Entry information : PretPGHS02
Entry ID 13819
Creation 2016-06-27 (Harold Duruflé)
Last sequence changes 2016-06-27 (Harold Duruflé)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2016-06-27 (Harold Duruflé)
Peroxidase information: PretPGHS02
Name PretPGHS02
Class H synthase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Metazoa Chordata Actinopterygii Poeciliidae Poecilia
Organism Poecilia reticulata (guppy)    [TaxId: 8081 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PretPGHS02
start..stop
S start..stop
TrubPGHS02 889 0 28..588 70..631
OmyPGHS01 884 0 9..593 35..624
SfoPGHS01 880 0 1..593 1..598
PretPGHS01 870 0 1..593 1..595
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..7 7 N° 2 90..164 75 N° 3 3325..3441 117 N° 4 3576..3716 141
N° 5 4684..4827 144 N° 6 4897..5078 182 N° 7 5172..5255 84 N° 8 6941..7187 247
N° 9 9612..9898 287 N° 10 12816..12963 148 N° 11 14277..14626 350  
join(1..7,90..164,3325..3441,3576..3716,4684..4827,4897..5078,5172..5255,6941..7 187,9612..9898,12816..12963,14277..14626)


exon

Literature and cross-references PretPGHS02
Cluster/Prediction ref. Genebank:   103469906
Protein sequence: PretPGHS02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   593 (571)
PWM (Da):   %s   68060.11 (65778.9)  
PI (pH):   %s   7.25 (7.00) Peptide Signal:   %s   cut: 23 range:23-593
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGFSLFSILAVLLLMKSSSGAAESSAVNPCCYYPCQNRGVCVRFGTESYSCDCTRTGFHGKNCTTPEFWTRIYLMLKPGPGVAHFLLTHYQWFWTIVNNSFLRDTFMRIVLTVRNELIPSPPTYNTKYGYISWESYNNVSYYTRLLPPVPEDCPLPMGTNGKPVLPDPKELCEKYFKRREFRPDPQGTNLMFAFMAQHFTHQFFKKSHKAPVGFTKALGHGVDASNIYGEELERQHQLRLHKDGKLKYQLINGEMYPPPVSEVPVDMVYPESFPAEQQLAIGQEVFGLIPGLTMYATIWLREHNRVCDILKGEHPTWDDEQLFQTTRLIIGEIINIIIEEYVQHLSGYHLKLKYDPSLLFGVRFQYTNRIALEFSHLYHWHPLMPDSFLIDGEEIPYSQFLYNTSILTRYGVEKLVDAFSRQSAGIGGGRNIHQAVLRVPEILMRDSRAARLQPFNQYRKRFNLKPYSSFYELTGDEETAQGLEELYGDIDALEFYPGLMMEKARPNSIFGESMVEMGAPFSLKGLLGNPINSPEYWKPSTFGGETGFNIIKTSTLKKLVCLNTKWCPYVDFHVPRNEEELKPRNPSTEL

Retrieve as FASTA  
Remarks
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCACAACCG TCTACTGAAA AATAGAATTT TTATCCCAAA GGTGTTTGTT CATTTTAATT CAGTGGAAAA CTGGTTATTA AGCAGGTCTA CGTCCTGAAA ATGCAGCTGA CATGTCTTTA  AAAGGCCTAT TCAAAGTTTC AACTGATGTC CATTAAAGTC GTTATTCCAC ACAAGTTCTC ATGTTTTGTA TTTTCTATGG AAAGAGTATA GTCTCATTGG TAACTTGTCA TTTTATCTCC  TAAAAGGCAG TAACATAGCA TTCTTGATCA TTTAACGCAT GTGTCAAACT CCAGGCCCGC AGGCCAAATT CAGTCCCCCA GAAGTTTTTA TGTGGCCTGC TAGAAATAAA ACATTTGATA  TAACAGTTGT GTATTTAAAT ATTGTTTTAT CTGCCAAACT AGATCAAGGT GAAAAGATGT TTAATATTTA ATTTCAAGAA GTTCTTATCT ACTGTTATTA ACCATTATTC TTACTTTAAC  AGTTTGTTTT TGGGTAATTT TATTAATAAA TCAGGCCCTT TAAAACATTC TTGATTAAAA TTAGTTTGAC ATCCCTGATT TAAAGACTGC ATCTGCAGCT