTAGATTTCTACTAGTGTAAATGTTTTTTTTCTTTTTTTACTATATAAATCCTAAATGTTTTCTGTTGTGTTATT
CATATAAAAACATTCATCAGTCTCACAAAAACTAAGCTAAATTTAATTAGAGTCAATCACAATGCGTACAAAAATAAACACGGGATAAACTTGAATTCATTCCAAATATTCATCACAGTC
TAAACACAACATAGCTGGGTCATCTTGACAGATTAGTAGTTTTTGTACATTTTTTTAAAAAATATTTGGAAAATCTTATTTGTGTTAACAGATAAGATTTAATTGTGTTAATAGATAACC
TTCATGAAAATGTCATATTGTTGTCTTATTTTTTTTCTCCTATTCTGAACAGCGACTCCCCAGTTTACCGTCACGCCACAGGACCAGTCAGTTTTGGAGGGTAACACCGTGGATATTCCC
TGCGAGGCGAGTGGTTACCCAGAGCCAGTGATTGTCTGGACTCGAGGTGGAAACGTACTGCCTTCTGACCGACGACATGCCATTCTGCCTGCCGGTACCCTCCGTATAACTCGTGTTGCG
ACCCAGGACGAGGGCCAGTATGAGTGTGAGGCAGTGAGCCCAGTGGGGACCGTGCGTGCAACTGTGCAGCTCAGCATTGAGCAAAGAG
GTAAGAGACTAAAGGGATCAGATCACTGAATA
ACGTGATAATGTTCCCAGAGCTCATAGTACTTTGGCACAGTGCCATATCACCGGTGTACATGCAAAATAGAAATGTGGTTTGCTCAGAGATTTATCAAACATTTCACTGAATCTAACAGA
GGTGCAGCTTTCACTCTCAAGCACACTACTGACCTACTAACCACTAAGGGGTGTGCAGGGCCTGGGTCTTGGCAAAACTTTGATTCAGACCCAGGAGTCGTTCTGTTAAATGTTCCATCC
ACTGTTGATAGCCATGTTTACTTTGACGTAATTAATCAGAATAAACAGCTGATCTGAATAAAAATGTGCCATGTAAATTCCTCCATCAGAACATTCTGATTGGATTCATGCCAACCCTCT
CATTTTTTTGCCCTGGGGCCTAAGAACTTAGGGGGCCCTAGGCCTGGGGCTCTCCTCAAAGAATTTGTTGTAAAAAAAAAAAAAAAAAAAAGTCATACATTGGTTTACTTAATCTCCTTT
CTGAATCTCGGTTATTTGTATCCACAAATTACAAAATGGCTGTTTTTGTCTAATTTTTGTCCCATCTCGACAATGATGGATGGATGACAAGCATAATGCACAAGACGTATCTGGGCAACA
AGATCATAAACCACCCAAGGAGCTAAAAGGGTTATTTTTATATAACATTATATGTTACGTGTTAAAAGTGTGTTGCAAAAACCTGTCAAAAGTTCACATTGTTTTCATTAATGAGGTTGT
TGCTATGTTATCATTTCAGACAAGAGGAGAGTTGAGCACTGAGTGTTTGGAAGCTGGCAGTGGTGCATCCCATTTATTGCTAATTTGTTGTTTGCCCTGGTCAGTGCACTCCTAAGCTTT
TCTCATTAAAAAAAAATCTCTTTTGGGGTGGAATTAGAGGAAATAAACATTTATTTAATATAATAAGTTAAAAGGCAGTAAAGTTCTGCTACAAGTAAATACAATTTTCTAAAGTTTACC
TGCTTTATTAAGTAAATCAGTAACTGATGTATCCAAACATTCCTCCTGCATGGTTCCCTCAGTAATCAGTAGTAGCAGCCAAATGTTTTCAATATCTATCTGAAATAACCATATGCCATT
GACTGGAGCTGCTGTCTGAGTATTCACCTTGAATTGACTTTTTAAGGGCCAAATACCATTTTGGGCTAAACTGTCTGACTGACAGAGTTTAGTTAGCGAAAACGGACCATTTGGGGAATT
AAAACACAAGTGAAACATTGAGTGATTATCCATAGAAATGTGAGGCTTGCACAATTATGGCAAAGTTTTCTAAGATAAAGTCCTTTGGTGAACGTTGTTGGAAAAAAATTGTTGATTAAA
CCTGAGTGTGAACAGAGCAACACACTCTGGTACCTATGCTTGCCAAAAAGGAACAAAAATTACAATGTCTACCTCAATTTGACCAACTTTATGAGTCATGTTTTTGTAAATTAGGCACTG
GCTCCCCTGTGACACTTCAATTAGAAACAGTTATTGACAATGGGTGGGTTGATCTTTTTGTGAAATTAGTTTTTGTAACACTGGTAGGCTATGCTCACCACAGAATACCTGTACTTTTAA
TCCATCTTGCTAGATCTCTGAGCATTTCTCCTGACTTTCTCCTGCTTGTCGATAAATCCCCATGAAAGTCTTTACTGTATGACAATTTAAGGTGGATTTACTGTTGTTGCTACTTTCCCT
TCAGTTGGCCATTGTGTTATGCCTGGGTTAGATGTTCCAAACATTATGTAATCACTCTTTGGAAACTTTTGGCTGCATTCTCGACTGTCTTGTACTCACTTTTTCTCTTTCATGCTTTTT
