Entry information : Pret2CysPrx02
Entry ID 13817
Creation 2016-06-27 (Harold Duruflé)
Last sequence changes 2016-06-27 (Harold Duruflé)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-06-27 (Harold Duruflé)
Peroxidase information: Pret2CysPrx02
Name Pret2CysPrx02
Class Typical 2-Cysteine peroxiredoxin    [Orthogroup: 2CysPrx001]
Taxonomy Eukaryota Metazoa Chordata Actinopterygii Poeciliidae Poecilia
Organism Poecilia reticulata (guppy)    [TaxId: 8081 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Pret2CysPrx02
start..stop
S start..stop
Xl2CysPrx04-2 438 6e-158 10..259 6..266
Xl2CysPrx04-1 437 2e-157 28..259 34..265
Xt2CysPrx04 430 9e-155 33..259 43..269
Mmul2CysPrx04 430 1e-154 30..261 40..271
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..211 211 N° 2 1620..1737 118 N° 3 1827..1943 117 N° 4 2088..2210 123
N° 5 2668..2798 131 N° 6 2927..2961 35 N° 7 3151..3201 51  
join(1..211,1620..1737,1827..1943,2088..2210,2668..2798,2927..2961,3151..3201)


exon

Literature and cross-references Pret2CysPrx02
Cluster/Prediction ref. Genebank:   103475421
Protein sequence: Pret2CysPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   261 (231)
PWM (Da):   %s   28692.58 (25709.1) Transmb domain:   %s   i13-30o
PI (pH):   %s   6.67 (6.67) Peptide Signal:   %s   cut: 31 range:31-261
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESGFSTGAKKELLCAFCAALLLVSAIASAEEGAHLKNSQCHNYAGGHVYPGEAFRVPVSDHSLHLSKAKISKPAPNWEGTAVIDGEFKELKLSDYKGKYLVFFFYPLDFTFVCPTEIIAFSDRVHEFQAINTEVVACSVDSQFTHLAWINTPRKQGGLGPMKIPLLSDLTHQISKDYGVYLEDQGHTLRGLFIIDGKGVLRQITMNDLPVGRSVDETLRLVQAFQYTDKHGVCPAGWKPGSDTIIPDPSGKLKYFDKLN

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTGTATGGGG TCTGCATTCA AACACAGCTA AAACATCTGG ACTTATTTAT CACTCTTATT TACTAATGGT GAGTGGGTTT TTTTTTTTTT TACCCTTTTC AAATCAACTT TTTCATTCAT  GATACTTGGA TTACACCATT TCTGACATTA AGATTAAAAT GAATATAGTG AAACACAAAA CAGTTGGGAG ATGGGTAATC TGAAGAACAT CGTTGCCACA TTCTCATTGA AACACGTATT  TATATTTTTA AGATATTTTG ACTGTGAGCC ATATGAGCAA GATCCGGTTT AAATTGCCAG TCCCGATGAA TTATCTGAAG TTCCCATCTA TGAATTTAAA ACTTCAAACA AGTACCTATG  ATGCTTTTCT TAAGCTTCTG TATTTAAAAG TGTTTTTCTT AAGCGTTAAG TTCTTAAACT TCTGTATGGA TAGTGTACTC CATATTGACC TTTTTGTTGT TACGCTCTGG ACATTGTTGA  GGTGCAATAA ATCTCACTCT TCATGTCAAA CCCACCTGCA TGTCTTTGAA CTCTTTTCTC CTTAAGTGTA AATGATGATA ATAGATCCTC