AAAAATACTT CTAAAAGCTC  AACCCTTTCT GCTTGACTAG ACATCAAGAC TAGGGTTGAT CTGTTGATTA TTTTTTACAT TTATTAATAA ATGGATAGCA AAAGGTGTTG GATAGGAGAT TTTTTATTTT TTTTCAAACA  GAATCTGAAC AAGGTGAAGC TAAAGCTGTG CCAATTGAGC CTTTCTGGGC AGAATATATA GACAAAGATT TTTTTTATCT TAAATGTAAA TTGTATAGCA TAATTCTGGA TTAACACCTG  CTAGTTTGTC ATAAAGTGAA AAATCATTTT GTACATATTG ATTACACATT CAGTTGGAAG TTTGTGACTA AAATCATTGA AATGTCCTAA AAGTGTATCT TTCCTCTTTT TAACGAACTA  CAATTATATA CAAATATGTA AACTGTATTA TGAGAATGTG ATAGCATCGC ACCACTAGCA GTGCCAAAAG TTTATTTCCA TGCTTTTTCC CCCCTTTGTG TGACAGTAAA CGTAAGTGAG  CGATCTGTTA ATCAGACACT CGGGGAGCAA AGCGGCTGAG AATGTGTTGT GAGGACAGAC TTCTGTGGTT TTGTTCCATA ATGTTACTTC TGTATTTCAT ATGTAAATTA GTGGCAACAA  TTTAAGACAT GTCAGAAGTC TGTGCTGAGG GAAGAGCTTA TGGGTGACAT GGAAATTGGT GCCAAACAAC ACAGGAATCA AACATTAAAT TAGTTTCATA ACATCAGAAG TTATTCAGAT  ATAATTTTAT TGTGACAATA TTTTAAATAA TGTTAGTTTC AGGTATTTTG GGTAGCAAAT TGTATAAAAA TTATTTTTTT TATAACTGTT ACTGGTAACT AAAGTCAAAC GGGCTTACAG  ACTTTTTATC CAACCTAAAC TTTGTAGTAA TAGCAGATAC CTGTTCACAA ATCAATTTAC TGTCATAATA TGTGATTATA CTGACCTCTC CAGGCTGCAT CTTGGTCACT ACTGTGTTTT  TAACTAGTGT ATATTATGAC ATCTTGAATG TAGAGTACTA CATTTAAGAT GTGATTATTT CTGCTGCTAG AGTTTATTTT CTTTCCTCTT TTAACACTCA CATTTCTTCA GTACATTAGG  AAAACAAAGC CAGAATGTAT TCATTTATTT AGATTAGATT AACTGGTTTT CCTAAATTGT AGGTGTGAGT GTACATTGTT GTTTGCCCTG TATGTCTCTG TGTTGCTCTG TGATGAAATG  TCGATCTGTC CAGGGTCTTC GCTGCCTCTT GCCCAATTAC ATACTGGATT TATATTTATA AAGTTAATAT AGCTGTTGAG AATAACCGTA CCTGCATGAA AAAGTTGAAA CCAGACATAT 
AGATCTACAG AATATAACGT CACATAACGA CCTAATATGA AAACAGACTA AACTTTAAGC TGTTTTAGGT CAGTTATGAT T 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAAACAGTTG GAAACAAAAA TAAACTGTCA AAATTTCATT ATAAATTTAG TGACACGTGA AAAATCTGCA TTATGGTCAG TACTGGGCAA TATTTCTCAA TTTTTAACAT GATGTGTCGA  TTCAGTAAGT ATAAAGTATG TTTTCTCAAA TAATATCTCA GTATTGGTTA TCGTCCATAA CAGTAATACT ATTAACTTTA TCCAAAATTT TCTTATTGGT GCATCACTAA TTAGCAAATT  GGCTAAAAAT GTATTGTGAT TATGTTTCTA CATTGAAAGA GGAAGTAAAA TTTGCAGCAT TAAAATTTAA GTGGCATTTT TTTCATTCAA ATCCTGGTGA CACATATGTA CTTCCATACA  AACTTCCCCT TCTTCTGTTT TTTTATTTTT TTTATCAGTG CTGCATTTAC TGCAAAAAAT ATTTTAACAA ATCTAGGTAT CTAAGAAATT AAGCATAAAA ATATAATTTT GGGTCTTGTT  TATGCCGACC ATTTTTATGC AGCATAAAAA TATAATCAGT AAATGTTTAA AAATGATCCG TTTCTGCAGA TAATTTTTAT GCAGCAGCAG TTAGTCACTT CGCTAATGGT TGTTACACAA  ATTCGCCAGT AGGGGGAGAC AAAGCTCTTT GATTCTGTCA ACTTCCAGCT GATGAGCGTT TGAATTAATA GATAAATGAA AAGTTTATTA ACTTACACGC AATTTTGGTT TTATTTGAAT  AATCTCTATG CCAAATACTT ACAATTCTTA ACAGGAGAAC AATTTGACTT GAAATACAAG CATAGAAAAT GTAATTTTAA ACACTCTGAA GTGCATTAGG TTGTGTTTAA AATCTATTAA  ATAGAGGAAG TGGAAGGCAC AGGGTGAACG CCCACTTTTG GTATCTCATA AAGCCAGTGA GACTCAGACA GTCGGATGGA GGAAAGAAAC CTTCAACCGT TTGTCAGAAC AGCCCTGTCT 