TCCCCCGATACTTCTCAATTTTGAGGCATAGAAAGGAATTCAACTATTGTGAGCTACGAGCCTGTGCACAATTGAAATCATGTCTTTTTACGGTTGGCTTAAGAAGTTTGTGTGCTGGTT
AAAAAAAAACAAACTCAGCTGAAGTGATGGACTTGATTGCTCAGTACTACAATGCCTTCTATGTTTGCATGGCTTTTTCCTCGCAGTGTAAGCCATTCAGTTTTATGTGTAGCGGAGCTT
TATTGCCTCCTGTGAACATGATTTCATTGAGTGTGCAGCTGAAATTACAGGCCTGACATAACACAGGAAAGCGTGGCAGCCTGTAATCCTGAGATGACACCATGTTTTTCCATGTAGTAA
TGGCTGTTAACATGGCTTAAAGTACATGCTGCATAATGGCTCCTCAGTGTTTTAGGCGGTGTGTTGGACCACAACCCTGGTGGCAGAGTATGACAGCTGTGCAGCTCCAAACAATGCTCA
GAGATCAACAGTACGACGAGAAAGTGAATCTCATGGGGATTATCACAGAATTTCACATCTTGATTTTCTCATTACACTTCTATCAGCTCTCAACAGTTTGAGTGCAGCTGTGCTCTGCAA
ATCAAATAAAAACATTCCCAGCTGCAGAAATGTTGGGTTCTTTTCGTTTTTAGTGAGTCATATGTTTCAGCTAATTAGAGTCAGGCTTGTACGAAATGTCATCTGTGTGTGTGTGCGTGT
GTACGTGTGTGTGTGTTTTTTTTTCTCTTGCTGAAATATGAGAGAAGTAAAAGGGAGGATGATGAAGACAGTTTAGATTATGAAAAATTAGACAGTACTCCATGACACAAAGACTAACAA
TGCTCTACAGTCTCCAGTGGTGAGTGAGCCACTGATATACAGCCTTGTGCAAAAGTCACAATCTCTCTCCCGTTCTCTAGGGAACCAGATTTTCAAGAATCATCTAAACGTTTTGCATCT
ACAACATGAATATTGTTAAATATAATATATTCTTCCATTCTTCTCTCTTATGCAGCAACCCCCCAGTTCACCGTAACGCCACAGGACCAGTCAGTCTTGGAGGGTCATACGGTGGATTTT
CCCTGTGAGGCAAGCGGCTATCCAACGCCACTGATCATATGGACTCGAGGTGGAAGTCCTCTTCCCTCGGACCGCCGCCACGTCATCCTGGCCTCCGGTACGCTCCGCATCACTCGGGTT
GCTGCACACGATGAGGGCCAGTACGAGTGTGAGGCTGTGAGCACGGTGGGAACGGTCCGCACCGCTGTGCAGCTTATCATCGAGCAAAGAG
GTGAGAAACTTTAAAAAAAAAAAAAATGT
ATTACTTCTATTTAAAAAAAAATAAAATAAAAATTGTAGGATTGCCTCAACACAGGTCTTTTGAGATGCAGAAGCCATCTGTTGGAACACCACCCTGAAATAAAGTTGAATAATGTGTCA
AAAGATGGTTATAAATGAAACAAAAGTACAACTTTAATTAATATGGCCTGTGGCCGCGAAACCCTGTTTTCTTCCTTGTGGTGGTTCATTGCAAAATGCTCTGTATATACGTATATATAC
TTTCTATGTTGGGCTTTGGTGCAAAAGTATTAACTTGCATGTGTGTGTGTATGTTTTAACTTATTCAGTAACGCCTGTTTTCACAAATGCTCCAAGGGACCTGACTGTGGAGTCTGGTCA
GGATGTGCAGATTCCCTGCAGTGCTCGGGGCCAGCCGCGGCCGGTCCTCACCTGGAACAAG
GTTAGAATTATTCAGACAGTTTCTTAGTTATCACAACTGAATTCGGGCAAAGTCATCCC
TCAGCACATTGAGGTTGGACTCAAGGAGTGTCAGTTTTTTATAACAGCCATCTTGATAATTACCGAGGGAATTAGAAAGGGGGGGGCGCACAAACACCAGATATTAAAAAAAAAAAAAAA
AAAGACTCATCCATCATTTACGCTTGGACCAGTTTTCTTTTGCTTTTATGCCATTGGAGTTAATTCAGTGTTGGTGCCCGGTTTCTGCTGAGAATAGGGAAACTATTTTACATGCCTTGT
GCACCACTGCCCTGCATTTTTGCCCTGCCCCAAGAAATAGATAATGTCGTGTTTTATTGGTTAAGGGACAGCAGGAGCAAGGGAAGGAAGACATTAACACAAGAGCCACCACTTCTCCTA
ACACTATGAATTTATTTTACCTTGGAGCTCTCAGATCCCTGAACTTCTCAGTTGCTGTGTCTTTTAGGATGGTGTTCAGATAACAGAGAGCGGAAAGTTCCACATCAGAGAAGAAGGTTA
CCTGGAGGTGAAAGATGTTGGCACTGCAGATGCTGGACGCTATGAATGTGTTGCCCGCAACCCTATTGGATACCAGGCTGCTCGAATGGTGCTTACAGTCACAG
GTACAAAAAAAAACAA
ACAAAAAAAAACATCTGAAGCTTCAAAGTCAACAGAACTACGTTTTTGTCGGTCAAAGTTACTTTCTAAATGTGTTTACAAGAAGAAAACCAGAAGACAAAAGAAACACTCCTGTTATAT
TTTCTTCTCTTTGTTTAAAATTCTACATTAATCTGTTCATCTTTTTCTGTCAGTGCCTGCTATCAGCCGAGAGGGAGACACATTTGTGAGCACATCCATAGAGCAGGCCATCCGTACTGT