AGGCAGTTAT TACCCAGACA TTTTTGACCT  TTCATGACAG AAATACCTCA AAAGGTTTGA TTCAACCAGT ATGTTTCCAT TAAAAATGCC ACATTAAAGA AGAAGTGCAG AGGTTTCTTG TATCTGTATG TACCTGACCC AGCTAAACAT  GCGCAGCTAA ATATGCTGAA AGTAGCTTCT CATCTTTGAT TTACTCCATA ACCAGAGATA TGAATTTACA TTTGTTGTAG CTTTTCAGCG ATTTTAGAGA GAAATTGATT GTGGATGTAA  AGTTTGTCGT ACATATCCTA AATTCTGGGA GTCAGGATTC CACTGAATGT GTATTTATAG AAGTAATAAA TCTTACGGCC TCGATATAAA CTCATCTTTC CAAATTGAAG ACTTGTTTGA  TTAAGTATTT CTGACCTTGC AGCTTTTTAT GACATTACTT TATTCACGAA AGATGGTTAT TTTACCAGAT GCAGCAAATG TAATTATTAG AAGGTGGTGC ATCAGAATTT CCATTTGGTT  TCAATACATA GTACAAACAT ATTTGATAAC ATACATTGTT GTGAACATGC TGCATGTCTA CACAAGCTGT TGGCAGCAAA TACAACTTTT AACTTTCAGC TGTTTTTAAA CACTGGCAGC  CTTTTTATAA GATCAAAATG TCTTGTATGG ATGTATTATA ACTGGAATAA AAATGGCTGC TGTTCAGTTA CTTATGGAAA GCTTACATTT GGAGTAGCAA GTAATTCAAG AAGAGTGTAT  GAACAGTCTG GATCTGAGTG AACCCTGGTA ATAAAAAAAA TATTAAGCTC TTTTGTTTGT GTGCAATTTG TATTAAAAAT TACCTTTAAT CTCATTTGCT ACATGGTTTA TATGAAGTGC  AATCAGACGT TTTCTGGCCT GTCTTTCAGT AAAGGTCTTA GATTTGTGAA GTGCATGACT AACATCTTGT TAACAGAATA ATCCACATGA GCTGTATATC TGTGTAGCTC CTCCAGAGTT  AAAATGAGCA CTTTTCATGA AGGGGTTCAA TTCCAAACAT TAGTGATGTT TATAGCCAAA GATGACATTT GCAGCTTCAG TTTGTGCTTC ATTGGTTTGA AACATTTTAA AGCATTTCAT  TGGTTGAATT AAGAATGTTT TTCTGATGAA AGTTTTATTT AGGGGTATAA ATGTAATGAG GTTGCAAAAA TCTTGAAAAT TATGCTTCTT TCAGTACACA CAGAATAAAT TATTTTACAA  GGATATGCAT CTGGTGGCTT TATATATTTT CACTAACAAT TAATCTGAAA TTTTAATTAC CTCCAGAAGA TGGCGGTAAT GCGGCAATGA GGACGCCAGC TGCAGGAAAT CTCCAAATGA 
CGAAGAAGAA GAAGATAAGG AAGAAGGCTT CATTCCTGCT GAAAGTCTGA AACTCTACGT GCACACGGGG AGACCACACA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAACATTTC TGCTTTCCCT CCCAAACTTT TTAATTTCAA CCAAGTTCAA ATAAAATCTT TTATTTTTTT TTCCTAATTT TTGGTGTCTT GTGTCATTTT TTGATTTCAT GTTGCATTTG  TGTTTTCCCC TAAACTGGGG TACTTATTGC TGACTGGATG ATCCCCATAA GTCACTAGTG AAGGAATTAG TATGCTATGC TGCCTTATGA TTAATATGAA CACTGCTTGT TTAGTACTAA  AATAAAAAAT TCTAAACATA GAATTATGTT GGGGCACATA CAAATTATGA TGAATTTCAG GCTGTGTATT TATTATCCAA CAGGTGATAA CTGGTAGTTA ATATTTCGTC ATCGCTCCTT  TGTTTTCAGC AGCTAATCAA GTATTAAAAT GAGGCTGATC AGACAAGTTT TCTGGGATGG GAGATAATTT TTTCCCCTCC TTCTTAAGAG GAAAACTCAC TCCACTTTAT TGCCACTAAC  CATTAAACAA TTCATCCCGG TTGCCTGTTT AACAGTTGCC TAGGTAACCG TTAAACAATT CTTCCTGGAC AATAAATCTG GTCAAAGTGA AATTTCCCAG CAACAGCCAC GGTGCTTACT  