GTGAAACATC TCCAGACAAC TTTCATTTAA TTCAAGCAAC C 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGGTGAGTGCTAAAAGTACAAATTACATAATTTGGATGAACTGCAGATGTTGCATCATTATTGTTTCTCTGTAAACGTTCGCAGGGTTTAGCTTGTTTTCCATCTTGGCGGTTCT
GCTGCTGATGAAATCATCCTCAGGTGCTGCTGAGTCAAGTGCAG
GCAAGTAGTTTTTAAAATTACACAGATCTTCTGTTTTTCCTTTTTTGAGTCACACTTAAAGGTTGGAATTTTGGCA
CACTTTTGTTTACAAAATTGCTTTAAAACAGACAGAATTTGAGATTTTTGAGCACAGACAGTTTAAGTTGGTCTTTAACTAGGCCACTCCAAGGTAATCTTTATTGAGCATCCCTACAGG
ATGACTCTGCCATCGCAGAGTTTGATGTGCAGTGTTAGTTTTCATAGATTTGTTCCAACATTTGTTCCAAAAAAAAACATTTAATAGTTATTTTTATTGTTATCATGACGGTACCATAAA
ATATGGTGATAAAATGTTCAAAATCCGTATCACTCACCACTAATTGCTTTAATGAATGGGTGATGTCCCAATTTGTATTTGATTAAAATGTCACCATGTGGCCATGCTTAAAATGATATA
AAATAAAACCAAACAAAAAAAAATTGTAAATGCCCATCTGCATCAGCTCAATTGTGCGCCATTCTTCAACTGCACACAAAATTATTCGAATAATAGATTTTATTTGGGAGTATCAAAAAT
GCAAACAGTATTTTCCTGCTAATCCCCTCCATTCTGCTGGTCTATTCCATATAATCCCAATAAAATACAGCTGGTCTGTAGTTGAAATGCTGCAAAATGTGAAAAGATGTGTAACATCTT
GGAAAGCTACTACAGTGAACGTATGACTAGCTTATTTTTTTAAAAGCAATGCCAAAGAGTCAACTTTAAGTCATTTGCAAAAAAATATGATGTATTCTTTTCATTGTGAACCTGTTGAAT
ACGTTACGTTAATGAGTTTAAAAATGAGGCAAACGAGGGAAAAAAGAAGCTTGAGATGTGCAAATATTGCGGCTAAAGCTATCAGTCACATAATCTGTAAAACTCAGTCTCACCTTGTTT
CACAATATAGTTTTGGCATCATTACATCATCATATACCTGCAAGTAAAAATCCTGAAATGTTTTTAAGAATGAGAAATATTTTTCATTGCGATCCACAGAACTGGAGGACCTGACATAAG
ACAAAATTTTAGTTTTTGCAGAGCCTGTGTGAATGAGTGTCATAAAAATAAATTCACTATATAATGAATGCACATTAAAATATTACCTCAAACATCACATATTTTTATGCTTTCTATTAT
TGGAAACCTCGTTACTGTTGTCCATGGGGCTTTTCTATGCGATAAAAAGTCACATTATCACATTGAACTTCTGTAAGGAGGCAGGGCAGGAAGCCCGAATACAGCAAGTGTTAAAGATAT
GTGGAAGTGGTTGGGTTGTGAGAAATAGACGTTAACAGCTCTGCATATAAAGCCAGTTCCTGTAAAAATGGCGACAGCTTAGAGTTCAAGCATTGTCACCTGTGTGTGAGTGCTGGTATT
TCCTGGTGAAGCCAAATGTTGGTGGTGACTGGGCATAAATGTTCTGCTGGGAAACAATGAGGCAACCTGATGCGAGTTTAAGGCCTGGATGCAGAGTGCGTTTCAAAACGCCCCGTCATG
CTGCTCTTTAGTGTCAGAGCTTGGTTTCACTATCTGACTGAGTCATTGCTCCATCTGCGCCACGTCACGCCAGAGTAACTCCAGACTTCTGAATGCAGAAAATGAGTGAAATTAGGAAAG
AAATGGTGTTAAGAGCCGACGAGAAAATAAGAAGAGTTGGACTGAACAAGCTCCAAATATGTCGACTTCACACCAAAAAAATACAGTTTTAATATTAATTAAAAGGAGCAGCTATATTTG
ACTTTAGTTGTAATCCCTTCTTAAATTTTGCTTCCTGTGTCCTCATCCATGTTTTACACAAATTAATCACTTTGGATTCAAGAAGAACTCCATTGTGGAGCCGCAGCAGAACTGCTACAT
GCAGCAGGAAAGTCCTGGATCTGAATTTGCATGGAGTTTGCATGTTTGGGTTCTCTCTGGGTTCTTCATCACGTTCTTCCTACATAAACCAGTCACAGTTTCCCTGAATTACCTCATGTG
CGTGGTTGCTTGTCCTGTGACGGACCGCCAACTCATACTCTTTATTTAAACAGATGAGATGAATCGTTCTCACCAATCAGAGAGATGATCTGTGTAAAAAAAAAAAGCCAAACTCATTTT
TGTAGATGCTACAGAAATGAGTTTCTTCAGACCGCTACTGTTGCGGTCTGAACCACTCAGTCAAAAACAACCAATCAGAGCCAGGAGGAGGGTCTTACTGCTGTCAATCGTCCTCTTGTA
CAATGCTTAATGTGTTAATGGTATAAAAACAAACTTACTGTTATAGGAAAACCACTTATCAGCCATCATCTGTGGCTATGCTAACCAGCATTAGCATTCATGGTAGCCTATGTTGTGGTG
AACTAGCTGTAGCTTAGCATAGTGCAACAGGAAGAGGTGAGCAGGAGAGTGATTGACAGCGCTGAGACCTTCCTCCTGACTCTGATTGGATGTTTCTGACTGGGAGGTGTATTTCAGTAG