GGACAGTGCAATTGAGTCCACAAGGAGACGACTCTTTGACGG
GTAGGACATAACAAACTTGCACCGCAAACATATTACAACACACAGTGTCGCACAAACACATGCATACTACTTGTTTCC
ATTTTGGTATGTTAACAATCCCAAAACTCAAGACAGCATAAGGATTTTATGTGACAGAGCAACAAAAAGAAGGGCATAACAGTGAAGAGGAGTGAAAACCATGTATTGTTTTCAAATATT
ATAAATAAGTACAAATCTGAAAAGTTTGTAGGCTTAAACATGGACTTTGGTGTTGTGTATTGAAGCTCTGGCTGCATGTTTAGGGTTCCTTTCCTTCCAGGTTATCTCATCTCAACTTTG
AACAGCTCTCCCTTGTAAAAATGCACCATCCCCACAGCATAATGCTACCACCCACATGTCTCACAATGTAGATTATGTGTTCAGGACGATCTGCGATGTTAGTTTTATGCCAGAGGGCGT
TTTGTTTGTATTTCAAACAGTTCAGTTTTGGTCTGATCTGAGCAAAGCCCTTTCTTTCACATGATTTTCATGTTCCCCACATGGCTTATGGTTGATTTTTACAAGTTTTTGTTTTTTAAA
CATTTATTTTCCTCAGGATATTAAAAAGCCACAGGTATACTCAAAGATGTTTTATGTTGCTTCAAAGGGATTGAAATTAATATCAAGACTTGTAACTGTGGCCTGATTCATGAATCATCT
TGAGGCCCCAAAACCATGGCTGTCAGAGATGTTAGCCTAAGCTAATTGACGTTGGGCTAAAAATGTGTCAAATGTTTTCAGATCCTCAAAACTCCAAGCTTTATAGGTTATCATAGTGAC
ATATTAAGGTAGTAAATCAAGCAAAACAATATTTTCTAAAACAGCTGCACTGTAAGGAGTTGGAGTATATGTAAATAGTTAAATAAAACCACATGTCTCAATATTTCAGATGATGCAGAC
CGACATGATTGTGGGGTGTAAAGTAAAAGTTTGCCCCAGTTCATGTTGGCACTTGACTTTTTCGCATAAAAACTGAGCATGTAAAACTAAACCCAAGTCATCCAGATGACTTAAATGTTG
CTTCGTGGATGAGGAATCACGTTTTTCACCTTTCAAATGCCTCCACCAAGCATATTTGTCTAGAAATAAATTTCTGTTTCATTGCTTTTCTTTGTCCTACTTGAACTTGTCTCTTATTCG
TTTTCCCTCCTATCTGTGTGAAGCTCTTATTAGAGTCAAAAGGTGATAACAAAGGCTTGGAAGTTTGTCACTGTGAGCAATGGAGATGACCTCAGGTCACCTTTTAGAAGTTTCCATCCT
GTTGAATGATGTGGTTAGCAGTTGTGCTTTTCTTGGCATGCTCACACGTACACTCCTGCCCACCCAGGCGCGCGCACGCAAACATACACACATGAAAATGATAAATTCACACCGCTACAC
AGCACAGCCATAGCTGCTGTTGCGATGAGGGGGGATTTCCAGCTTTGTTAAATCGCAATCACAGAATAGGATGCAGCTTTCTCCTCGGCTGAGTCAGTCGTCTAGAAACAAAGAGGAATT
CCTGCGGGAATTCGGAGCGAGTGCTGCTTCTTCGTCTGACTCAACAACATAGGCTGCTGGAAAACACAAGACAGATCCTGGTTATTTTAACAGTGGTGCGCACTGCTACCCAAAAACTTA
AACCATTGATATATTTTTTGTATTTATTTATTTATTCAGTCATCAAATAATTGACCCATGTTTTAGAATTTAAACAACATGACTGAAAAAATACAGACAGAAGGGCAATGCTTATATGTA
TACCTGGGTGTTCTGAGTACAGAATAAACATCATTTGCTGCACCGCGACACAAGTGGAGGATGTGAGGAGTATCTGTTTTGGAATTGTTGCTATACAAAGGTACTTTAGGGCCGCCATCT
TGGGCCGCCATCGTCCCAAGATCTCCCCAGTTGAGAGCACACACTATGGAGGAGCTGCAGAGATCCACAGCTCAGCTAGAAGGATTTGTTGACAGAAAAGCTACAAGTTGAGCAATCCAC
AAATCTGGTCTTGAGGAAGTAGTAAATAAAGTTTATTGTTGAAATAAAACCATAACTCCCATTTTCTGTTTGCAACAATGCCATGTAGTGACACAGCAAATAGTGTGGAAGAAAGTGCTT
TATTATATGTGTGGTGGAATAGTATCATAACCCATAATGCATGCACATGACATTATGCTTTCGGGATGCTTTTCTTTAGGAAAGGTCAGGGAAGTTAATCAGAGTTTTTTGGAAGATGGA
TTGATCTAAAAGAGCTCCAAAAGATTTGAGAAAAACGCCAGTATCCACTTTTGAGTGAGTGGAAACTGCAGAAACTCAATGACTGGCTTTTCATAAGCTGTGTGAAGCGACTCACATGTG
CATGCAAGGTTCTGTTTGGATTCCTCTTGTTGAAACGCTTCAAAGGAGAAACTAGAGCAAGCTCTGTCTTCTTCTGATACCTCAAAAGTTTGAGGAGAAGATACGTTTCCTGATCTGTTT