ATCACTAAGT AGCATTTTAT GATCAGAATA TTTATTATAC ATATATATAG TTTTGAGATT TTAAATGTTT TTACGTATTC TTATGGCTTA CTATGTGGCT TTAGACTTCA GCACATTTTG  AAGGCCGCCT TCATAATTTG AAGACATGTG AAGAAGACCT TTACCCAAAC TATGACATTT TGCACTAGAA ATGGTAAGTT AGACAATGCC ATAAAACAAA ATTGCAATAA ATAAAGCATT  TTCAGTATCA GTATGTGGGA GCATTCCCTC AGTCAGGTGG AGAATACCTA AAGTCGGCTC GGACCCAAAC AACTCTTTAC AATGTAGAAT AGATTATGGA CAAAACAATG TTGTTGGCAT 
CTGAATCAAA TCTTGTAATG CAAGTGCACC TTGGACTGTC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCTGGTTTCAGCACTGGTGCAAAAAAGGAGCTGCTGTGCGCCTTTTGCGCTGCCTTGCTCCTTGTCAGCGCAATCGCCTCTGCAGAGGAAGGCGCTCACCTGAAGAACTCCCAG
TGTCACAACTACGCTGGAGGACACGTATATCCTGGAGAAGCTTTCCGTGTGCCCGTGTCCGACCATTCCCTGCATCTCAGCAAAGCCAAGA
GTGAGTTCCTTCCTCCCCTCACTGCTTTT
AACCCCACCGGTTATTGAACCGATGTTTTGCACGCTGAAAGTTCCCGTTTTTAGATGCGTTTCTTGTTGGGAAGCCACTGCTGTGCCTGTGGGAAGATGACAGATGCGCACTGACTCAGC
CTGCGGATGAGCGTTTAATTGTGTTACCTTGTGTCCCTTTGTTTCCTCATAGGTTTTAAACTCCTATTTAGATTTCACGCCAGAAACGTGATTTTATTTCCAATGCTTTTGATTCAATTT
TGTAGGACACGTCAGTGTGTGACATTGATTGGGTAGTTTGTCTCTCTCCGCCCCTGACACATGACCCAGAATAGCGGCACACCAACACGCTTACCCATAAAATCTTAACAACACGCAGCT
AGTGCGTATGTTCTAGTTGTTTCTGCTTTGCTTCTCTGCCATATGGTCCATGGCTTACCTTAATGCAAGCCGTGTCCTCTATTCTTGCTTTAGCAATTACTTATGGCTTGCTGCTCACTT
TGAATGCGAGTAATTTGAGACCGATGTCAAACATGGGAAACCTGTTCCTGGCAGTCTGATTGGTAAACACAGAGTATGTCCACCAAAACTGAGGACAACAGAAAAGCATAAAGGAAAGAA
CTTGCAAAGATGACTTGGATGGAGAGTATGTAACATAAAATAAGACAAACTACTGTGCCACAACCATATCAGATGAATGTTCAACATTTCTATCTATGTGAAGAAAATATGTTATTAAAA
CCGTGGCTCAAATTATGTTTACATGTCATGTAACACATAAAGCCTGTTGTTGTGGTTTTTTTTTGTTTGTTTTTTTAGATAAGTACTCAATTTGGCAGTTTTTGGTTCTTAGAGTCAGTC
CATAATTTTTAATCCCACTACTGTGGAAATGATCGTGTATGGAACTTGAAGTACTTTCGAGGTCAGAGTAAGCATGGAAAAAGTAAATTGGTTATGGTTAATTATTCTCTATTCCCTCTC
TCACTTTGAAAAATAATAAGTTATATCCTCCCAAACACATCTGTTGATCTGTTTTTTCCAACCATCTGTTTGCCATCAACTGTCAATCTATAATGGTCGAGACTGGGAAAATTTGAGGAA
CTGAGTCTCTAAGTATGGAAACTGAAATGATTAAAATAAATGTGGAAGACATCTGAAATCTGATGTCTCTGTAAGTAAAGACAGCTAATTCTTAAGAAGAATACGTAATTTCTTCAAGCC
CAGTAAAATAAACTGATTGCTCAAATCAGTAGTGGTTTAGTGTCAAAAATTGTATCCACTTGGCACGACTAGTAAAGTGAAATTACTAGTCTCCTACAGGACAGGAATATGAAAGTAAAA
AACATTTCAAAGAAAATAATTTTTGTGTGCATTTTTTTTTTTTTTTTTTTCCATTTCAGTTTCGAAGCCTGCCCCCAACTGGGAAGGAACTGCTGTCATTGATGGGGAATTCAAGGAGCT
CAAGCTGTCCGACTACAAGGGGAAATATCTTGTTTTCTTTTTTTATCCTTTGGACTT
GTACGTATGTCTTGAATATATTATTGTAAAATCACATTGTCTTTAATCACATATGTAAAATAT