TTAGTACTGGGAGCACTGGGAGAAGGCAGAGAAGCTCAATTTTCACAAATTGTCTTATACAGTCATGACATAAATGCTAATTTAACAGATATGTGAAAACAAAATAATTGTTTTAATAAA
AGTGACATACTGGAGCTTCAGAGCTCCTTGCTTTCTGCTAAGCTGCAGCTAGCATAGCCTGTTTTAGTGCTAATGCTAGCTAGCATGGCCACAAATGATGGCGGATAAATGGGTTTCTTC
TGACAGTAAGTTGTTTCTCCACCATTAGTACATTAAGTAGCGACTACATGAGGTTGATTGACAGCACTAAGACCCTCCTCTGGTTTTTGATTGGTTGTTTTTGCCTTGGAGCGTATGCTT
TTATTTAGACAACAAAGTAGCCCAGGGAGAAGGTGAAGGAGATTGATGTTTTCACAGCTTATCTGTCGACATGGTGAGTTTTAAAAAATATGTATTAGTTACATACTGCAGCTTTAACTA
TCTTCAAAAAATGCTTGGTTTCATGTAATGTACATTTTGTTTCCGTTTTGTTGTGTTGTTACAGATGGTGTTAGGACAGTGTTATTTACAAATTAGGATTTAGTTCTCTAAATGGTTAAC
GAGCCAAATATCCACCCAGCTGCTTAAACAGGGCGTACCTCAGTGTAATTATTCATTATTTGTATAAACTGTTTTTTATTCCAGTGAATCCCTGTTGCTACTACCCTTGTCAGAACAGAG
GTGTGTGTGTGCGATTCGGTACAGAAAGCTACAGCTGTGACTGCACCCGAACAGGTTTCCACGGAAAAAACTGCACCACTC
GTAAGACAATTTGTTGTTCAGTAACTTCTAATGTGATTA
TTTTTGTGGTTTATTGTCTGCATAGCGCCTTAAATATTTCTCCAACGGTGCTTTTTCAAAGTAAAAAGGTACGTTTTGCTTTTATTTCTGCACAGCGGAGTTCTGGACCAGAATCTATCT
GATGCTGAAGCCCGGTCCTGGAGTGGCTCATTTCCTTCTGACCCATTACCAGTGGTTCTGGACCATCGTCAACAACTCTTTCCTGCGAGATACCTTCATGAGAATCGTGCTGACTG
GTAA
GTTAAGGCGTCAAAACCACTCAGTCTTTAAAACACAGTCAGACTCAAACAGATAATGCAACATTTTGCATCCTGTACTTCAGTTCATTTTTGATATTGACTAATATTTTTCTTCTAGTTT
TTTTCATTTGTGGTCAGAAACGCTTGGTGGAGGTTTATTTTTTTAAGCCATCCAGAGATCTGAATAGTGAGGAAAACCAAAAGTTGCTTTTCAAGCACTTAGTTTCAGCTCTTGAAAGCT
CATTCCGTCCACAAAGTTTCAGGTGTTACTCATTTGGTTTAGGTTTTTGGATGAGTCACTGCTGGTTCACCTGCCCAGTTATCTTAATATTCATGGTTTATTTTTGTGGTCTATTTATGT
TTATGTTCTTCAGTTTGCAATTTAGGATTTTGGACCTTGAACTTTGTGATTGTAAGCTTTGGTTTGACTTAAATGTAAATAGTAAATAGTTTATAAAGAGCATTTTAAAATCTTTTCTCT
GAGCTGCCGGGAGCCAGTGCAGGATAGATGTGCTCTTTCATTCTGGTTTTAGTCAGAACGCTAGCAGCAGCGTTCTGGATCAGCTGCAGCTGTTTGATTTTTAGACAGAGCTGTTACAGT
AATCAGTACAACTAAAGACAAACGCATGGATAAGTTTTTCTAGATCTTGCTAGGACATTAGTCCTTTAATCCTGGAAACGTTTTTCAGGGGATAGAAGGCTGACTATCCCCTGACTAAAT
TGTCCAAGAGACAATTTAGTCTCTGGACTAAAAATTGTAAGACGGCTTGTTTCCCATGTCAAAAAGAACAAAGTTCAACTCGATAACATACAGAGAAATAATGTAAAATCACCACTAAGC
CATTCTTTATTTTTGTATTTTCTCCCTTTCAGTTGGCACAACAGTTGCATCTTTTCAGAAATGTTGCAACATGAAAACTGTCTGAAAACTCATACAAACAAGCTAATCCCTTTCTTGTTA
CAGTCAGAAATGAACTTATTCCCAGTCCGCCAACTTACAACACGAAGTACGGGTACATCAGCTGGGAGTCGTACAACAATGTCTCTTACTACACCCGCCTCCTCCCTCCTGTACCTGAAG
ATTGCCCTTTGCCAATGGGAACCAACG
GTGAGGCCTTTACAACTTCTAACACTCATTTAGCCCCAATGAAATCTTAAACTGAGCATAAATTCACAGGTAAACCCGTTCTTCCTGACCCCA
AAGAGTTATGTGAGAAATATTTTAAAAGGCGGGAATTCAGGCCAGATCCTCAGGGAACCAATCTGATGTTTGCTTTCATGGCTCAACACTTCACACACCAGTTCTTCAAGAAAAGTCACA
AAGCTCCCGTAGGATTCACCAAGGCTTTGGGGCATGGG
GTGAGACACAAGAGAGCAATAAGCAACATAGGTCTGGTTGTAGTCAGCATTTGTTGAGTTTAATACCCGATTTATGTGTTTT
TATCCAATTAGGTAGATGCAAGCAACATATATGGAGAAGAGCTTGAAAGGCAGCATCAGCTTCGGCTTCATAAAGATGGAAAGCTAAAATATCAGGTAATAGTTGGGACATGTAAAGTCG