TGTTTGTTATTTTAACATATGCTTCTCATCTCCTGCCTTCCCAACAATCTTCATGCCCCTCATCTCTCCAGTCAGCCTCGTACTCCAGGAGAGCTGCTCGCTCTTTTCCGATATCCACGT
GATCCCTACACGGTGGAGCAGGCCCGTGCCGGGGAGATCTTTGAGCAGACTCTCCTTCTCATCCAAAACCACGTCAACCAGGGTCTCATGGTGGACACCAACGGTACCG
GTAAGGCTGAT
TGCAAACTTCACCACTACTTCATAAAAGTTGTTTCTATATGCTGGAGAGAGTACTGTCTTTGTAAAAAATTATTTGAAATGCATGTATATCCTTCCACTTTGCCCTACTTGTGTTGTCAG
TGACATAAAACACAATAAAGTTTTGTGTTGCGACGTGACTTAACGTAGAAGAATTCAAGAGCTATACAAACTTTTGCAAAGCAGTGAAGTTGTGTGTTTGGTAAGTAAGACATTTCCATC
CAGTCTCATTTTGTATTAAGCCCAATTTTCTCATCTCCCCTGACTGTGACTCTGTGACTTTTTGTTGTTGTGAGCAACAGTCGACTCTGTCACAGCTTTCGGTCTGTCTGCCGTTTCCCC
CTGTAGTTTAACCTGAGAGAGTGTCGTAACTGTGGAGCAGTTGACAAGTAGCCTTTAAACTGGTTTATTGGCCTCTTGACATGCTGTGAAACACTTAAAACTGTAATCGCTGCAGAGCAC
TGGACAAAGTTTAACACGATGCGTTGCACATTTAATTAGGACTGTGTGTAGGCGTGTGTGTGTGGGTAGACTTGGGCGGAGCAGGGCGGTAACTGACTATTTACCACATAAATATCTACA
TTTTTGTTGCTCTTCTCTAGTTAGTGTGAAGGAAAACTGGAGCAGCGTTGTGTGCCTGGGAACAAAACCAACCAGCTAAGAGAGGAATACATTTTAGAGAACAGAGTCAAAGGCGAAATG
CAGTGAAAACAAAGCATGTATCAAATTTATTATCTTGGGGTTTTTTTGTAATACATTTCATGGACAAGCAGATATACATTATTTTCTTTCAGAAAAGAATAGAGGTAATAGCTCATTATG
GAAATGGTAATGGTACGAGATGCATTTTAAATGCTGTAAGTGTAAGATGATGACTCCAGACTAAATGAATGCAATGATTTCAGCAGAAACAAATCAGTATTTTTCCTTTACTTTACTTTG
ATCTCATCCTATAGATCAGCAATACAGTTTCTCCTATCTTTCTTTTACAAAAGTGCACATAGTACACAGACAATGCCCAGGAACATCATATATGAAGGAACTCTCACCCAGAGCTTGGTT
GCATTTAGCCTCTCTTCTTAGTGAATTTATTTTTGTGTTTTTGCAGCATTTCGCTACAACGATCTAGTATCACCCCGGTTTCTGGAGATGATTGCTAATCTCTCTGGCTGCACAGCCCAT
CGCCGCAACAACAACTGCTCAGACATTTGCTTCCACCAGAAGTACCGCAGCCACGATGGGACCTGCAACAACCTGCAACACCCCATGTGGGGTGCCTCGCTCACTGCGTTTGAACGTCTC
CTGAAGCCAGTCTACGACAATGGCTTCAACCTGCCCAGAGGAACCATAGACAGGGTTCATAACGGTTACCGACTGCCCCTGCCTAGGCTGGTGTCCACCACAATGATCGAAACAGAGACC
ATCACTCCTGATAGTCGCTACACTCACATGCTGATGCAGTGGGGTCAGTTCCTGGACCACGACTTGGACTCCACAGTAGTGGCCCTGAGTCAGGCTCGGTTTTCTGATGGCCAGCTGTGT
GCTCAGGTCTGCACAAATGACCCGCCGTGCTTTCCAATCCAGTTCCCACCCAATGACCAGCGGCAACTGCGAAGCGGCGCTCGCTGCATGTTCTTTGTCCGTTCCAGCCCAGTGTGCGGT
AGCGGGATGACGTCTCTGCTCATGAACAGCGTTTATCCGAGAGAACAGATCAACCAGATCACCTCCTACATTGACGCCTCCAATGTCTATGGCAGCTCACGACATGAATCTGAGCAGATT
CGCGACATGGCCAGCCACAGGGGGCTTCTTCGTCAAGGCATCATACAACGGACAGGGAAGGCACTTCTTCCATTTGCCACAGGACCGCCTACTGAGTGCATGAGGGATGAGAACGAGAGT
CCAATCCCTTGCTTCTTGGCTGGAGATCACCGTGCTAATGAACAACTTGCCTTGACTTCTATGCACACTGTGTGGTTCAGGGAGCACAACCGCATCGCTACAGAACTGCTGAGACTGAAT
CCCCACTGGGACGGCGACACCATCTACCACGAGACCAGAAAAATAGTGGGGGCCCAGATGCAACACATCACCTACAATCACTGGTTACCAAAG
GTAACTGCTCTGACCTTAAGCTTTTAT
TTTGACATTTTCATCACATTTATGGATATCTCCATATTTTCTTGGTAACCAGTCAGATGACACTGACAAGATAATAAGTTTTTTGTTTGTTTTCCTTCCCTATAGATACTCGGTGAAGCA