GTCATCATGGGTTTTTCCTCCTGCAGCACATTCGTCTGCCCCACTGAGATCATTGCTTTCAGCGATCGCGTGCATGAATTTCAGGCCATCAACACTGAGGTGGTCGCCTGCTCGGTGGAT
TCCCAGTTCACCCATTTAGCTTG
GTATGGAAACCACTTCCAGTAGACTTATAAAGTGCAAACCACATTCAGTAAATGGCATGATTACATATTGATCTCCCTAGCTCTTCCGTAACTTTAG
TGATAATTTGTCTAAAGTGTTTTGCTCACTTTTTCTGTTCTGAACAGGATCAACACCCCCAGGAAGCAGGGTGGACTCGGACCAATGAAAATCCCTCTGCTGTCTGACCTCACACACCAG
ATTTCAAAAGATTATGGAGTCTACTTGGAGGACCAGGGTCACACGCTGAG
GTGCAATTCAAATTTAAAATCACCATCCTGGTTCAAATAATGCTATTCTGTAATGCTGGAGAAGTGAAAC
GGACCAATCGAAAGAAAAAATTGGAACGAAATTGATGTTTTGTGGGGGTTTTTTATTATTATTTATTTGTTCTGGAAAACTTCTCCAAATTAGACCTCTATTAGGCTATCTATAACATTA
TTTGACTTTTAAACACTTTTTTTTATCATTTGTCATAATTATTGCAATAATTACCATAACATATGATACAAGGAATATTTTTTTCTTATGCTGCAGAACCTTTTTTAAGTTTTTTTTTTT
TTTTTTAATCTAAATTTTTTTGATATAGGGACTACGTTTTGAGACTCGAGTCAAATCCTACTTCATAGAGGGGGGCGGGAAAGGACTAAAGTGGGTATTTGACATGGTGAGCCCTACCCT
CATCTAACATGTCCATGTCTTTGTCAGAGGTCTTTTTATCATCGACGGCAAAGGCGTCCTAAGGCAGATCACCATGAATGATCTTCCCGTGGGAAGATCAGTGGATGAGACTCTGCGGCT
GGTCCAGGCCTTCCAGTACACAGACAAACATGGAGAAG
GTACTGGAAGTGCTTTTCATTCACCTTTGGAAAGATTATTTATCTATTGGCTATAATGAGATCTGTTTTTTTGAATAGACAC
CTGGTTTTGTTTAGTATTTTATTATTTTTTTTTTTTTTCCCTACAGTGTGTCCAGCAGGATGGAAGCCAGGCAGCGACACTGTAAGTATGACTGGGAATTGGACTGAATCGTTGTCTTGC
TAAACAAAATGCAACATGGAAAACCTGATTTGGATGAGTTTAATAGAACGTTTCTGAAGTTCTGGCTTTTTTTTTCTTGGCATAAACTGATCGGAGATGCTCGGTGTATTTGAAAGAAAA
TCACTAATTAAATCTTATCTTCCTCCACAGATCATTCCTGACCCCTCAGGCAAGCTGAAATATTTTGACAAACTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCTGGTTTCAGCACTGGTGCAAAAAAGGAGCTGCTGTGCGCCTTTTGCGCTGCCTTGCTCCTTGTCAGCGCAATCGCCTCTGCAGAGGAAGGCGCTCACCTGAAGAACTCCCAG
TGTCACAACTACGCTGGAGGACACGTATATCCTGGAGAAGCTTTCCGTGTGCCCGTGTCCGACCATTCCCTGCATCTCAGCAAAGCCAAGA
TTTCGAAGCCTGCCCCCAACTGGGAAGGA
ACTGCTGTCATTGATGGGGAATTCAAGGAGCTCAAGCTGTCCGACTACAAGGGGAAATATCTTGTTTTCTTTTTTTATCCTTTGGACTT
CACATTCGTCTGCCCCACTGAGATCATTGCT
TTCAGCGATCGCGTGCATGAATTTCAGGCCATCAACACTGAGGTGGTCGCCTGCTCGGTGGATTCCCAGTTCACCCATTTAGCTTG
GATCAACACCCCCAGGAAGCAGGGTGGACTCGGA
CCAATGAAAATCCCTCTGCTGTCTGACCTCACACACCAGATTTCAAAAGATTATGGAGTCTACTTGGAGGACCAGGGTCACACGCTGAG
AGGTCTTTTTATCATCGACGGCAAAGGCGTC
CTAAGGCAGATCACCATGAATGATCTTCCCGTGGGAAGATCAGTGGATGAGACTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACAAACATGGAGAAG
TGTGTCCAGCAGGATGGAAG
CCAGGCAGCGACACT
ATCATTCCTGACCCCTCAGGCAAGCTGAAATATTTTGACAAACTGAACTGA

Retrieve as FASTA