GGCTGTTTAGTCTGATTTTCCACCTCAATATCTGTGATCAATCACGTAACGTTGAGCTCAGCTGCAATAAAATGGAAATAATCTATCACCATAACCCTCACGTTAAAAAATATCAGCTAA
ATTCACTGATAAGATAAAAGCTATGAGGGCTGGGCAACATGGCTGAAAAACGAATCACGATAAAAGTGTTTCATATCAGTCGATATCAATAATTATTGATCAGATTTTTGTTTTAAATTT
CTGAAATACTGCCAAACTGGTGGCCTGGTTTTTTTTTCCAGTTTTCACTCCACAGTGTTGTTTTTAATTTTTAAGCAGTTATGAGGCTATGAGTGGTATAACTTTAAACTGCTGCTGTGC
CAGTTACTCAGCAGGGTGTTGCTAGGCAGCCACAAGTTACTCAGCAAGTTGTTGCTAGGTAGCCAGAGTGAGTGGGTTTGTTGATGCCGCCAATCTTTCTTAGTTGTGGGTTTGTTGATG
CCGCCAATCTTTCTTAGATGAACGTTAGAGATTGAGAGGCCAAAGCCTTCCTCTGCCTACATGCTGTGCAGTTCTGGGAAATTACTGAATATTCTATCATATGTATTATGTACTGATACC
GATCACATGTCCATCGCGATAGATATTATTGATTTATTTTCCAGCAGTATAAGACACTTCCTCTTTATCCACTTTTATTTTAATAGACAAAATTATTCTAAAATAACTTTTTGAGTTCTG
TCAACATGTAATATTAGCCATTTTCTATTTTACAGTGCTCATTTATTTTAACATTACTAAAGTTGAAATAAACATATTGATAGTTGATATTATCAGAAGGCAAAACAAGCTACCAATCTG
AGTGAAATGCTGTTTACTAACATTATTTTTGTTTTCTAATCACTGTCAAAGCCCTAATTGTTTGTCCTTTAATTTAACAATGTCTTGATATTTTAGCTGTCAACTCCAAACTCTTTTTGT
AATGCGCAACTTCTGTAAAGCTATTTTTGCAGCAGTTTCTGTGGTCAAAAAGGAAAAAAATAGAAAAGTTATGTTTCAGCTCTTAATTATCTATCTAAATAAGCGTGAGACCCTTTTTAA
TTTTTCACATCCAGCATGACTTACAAATCCATTTTCTGCTGACTACTTAATTTATTTCCTCAAAATATTTCACTTTTAGATTATTTAGCATGTAACAGATAAAGTAAAACAAAACATTTG
TGTTTTAAAAACGAAATGTTTTGTGGCCCATGGGAAAATGTTAAATATTAAACTTGAGACGAAGACTACAAACCAAACAAGAGAAGCAATTAGTTATTAATTACAGATGTGTTGTACTTT
GTAATAACTTCTTTAGTTTTACACAATTTTCTGTTCTTCAGCTCCTGCTGTGACGACTGCGTGAAGAAAATTCTCATATCCTGTTACTTGTCGACTTCTTAGAATAAGTCAAGATAATGA
CAACAGTGGTTGAAGATGGCGTCACCGTTGGTAGCTGAAAATCCATTATCGAACATTCAGATTTTGGTCTAAGAGAAGCCAGCTTATCTGATAACCTCTCTGCATGAAGATGTTGTTTCA
TCTGATGAAATCGCAGCAGTTTGAGGTCTTCATCAGGGCACAGGAAGCTAAGTTGATAAAGAAGTTACTGGTGAAATGACTCCTGATTGACGCTCCACAGCTGATCAACGGGGAGATGTA
CCCTCCCCCGGTGTCTGAGGTCCCAGTGGACATGGTGTACCCTGAAAGTTTCCCCGCTGAGCAGCAGCTCGCCATCGGACAGGAAGTGTTCGGACTCATCCCAGGCCTCACCATGTACGC
CACCATCTGGCTGAGGGAGCACAACCGGGTGTGTGACATCCTGAAGGGCGAACATCCGACCTGGGATGATGAGCAGCTTTTCCAGACCACCAGACTCATCATTATTG
GTGCGTATGTCAC
GTGTATTTTAAAATATTTACTCTGGTTTATTATTTATTCTGCTTATATGATGTACATGAGGTGGATGATATGAAAGAGAAAAGTATCTAAAACCTGCTCAGATGAGGGGTGTCCAAAGTG
TGGGCTGGGGACCATTTGTGGTCCTTGAAATTATTTTGTTGGCCCCTGACCACAAGTCAGGAATGATAAAAATAAAAATTTTGCCAACAAAATAGACACTTTGCAACGTAACGTCAGGTG
TGGCAGAACCCGGCCCAATCTCCATGTTGGAGGGCAGAAAAGCCGCTCGCTAACGATGACCACCATCAGTTTTAGCTGTCAAGTTGTCAACTTAACACGGTAAATCTTAAACGCATAATA
TACAAAAGAAAAAGGGATGCAGTGCTTTGCTACTAACTGTCAACACTATGACAACTAGATCAAAAAAGTCAGAAAAAATAAGTTTTAATTAAGAAAAAACATAACGAGGGAGTGGGAAGT
AGTTCAGTTATGCTAGCTTGACTTTGACAAACTTAACATGTAGAGGTGCTGTGGATTTCGGGTGAGTATAAGGCGATCCACACACCAACTCTCTGACAGCTCATCAGTAGAGCAGATGCG
TCAACTAGCTAATCAAATACCGATATGTTCAGACGATCACTTATAAATAATCACAAAATAAACAAGGAAAATAATCGCCTTTTTGCTCTCCACTGTTTCTGGATGTAAATGTTTGTTTAC