GGCATGAGGATTTTAGGGCCGTACGCCGGTTACGACCCCAATGTTAACGCTGGCATCTTCAATTCGTTCGCCACAGCAGCTTTCCGCTTTGGACACACCCTCATCAACCCAATACTCTAC
AGGTTAAATGAGCACTTTGAACCTATCACCCAGGGTCACATCTCACTGCACCGGGCCTTCTTCTCACCTTTCCGCATCGTAAATGAGGGAGGCATCGACCCGCTCCTTCGCGGACTGTTT
GGTGTTGCTGGAAAGATGCGCGTTTCCTCCCAACTGCTGAACACTGAGCTGACGGAGAAGTTATTTTCCATGGCTCATGCTGTGGCACTGGATCTGGCTGCCATGAATGTTCAGAGAGGA
AGGGATCATGGCATACCACCATACAATGACTACAGGACCTTTTGTAACCTGACCTCAGCTCAGACGTTTGATGACCTGAAGAATGAAATCAAAAACCCTGATGTCAGAGAAAAACTGCGA
AG
GTAACTGTGAACTAACTGCTGCTTATGATTATTGTCTATTCTATGTTATGTTATATTTGGAATATTTATTGACTGAGAGGTTCTGAGTGGCAGGAACATGGTTTGGCTTTTGTTTAGG
AATCTATCGCAAAATGAAGCTAGGTTCCAGCATTACAAAAAAAAATAAAAATTATGACTATTTTTAAGTTGTTGTTTTTCCCCCCTTCTTCTACTTGTTAAGTTTGTATTAATTATATTT
TTAACTCAGAAATATTATGAATTGGCAAACAAAACGAAATATTTTTTTCAAAAATAATCTTTTGGTATAATTATGATATCTACCAGAGCCACATAATATCTATACTGGGACCAGAGATGA
CATTGTTAATATGTGTGAAAGAGCAGCTAATGATGCAAAGCTCTCCGGTAAACATAATTTCACTAATGTTTGAAAAAAAATGAATACAAAGCTCACAACTTACACTATCTTTAGGGTCTA
TAGTAACAATTTACAAATAAACAGTGCAAGCAGTTAACTGAGTTGTCTTCACTCACCACTTATAAATTGTGCATTTACTGAATGCAGTTTCTTAGTACAAGATAAAATATTGAGTTGCTG
AGCAGCCTTTCAATGGTCAGAGCCAGTCAAGCATAATAATCTTGAGTATTTCAATTTAACAACATCAGATTTCTCTGCATCCATAGTTTTGTCTTATGATGTGTGAGGATGCACTTTCTA
AGTATCTAAGTTGATTTTAAACATTCCTTTAAACTCAGAATCCACAGAAATGTCCTAATTATGTGGTGAGAGTGGCTTCAGTTTTTTTTTTTTTTTCACTGGCACCTTTCCTTGTATGAC
AGGCTATACGGTACGCCTCTCAACATTGACTTGTTCCCAGCCCTGATGGCTGAAGATCTGGTCCCTGGCAGTAGATTGGGTCCCACCCTCATGTGTCTGCTCGCAACGCAATTCAAGCGT
GTCCGAGATGGAGACCG
GTAAGGAAGTATCATCCACACATCACCAGATATATACAAATATGACCAGATTTTTCTTCATCACTTTCGTCGTGTCCCGCATCATGTCTTTGGGTCTCGATTA
GGTTCTGGTATGAAAACCCAGGTGTCTTCGCTCCTGCACAGCTGACACAACTTAAGCAAGCGTCCTTAGCTCGAGTCGTGTGTGACAATGGAGACAACATCACCCGGGTGCAGCGGGACG
TGTTCGCAGTGGCCGACCTGCCCCACGGATACGGAAGCTGTGATGATGTTCCTCAGATCGACTTGCGGATGTGGCAGGACTGCTGTGAAG
GTAAGACCAGCAAAACCAATTTTACGCTGT
TTCTTTGATTACGTTTCAAAAAAAAAAAAAAGCCAATCAATCCTGGTAAAAACGGCCAGATTTACTCCGTGCTGGCATGTACCGTAAAATATATTATGGACGCTGACTGCAGGATGCAGT
CAATAAAGCTTTGTAATTCTCACAGACTTTTGAAATCCACGCTTAAGTAGAGCACACAGATTGTTGTGACATGTTATAGCAATGCTATTGAAGTCCAACAGGATTCTTTCAATTTAAGCT
TTTTCAGTAATTGTTTGTGCTGGAAAAATAAATTTTATGTAGCAACAAGAACCAAATGGCAAGTTCATTCATGCTTTATTTTTTTAGGACACTTTGATTTCTGCAATGTATAAAACACAG
ATGGAATCACTCAATTCGAGGTTCAAAAGCATAAACCGTTTCAAACTTGTAATTTGTGGATAAGACCTTAGAAATCTGAGGTTTTCTGGGCATAATCTTTGTCTCAGTTTAACTTTTACA
ATTTACTTTAAAAGAGAGCCACTGGAGACACCCAAAGCCGCTCCTTCAATGCTAGCAATTCATAATTGTAGCTTCAAAGCTTAGTTATTGAAGGTCATTATGAAAAAAATTGAGTGTTAA
ATAAACTTCACTGTGAAACTGTTAACACCTTAATAAGAACACAAACAATTTCTAAAAACGGATCCATCATTTCTTTAGCTTGTAAACTGTAAGAAGACTTAATTAAAGGTATTTACTCAC