ATCCAGAACAAACATGAGCAGGTAAAACAAAACAAACAAAAAGGACCCAATAAAACTAATTTCTGCATTTTGTATTACATTTTGTGGCCCAGCAGCAGTTTAAATTTGCTGCCTGTGACA
AAAAGTTCGGACACCACTGGCTTAGATGTACAGCTGTGCTCCACCAGATGTTAAATTATAAACAACTGAACATATTTAAAATGATCCTGATGTCAAATCAACAAACCAATCTGAGACAAA
CAGGATTTGTATGTTTTTCATGGGAAAATCTGTACAAAAAGATTGTTTTATTATTTCAGCTAGCAAACAATTCTGAATGACTTTTAGAGCTTTTTGAATGAGTCATGCTTTTGATTGGCT
ACTTCCCAATTTGAACTCATTTGTTTAGTCTAAGTGAAGCAATGACTGTGCTGGATGGCATGTTATTTAACAATATGGCAACAATATCAACTGTTTAAAAGCACAAAAATTATTTTAAAA
TCTATTCATGATGTGGCAGCTTCCCATAAATGCTTCACAGTTCCTAGGATCTAAGTAAAACTGACATGTGTCCTGGTTAAAGTTTTGGAATGAGGCCAAAATTAAGATACTCAAATATTG
ATGGCATTTTTTGCTTGTTCTGTGTCATTTTCTCACGTTACTTGTTGGTATTACAAAGAAATACAGACCGTGCAAAAGATGCACCACAATACCAGTTTAAACTTTTATCTGCTTGTGAAA
AACTGTGGTCTGCAACAGTACATGAAGTTACACAAATGTGGAACAGAAACATGGGTGATATTTTTATGTAAATCTATTGACCCATTTATCAGTAGTTTCAATGGACAGATATTACAGAGA
GCAAAAAAACAAAATTAGTTCTGAATCAAATCCCCATAAGTACATTTGAATTGTCGTGGGACAAATGATTTGGTCGTTCACTCTGTGTGCTTCATGTGTGGTAAGTAGGAAGTTGATCTA
AGGCAGGGGTGGGCAACTCCAGGCCTCGAGGGCCGGTTTCCTGCAACTTCTAGGTGTGTCTCTACTTCAACACACCTGGGTCAAATAATGAGGTCGTTAGCAGGACTCTGGAGAACTTGA
TTGCACTTAGGAGGTGATTCAGCAAATGTGTTGGACCAGAGAGACGTCTAAGAGTTGCAGAAAACCGGCCCCTGAGGACCAGGATTGCCCACCACTGAATGGTTTTCTGGTGGTGAATGT
ACTCCACCTGCTGGGCAGATCATTTTACTGAAATATTCTTATATTGTAATGCAGTTCAGAAATTTGAACTGCCTTACATCATAGCTTAAAACGTCTTGCTTTGAAAAGTTGCCGGAGTAC
TGACCTACAGCAGATCATTGGCAAAAAAAATTTGCTTTGAAACTTGCTGCACTGTTATTAGTTATGCAGGAGGTACCACTTCTGCTTTTCAAAGATGTATGATTGCATAACTGTGTATCT
GCTTGCAGCCATTTTCACGTGCGAGTGTAAACATTGAGTTTGGAGGCGTGGCCAGCAGCAGCTCATTTGGATTTAAAGTGACAAGAGGCCCTAAAACAGCTCATACTGAACGGAGATCAA
GATGACCCGACTAAAACCTCATAATCTAAGAGCAATTTTGTGCAAAAAAATGTTATGAACATGTTTTCTATAGTCTTTAGATCTGTGGCAACCTGTTCAAGGAAGCATAATAGGTCACCT
TTAATTCCCAGGTGAGATCATCAACATTATAATAGAGGAGTACGTGCAGCACCTGAGCGGCTACCACCTGAAGCTGAAGTACGACCCCTCCCTGCTCTTCGGTGTGCGCTTCCAGTACAC
TAACCGCATCGCCCTGGAGTTCTCCCACCTCTACCACTGGCACCCGCTCATGCCGGACAGCTTCCTCATCGACGGAGAAGAAATCCCGTACTCCCAGTTTCTGTACAACACCTCCATCCT
GACGCGTTACGGCGTGGAGAAGCTGGTGGATGCTTTCTCTCGGCAGTCTGCAGGACAG
GTAAAAATATAGCAGCTTACATTTTGTTGCGTGTGGGAATCATGATGATCATGCATGCAGAT
GTTACGTTCTGAAAGAAAGCTGTGTGAAACAAGCGGCAAGTAAACTAGCAAATAAAAAACTAATTTAGTTAATTGCATAAATCATGCTTTGTCTAAAAAACTAACTTTAGTAACCGCTTC
CTCTCGTATGAGTCCAGACAGCCATGTTGAAATGCAAGATTATTGAGACATAAAGGGAAGTTATTTAAAAACGCTTTCTTCACATGGTGTGGTAAAAGTAAATATCCTTCCTATTTCAAC
AGAAAAAACAAAGAATATGTCAGAGGGGAAAAAAGAAAAAGGTGGAAAAACTAAAATGTAAACACTGAAACTTATTCATTCAGCTTTGAGAAGAGTAAGTCAACATCCCTCTTTTTTACT
TTTAATATGATATAATTATAATATCATTTTGTTCACGCTGCCTTTTCAGTGTCATTCACATTGTGCGGAAACATGTTCTGTCAGATTTAGTTGTAGACTTTAACTAGGCCATTCAAAATC
TTACTTTTCTATCATTTTATTGATTTCAATGTCCACTCTGACTGTGATGCTCAAAGTATTTAAAACCTCAATGTTTTTGACCTGATCATTTCATCCACATTGAAAGAATTAGGGCTGAAA
CGATTCCTCGAGTGATTCGAGTACCTCGATTATTAAAATTCCTCGAGGAAAATTGACCTGCCTCGAAGCTTCGTTAATTTATGTTTTATCATTTAGCGCACCGTGTTCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAAAAAATAGACTGATGTTGATATCCGATAGTAACACTGGTGTTATGGAAGATTTACCAATATTTTATTTCATAATTGTTTTTATCCGATTACTCGATTAATCGTAAGAAAAATCTA
TAGATTACTCGATTACTAAAATAATCGTTTACAACAGCCCTAGAAAGAATCCCTATTTCCATCTGAAACAAAGAAACGTCCAATCATGATCCTACCACCACTGTTTGTTTTTGACTTAAA
CTTTTGTAATCGCAGCTGAATTTTCAGGCTTGGTTTTATCAGGTTTTATAAGATTTTAACCAATCCCGGATGTTTTCCAGGCTTCTGTTTTCCAGCAATGCTTTTCAGACCAGACATATA
GCGAAAGTGTAACATTTTTACCACATTTAACTGCTAAAACCGTTGAAACTTGGACACCGTTTGTTTGAATAATCTTAGCACACGTCAAGTAGGTTTGGAACAAACTAAACTGGCAAACAT
TAAGGTTTTTAAATGACACTTAAAAGTCCTGTTGTTTTTCTTAATTTCATGATTAAACTGAGGTATTTTTTTTTCCATGAAAACAACTCAAATGAGCTACTTTGAGATGAATGTTCAAAT
ATGTAGCCAGAATAATGCCAGATGGCTGTTTGAGATGAAACTGTTGATCAATGTCAGTCAGGTTGTAAGTATGTAAAGCTTTGGTCCCATATGGAAAACCCTAAATAAATGTAAACTAGT
TTGCCTAATTCTATTTTTTTTAAACATTAATTGAATCTGTGTGCTGTATAATCGTTCCACATTGAATGAAAACTGTTTAAACAAACCATCAAGTCCCAAAAGTAATGATGTTCATGTTGA
TGAGTAACTATCTCCTTTAATGTGTCAGAAATAATTGGTCAAAAAAGATTTGTAGCCACTAGAATAAGCAATCTTCAAATTCAAGAGCTCAGTTGATATTTTTTTTAAATACACTGTTTG
CTGATTGGTTAAGTTTCTTTCTGAATGTAAACTTTAGGCTTACATAAACTGAAAAAGCGACTGGCAGAACCACAGTTTCACAAAGTTTATCTTTAGCTGTCGCTTTTCTCTCCAATGTCT
CAAATTGTGGTTTCTTTGTCTTGCCACAGTCATGCAACATGATTTCAGGTAATGGCTTATAGTCTGCTATCCTGAGCAATGAAATACATGTCAACATTTCTAAGTAATTCTGGAGTTAAA
GTGATACTCATCAAAAAGATGTATATTAATGTGCGGAAATGTTTTCTGTTTTCGCCTGTGGTTGACTTTTCTCAACCCACAAAAGCCAAACTTTTTTAAATACAAGAATCCTGTACCATG
CACAGAAATCGTTTGCATACCGCTCATCTTGAATACTTGCTGAATAAGAAAAAAAATTAAGAATGTAAAACTCACTCATGCATGCTGTGAGTGCTTCAAGTTTATGATATGATTGCAACA
TAAGGCGTTCTCAAAACCACAAACTGCTGCTTATCTTTCTAAATTAGCATCAAAGTTCAGTTCCTCTTTAAAAAATACTTCCTGAAGTAATTTCTGGTGTTTTATCTGCTTTCAGGGTAA
TCTCCCTTTGTAGGTGTAATAACTGGGTGCTACAGCCCATAGTTTCCTTTATTTTATTTTTTTTAAAAGATTGAATTAGACTCTGTGTCTTTCAGATAGGCGGCGGTCGCAACATTCACC
AAGCGGTGCTCCGAGTCCCAGAAATATTGATGAGAGATTCCAGAGCTGCACGCCTGCAACCTTTCAATCAGTACCGAAAAAGGTTCAACTTGAAGCCGTACTCATCCTTTTATGAATTAA
CTG
GTAAGTTGGTGAAATGTAAACTCATAAAAAGTTCGGACACATATAGGTGCAAAGAAGTTGATGAAATCTGTTGCATGCAACGTTCATGCCCTCCATGATTACAGGCCTGTAGATTAG
CATAATGACACATGAGATGTGTAGAAAAGCAGTAGAATTTAATTGCTTAAAGAATAAAATATTTGAAAAACTTAAACCCCCAAGAAGAGAGTGTTGAGGAGGCAGCAGACTTTACTTGCC
ACAGCGTTATCCACTGCGCTTTTCTGTCATCACAAAAGTAATTTTTGTTTGAGAGAAAGTTATCTCTGCTACGTCACGCAGTTCGGCTGAATGAGCGCCATTTAGGTGACAAATAAAAGA
GCTTTTCGAGAGTTTATATTTTAAAACAAAACCGCATAACGTGCATTTCCTATCCCACAACGGACTCGGTTTGGACCATTTCTCTGTCAGCATTCTTGTGTGGCTCTGCCATCTTGAATT
CTGTATCGGACTCGCTTCGCTTTCGCGCCCTCTGCTGGATGGCGGCCAAACTGCAACACTAAAAGAAGGTGTATGTGGACGTTATTAGTCGATTGGAAATAATCTTTATCTAATAAATCA
TTAATCGATTAATTGTTTGCTTTCCTACTCTGAATATATTGGTAGGTTTAGGCAAGTTTCCTCGAATGGCTCTTGGCTTTCAAGCTTTAAGTTTTGTGTCTCAACACAAAGTTATTAGTT
ATTGTGCAACAAATAACTAATTTAAACAAATCAAACGTTCCTAGACTCTCTGAACTTCAGTAGTTAATACAAATAATTTTTCTCTTACATTTATTGGATCAAATTATTAAAAGTTACAGT