TGCAAGTTGTATAACTTTGATGTTATCTGGAGATCAGATTTGGACTTTTTAACATGAAGCTTGAAAACCTCAGACGTAGGACATTTTTTTACAAAGATTTTAGTGTATCAGACGCCTTCA
GGGTGTTTGGTTTGGAAATGTTTTTGGGGGCCAATGAGGATTATATTATTTATAATGCATTGCATATTGGTGCATAAATAGAATCGAAAAACTGGACTTGTCTGTTCAGCTTCTGATTGC
TGGTTGAACCTGTTCTCCATCAGACTGCAGAACCAAGGGTCAGTTCAATGCCCTGTCATACCACTTCAGGGGACGGAGATCAGCTGAGCACAGCTACCAGGAGGAGAAACCTGACAGCAG
CATCCAAGATACAAG
GTAGCAAACACTGAATCTTCTTCATTGAATATTTTTCAATCATAGCCAGAATATCACTGATATGTATAACCTATGTGAGCTTATGACTTTTTAATGTGTTTACAA
TCGTCTTTCCAGCCCTCTGGAAGAAACTCAAAACAGTCTTTCAAATGTCACTTTGAGCTCCAAGTTGAGCAGTGAACCTTCAGCTGGTGACTTCCAGGAGTTTGTCTCAGACATGCAGAA
GACCATCACAAGCTTAAGGAAACAG
GTGCGTTTGGACACACACTGACACTATTTGAGCTATCAGTCTGGCAACAAATGCAACAAGCCTCCTTAATGCAGAAAATCCAACAAGAGCTCAAC
AGCTTTTTGCTTACGAAAATCAGATATGAACACATAGAGCTTTTCTTCCTGACTTATTGGTTTGCACTCTTTATGTAAGATGTTGCTGTCTTTAATGAGAACATAAAAGAATCTTACATG
AAAATCACAATTAATATTACCTGAAATGTTTGTCTTCCCTGCCCTGCTAATAAAAGCAAAAAAAGAAACTAACATGAAAAATGACTTCAATAATGCCTGAACTAAAATGGAGTGATGAGG
ATGTGGACTCTAATTCCAAACAGATGTCACAAGACAGCCTCAACTTTGAGCCTTTATCTGGGACAAGTATGGTAACAAATAAGGTTTTAGACTGACTTCTTCTAACTTTACCAAGTATTC
TCCAGTAATAGCTCAGTCATCACTGGTTTATAAATCTGTCAGATTTTTAACTGCCGATGTCATGTTTGCGTTGCATTTTGCCTCATTTTAAACCTCTGAAACCTCCAAGAGAAAGAAACT
CTTTCTTTTATTACTTCCCCATGGGATTATTAAAAAGTTACACATGAAAACAATATGCCTGCGTATTCAGAACTGAATTGGCTATTACATACATTGCATTTCCTGGAATGCACAGCAGAA
AGGGATCATGGATTTTCCTGCAGCAGACATTTGTTCACTTTTGCCGTCTGCAAAGAAAATCTGTTCTGATGCACGAGAGCGTTTTATCCATTAGTTGCAGGTTTTGATTTACTACTTTCA
TTTTTGTCCCGCAAAAAATTCTCACATTGGTAAATTGCAGCTGTCTCTCGGGTTTTTGCAGATTAAAAAACTGGAAGCTCGTCTACACAAGTCCACCTGCGCAGACGGCGAGGGGCGCGA
GCGGACAGATGGAGAGCGCTGGCGAAAGGACTCATGCTCGACGTGCGAATGCAGA
GTAGGTGCACACTGATGTGCAGTAGGCAGAACACACCCCACACCAGATCTCGTTACACTGTTTCT
GTGTTTCTCACAGATGATGGGATGTCTATTCTATTTTTAAAGCACCTTCTGCCTCTTGCACTTTCCTGCCACCGGTCCACAGTTTCTTGCCACGTTTCTGTCTTTCATTCCTTGTCTGTT
TCCAGCTAACCGTAACTTCACACACCTCTAATGCGCCTCCCTCATGATAAATCTTACTGCTACTGATCTCTTTATAGTTTCGTCTTTTCAGTTCATTTTTGCATTACACAGCTGACGAAC
ACACCAGTAAGTCTTCTTGTTTACAAATGGAGATCTTAAAAGTCGAGCCGAGTCAATACTCAAAAAAAAACAACCTTTGCTTTGATTACAGCTTTAAGTCTTTTGGAGCATGTCTCTACC
AGCTTTCCCCATGTAGGGACTGAGATGTTTACCCATTCTTTGCAGTTGAAGGTCAGTCTAATTAGATGGTCTATGAGCATACATTTACAAGTCATGCCTTAAATTTTCAACTGTATTCAG
GTTTCTACTTTGACTGTCCCATTCCGTCACATGGGTATGCTCTCATCTAAACCATACGATTGTAGCTCTTGTTGTTTGTTTCAGGTTTTTTTTTGTCTTGTTTGATGGTTAAAGAGGGTC
CAACTCCAGAAAGTGAGAGGCTTGAATGCCTGCGATGTTGATTGGTCGTGTGAACGCAGATGGGACTATGAGGGGAACATGTGGAGGAAGCTGAGGGAAAATGACTACTATAAGCAAACC
TAAAGGGAAGCAAAATGGAGAATAGAAGGTTGCAAAAGAAAAGCTAAAGATGAAATACAAATAAGAATGTAAATATGGAGCACCGTGCATGACAGGACCAAAAATAATCAGAGAATTGAA