AATATTTTGTTAAAATTCTGCCGTTCTGGGCAGAATAGCTATAAATATAGCTCATTCAAAGCTGGTTTCTCCATTTCTGACTATTACATTAATAAAAATTCAAACTTTTAATCTGTATCT
GTTAACTGGAAATCAGTTCCTCCCCTTTCGGGTTGATTGTATCAGAAAATTACCCCAACTTTGAACTGCAACAACCTAAAAAAAAAACTTCACATTTCTTTTGCTTTATTTGAGCTGCAG
CAAAACTTTCCATCTTGTCTGATGTTTGCATCACCACCTTCCTGTGGTTTTTTTTTAATCTGCTACCATCTAATAAAGATACAAAAAGCTTACTGATGCAGTGTGTAGATGTAAATTATG
TGGTAGTTTTTATGCCTACTCAGACATTCCTCCTGTATAATGAGGTTACCTGCAGCACTGATGTACACCAAGATGTCAGGAAATGCATTCAAACTTTAACATTTTTCTGCAAACAGGTGA
TGAAGAAACAGCTCAAGGTTTAGAGGAGCTCTACGGCGACATTGATGCCCTGGAGTTTTATCCCGGCCTCATGATGGAAAAAGCTCGCCCCAACTCCATATTCGGAGAGAGCATGGTGGA
GATGGGAGCCCCTTTCTCCCTGAAAGGCCTGCTTGGGAATCCCATCAACTCTCCGGAGTACTGGAAGCCCAGCACCTTCGGAGGCGAGACGGGCTTCAACATCATCAAAACATCGACTCT
GAAAAAACTGGTCTGTCTGAACACCAAGTGGTGTCCGTACGTGGACTTCCATGTCCCGCGAAACGAGGAGGAGTTGAAGCCGAGGAACCCGTCCACCGAACTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGGGTTTAGCTTGTTTTCCATCTTGGCGGTTCTGCTGCTGATGAAATCATCCTCAGGTGCTGCTGAGTCAAGTGCAGTGAATCCCTGTTGCTACTACCCTTGTCAGAACAGAGGT
GTGTGTGTGCGATTCGGTACAGAAAGCTACAGCTGTGACTGCACCCGAACAGGTTTCCACGGAAAAAACTGCACCACTC
CGGAGTTCTGGACCAGAATCTATCTGATGCTGAAGCCCGGT
CCTGGAGTGGCTCATTTCCTTCTGACCCATTACCAGTGGTTCTGGACCATCGTCAACAACTCTTTCCTGCGAGATACCTTCATGAGAATCGTGCTGACTG
TCAGAAATGAACTTATTCCC
AGTCCGCCAACTTACAACACGAAGTACGGGTACATCAGCTGGGAGTCGTACAACAATGTCTCTTACTACACCCGCCTCCTCCCTCCTGTACCTGAAGATTGCCCTTTGCCAATGGGAACC
AACG
GTAAACCCGTTCTTCCTGACCCCAAAGAGTTATGTGAGAAATATTTTAAAAGGCGGGAATTCAGGCCAGATCCTCAGGGAACCAATCTGATGTTTGCTTTCATGGCTCAACACTTC
ACACACCAGTTCTTCAAGAAAAGTCACAAAGCTCCCGTAGGATTCACCAAGGCTTTGGGGCATGGG
GTAGATGCAAGCAACATATATGGAGAAGAGCTTGAAAGGCAGCATCAGCTTCGG
CTTCATAAAGATGGAAAGCTAAAATATCAG
CTGATCAACGGGGAGATGTACCCTCCCCCGGTGTCTGAGGTCCCAGTGGACATGGTGTACCCTGAAAGTTTCCCCGCTGAGCAGCAGCTC
GCCATCGGACAGGAAGTGTTCGGACTCATCCCAGGCCTCACCATGTACGCCACCATCTGGCTGAGGGAGCACAACCGGGTGTGTGACATCCTGAAGGGCGAACATCCGACCTGGGATGAT
GAGCAGCTTTTCCAGACCACCAGACTCATCATTATTG
GTGAGATCATCAACATTATAATAGAGGAGTACGTGCAGCACCTGAGCGGCTACCACCTGAAGCTGAAGTACGACCCCTCCCTG
CTCTTCGGTGTGCGCTTCCAGTACACTAACCGCATCGCCCTGGAGTTCTCCCACCTCTACCACTGGCACCCGCTCATGCCGGACAGCTTCCTCATCGACGGAGAAGAAATCCCGTACTCC
CAGTTTCTGTACAACACCTCCATCCTGACGCGTTACGGCGTGGAGAAGCTGGTGGATGCTTTCTCTCGGCAGTCTGCAGGACAG
ATAGGCGGCGGTCGCAACATTCACCAAGCGGTGCTC
CGAGTCCCAGAAATATTGATGAGAGATTCCAGAGCTGCACGCCTGCAACCTTTCAATCAGTACCGAAAAAGGTTCAACTTGAAGCCGTACTCATCCTTTTATGAATTAACTG
GTGATGAA
GAAACAGCTCAAGGTTTAGAGGAGCTCTACGGCGACATTGATGCCCTGGAGTTTTATCCCGGCCTCATGATGGAAAAAGCTCGCCCCAACTCCATATTCGGAGAGAGCATGGTGGAGATG
GGAGCCCCTTTCTCCCTGAAAGGCCTGCTTGGGAATCCCATCAACTCTCCGGAGTACTGGAAGCCCAGCACCTTCGGAGGCGAGACGGGCTTCAACATCATCAAAACATCGACTCTGAAA
AAACTGGTCTGTCTGAACACCAAGTGGTGTCCGTACGTGGACTTCCATGTCCCGCGAAACGAGGAGGAGTTGAAGCCGAGGAACCCGTCCACCGAACTTTAA

Retrieve as FASTA