AAAGATCACGGCATTATAGTCCTACTTGGAAGATGAACCTCCACCCAGTCTGAAATCTCCTCCAGGGTTGAGCGTAATTCATCATGCTGCCACTACCTTAACGTAACCATGACGATGGTA
TGGTCAGAGTGATGTGCACTATTAACTGACTCTTAATCTGAGCTGGCTTTATACTGATAACAAACTGGACTCTATGTACTTATCAGGTGATGTGCAAACATTTGATTGCAATGATTTTTC
TGATTTTTATTTATTTTTTTAACATTTATTACTATTTCATTACTATCCCCTCCACTCAGGATGCCCAGGTGACCTGCTTCATCGAGTCGTGTCCAACTGCAGAGTGCAAACAGCCCATCA
AGCTAAAAGGTGCCTGCTGCCCAATGTGCCTCCAGGAGGACGATGACAACAAGAGGCAAAAAGCTGACACCCACCACAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGACCTGAGATTCAACAAAATCAAGGATTTACAACCAGGCTCCTTCAGGCGATTAACAAACCTCAACACACTTCTCCTCAACAACAATCATATACGAAGGATTCCCAGGGGAGCG
TTTGAAGACCTAGAAAACCTCAAGTATCT
CTATTTGTACAAGAATGAAATCCAATCAATTGACAGACAAGCATTTAAGGGCCTTGTCTCTCTTGAGCAACTCTACCTGCATTTCAACAGC
ATCGATTCTCTGGAACCGGAATCCTTCAGCCATCTGCCGAAGTTGGAACGACT
GTTTTTGCACAATAACAGAATAACACAGCTCATCCCAGGAACCTTCGCTCATCTTCAGTCCATGAAA
CGATT
GCGGCTGGACTCTAACGCTTTAAGCTGTGACTGTGAGCTGCTGTGGCTGGCCGACCTGCTGAAGCAGTACGCCGAGTCAGGAAACGCCCAGGCTGCTGCCACCTGCGAGCATCCC
AGTCGACTCCAGGGCCGATCAGTGGCCACCCTCACTGCTGAGGAGCTCAATTGCG
AGGTACCGAGGATCACCTCAGAGCCCCGGGATGTCGATGTTACATCAGGAAACACTGTTTACTTC
ACCTGTAGGGCTGAGGGAAACCCCAAACCTCAGATTATCTGGCTCAGGAACAA
CAATGCTTTAAATATGCGAGATGACAATCGTCTGAATCTCCTGGAAGATGGGACACTGATGATTCAA
GACACCAGAGAGACTGACCAGGGAGTTTACCAGTGCATGGCCAAAAATGTAGCCGGGGAAGTCAAGACTTCAGAGGTCACGCTTCGATACTTTGGAGCCCCCT
CCCGGCCAAGTTTTGTC
ATTCAACCCCAGAACACGGAGGTGCTGGTGGGTGAGAGCGTGACCCTGGAATGCAGCGCCACCGGTCAGCCACAGCCAAGAGTCACGTGGACGAAGGGTGACCGCACGCCGCTGCCCAGT
GACACTCGCATCAACATCACTCCATCTGGGGGGCTTTACATCCAGAATGTTGTCCGAGAGGATGGAGGACTATACACGTGCTTCGCCTCCAATAATGTGGATACCATACATGCTACAGCA
CGCATCATTGTCCAAG
CGACTCCCCAGTTTACCGTCACGCCACAGGACCAGTCAGTTTTGGAGGGTAACACCGTGGATATTCCCTGCGAGGCGAGTGGTTACCCAGAGCCAGTGATTGTC
TGGACTCGAGGTGGAAACGTACTGCCTTCTGACCGACGACATGCCATTCTGCCTGCCGGTACCCTCCGTATAACTCGTGTTGCGACCCAGGACGAGGGCCAGTATGAGTGTGAGGCAGTG
AGCCCAGTGGGGACCGTGCGTGCAACTGTGCAGCTCAGCATTGAGCAAAGAG
CAACCCCCCAGTTCACCGTAACGCCACAGGACCAGTCAGTCTTGGAGGGTCATACGGTGGATTTTCCC
TGTGAGGCAAGCGGCTATCCAACGCCACTGATCATATGGACTCGAGGTGGAAGTCCTCTTCCCTCGGACCGCCGCCACGTCATCCTGGCCTCCGGTACGCTCCGCATCACTCGGGTTGCT
GCACACGATGAGGGCCAGTACGAGTGTGAGGCTGTGAGCACGGTGGGAACGGTCCGCACCGCTGTGCAGCTTATCATCGAGCAAAGAG
TAACGCCTGTTTTCACAAATGCTCCAAGGGAC
CTGACTGTGGAGTCTGGTCAGGATGTGCAGATTCCCTGCAGTGCTCGGGGCCAGCCGCGGCCGGTCCTCACCTGGAACAAG
GATGGTGTTCAGATAACAGAGAGCGGAAAGTTCCACATC
AGAGAAGAAGGTTACCTGGAGGTGAAAGATGTTGGCACTGCAGATGCTGGACGCTATGAATGTGTTGCCCGCAACCCTATTGGATACCAGGCTGCTCGAATGGTGCTTACAGTCACAG
TG
CCTGCTATCAGCCGAGAGGGAGACACATTTGTGAGCACATCCATAGAGCAGGCCATCCGTACTGTGGACAGTGCAATTGAGTCCACAAGGAGACGACTCTTTGACGG
TCAGCCTCGTACT
CCAGGAGAGCTGCTCGCTCTTTTCCGATATCCACGTGATCCCTACACGGTGGAGCAGGCCCGTGCCGGGGAGATCTTTGAGCAGACTCTCCTTCTCATCCAAAACCACGTCAACCAGGGT
CTCATGGTGGACACCAACGGTACCG
CATTTCGCTACAACGATCTAGTATCACCCCGGTTTCTGGAGATGATTGCTAATCTCTCTGGCTGCACAGCCCATCGCCGCAACAACAACTGCTCA
GACATTTGCTTCCACCAGAAGTACCGCAGCCACGATGGGACCTGCAACAACCTGCAACACCCCATGTGGGGTGCCTCGCTCACTGCGTTTGAACGTCTCCTGAAGCCAGTCTACGACAAT
GGCTTCAACCTGCCCAGAGGAACCATAGACAGGGTTCATAACGGTTACCGACTGCCCCTGCCTAGGCTGGTGTCCACCACAATGATCGAAACAGAGACCATCACTCCTGATAGTCGCTAC
ACTCACATGCTGATGCAGTGGGGTCAGTTCCTGGACCACGACTTGGACTCCACAGTAGTGGCCCTGAGTCAGGCTCGGTTTTCTGATGGCCAGCTGTGTGCTCAGGTCTGCACAAATGAC
CCGCCGTGCTTTCCAATCCAGTTCCCACCCAATGACCAGCGGCAACTGCGAAGCGGCGCTCGCTGCATGTTCTTTGTCCGTTCCAGCCCAGTGTGCGGTAGCGGGATGACGTCTCTGCTC
ATGAACAGCGTTTATCCGAGAGAACAGATCAACCAGATCACCTCCTACATTGACGCCTCCAATGTCTATGGCAGCTCACGACATGAATCTGAGCAGATTCGCGACATGGCCAGCCACAGG
GGGCTTCTTCGTCAAGGCATCATACAACGGACAGGGAAGGCACTTCTTCCATTTGCCACAGGACCGCCTACTGAGTGCATGAGGGATGAGAACGAGAGTCCAATCCCTTGCTTCTTGGCT
GGAGATCACCGTGCTAATGAACAACTTGCCTTGACTTCTATGCACACTGTGTGGTTCAGGGAGCACAACCGCATCGCTACAGAACTGCTGAGACTGAATCCCCACTGGGACGGCGACACC
ATCTACCACGAGACCAGAAAAATAGTGGGGGCCCAGATGCAACACATCACCTACAATCACTGGTTACCAAAG
ATACTCGGTGAAGCAGGCATGAGGATTTTAGGGCCGTACGCCGGTTAC
GACCCCAATGTTAACGCTGGCATCTTCAATTCGTTCGCCACAGCAGCTTTCCGCTTTGGACACACCCTCATCAACCCAATACTCTACAGGTTAAATGAGCACTTTGAACCTATCACCCAG
GGTCACATCTCACTGCACCGGGCCTTCTTCTCACCTTTCCGCATCGTAAATGAGGGAGGCATCGACCCGCTCCTTCGCGGACTGTTTGGTGTTGCTGGAAAGATGCGCGTTTCCTCCCAA
CTGCTGAACACTGAGCTGACGGAGAAGTTATTTTCCATGGCTCATGCTGTGGCACTGGATCTGGCTGCCATGAATGTTCAGAGAGGAAGGGATCATGGCATACCACCATACAATGACTAC
AGGACCTTTTGTAACCTGACCTCAGCTCAGACGTTTGATGACCTGAAGAATGAAATCAAAAACCCTGATGTCAGAGAAAAACTGCGAAG
GCTATACGGTACGCCTCTCAACATTGACTTG
TTCCCAGCCCTGATGGCTGAAGATCTGGTCCCTGGCAGTAGATTGGGTCCCACCCTCATGTGTCTGCTCGCAACGCAATTCAAGCGTGTCCGAGATGGAGACCG
GTTCTGGTATGAAAAC
CCAGGTGTCTTCGCTCCTGCACAGCTGACACAACTTAAGCAAGCGTCCTTAGCTCGAGTCGTGTGTGACAATGGAGACAACATCACCCGGGTGCAGCGGGACGTGTTCGCAGTGGCCGAC
CTGCCCCACGGATACGGAAGCTGTGATGATGTTCCTCAGATCGACTTGCGGATGTGGCAGGACTGCTGTGAAG
ACTGCAGAACCAAGGGTCAGTTCAATGCCCTGTCATACCACTTCAGG
GGACGGAGATCAGCTGAGCACAGCTACCAGGAGGAGAAACCTGACAGCAGCATCCAAGATACAAG
CCCTCTGGAAGAAACTCAAAACAGTCTTTCAAATGTCACTTTGAGCTCCAAGTTG
AGCAGTGAACCTTCAGCTGGTGACTTCCAGGAGTTTGTCTCAGACATGCAGAAGACCATCACAAGCTTAAGGAAACAG
ATTAAAAAACTGGAAGCTCGTCTACACAAGTCCACCTGCGCA
GACGGCGAGGGGCGCGAGCGGACAGATGGAGAGCGCTGGCGAAAGGACTCATGCTCGACGTGCGAATGCAGA
GATGCCCAGGTGACCTGCTTCATCGAGTCGTGTCCAACTGCAGAGTGC
AAACAGCCCATCAAGCTAAAAGGTGCCTGCTGCCCAATGTGCCTCCAGGAGGACGATGACAACAAGAGGCAAAAAGCTGACACCCACCACAAGTAA

Retrieve as FASTA