Entry information : Pret1CysPrx01
Entry ID 13824
Creation 2016-06-27 (Harold Duruflé)
Last sequence changes 2016-06-27 (Harold Duruflé)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-06-28 (Christophe Dunand)
Peroxidase information: Pret1CysPrx01
Name Pret1CysPrx01
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Metazoa Chordata Actinopterygii Poeciliidae Poecilia
Organism Poecilia reticulata (guppy)    [TaxId: 8081 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Pret1CysPrx01
start..stop
S start..stop
Tn1CysPrx 358 2e-127 1..224 1..226
Xl1CysPrx 330 5e-116 1..224 1..223
Gga1CysPrx 327 8e-115 1..224 1..223
Xt1CysPrx 325 3e-114 1..224 1..223
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..92 92 N° 2 1776..1932 157 N° 3 3270..3419 150 N° 4 3570..3716 147
N° 5 4322..4507 186  
join(1..92,1776..1932,3270..3419,3570..3716,4322..4507)


exon

Literature and cross-references Pret1CysPrx01
Cluster/Prediction ref. Genebank:   103478987
Protein sequence: Pret1CysPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   243
PWM (Da):   %s   26782.66  
PI (pH):   %s   5.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGLLLGDKLPNFEVETTAGTMKLHEYFGDSWGILFSHPRDYTPVCTTELGRVARLSGEFSKRDVKLIALSVDNLEDHRGWSDILAYNCEETEGCELPYPIIADSKRKLAVALGMLDPVERDKDGIPVTARCVFIIGPDKTLKLSLLYPNTTGRSFDEILRVVDSLQLTAHKRVATPTEWMPGGCVMVPPNMPEEEAAALFPIGVFSKALPSGRKYLRYTPDPLDRKGCEPPPAEPELPTTL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 17, 4 introns).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTCCCCCCG GAGCAGAGTG TACACGGCGC CGACGAGCCA CGGGACGACG TGCCCGGAGA ACTCCACCAG CCGCACCAGG GGCCGGATGC CGCCCCACGG CGACTCCTCG CACGCGCACA  CCCCGAGCTT CTTGGACAGC CACAGGTCCA CCGCCAGCAG GAACCGCAGC GTTATGGCGA ACATGGGCTG GCTCAGACTG ACGGAGAAGT CATCGGCCTG CGCGCCGGGG GAGAAGTAAG  GGCAGCTGGA GGAGGCCCGG CGGCGCCCGG GGGGTACCGA GTCCGACGAT GCTCTGCTTC CAGCCGCGGC TCCTCGGCAA CTGTTCCGTC TGCTCCCCGG GGAGGACATC GTTTCCTCTG  ATAGAGTGTG GGGCAGTGAT CCGCGCGGCT CTCTGAGTCC CGCTGCGCTC AGACGCAAGC CATCCTGCAA ACGGGTCCAG TCCAAACACG GGTTAATCTG GCACCAGTTT AGAACCGGAC  CCCCCTCCGA TCACGTGGGC TCGCAACACT CTTACTAGAT CTTACTCTCA AACCGGTGGA GAACAAATTG TCTTTATTTC CTTGAGATTT CTTGCAAAAA TATTTGGAGT CAAGGGTACT  CTGAGAAAAC CGTGGTTCAG ATTTTCATAA AAGAAACAAG GTTAAATTAT TATCTGCCAC ACATAAAACT AGCTAGAGAA ACATATATTT TATTTTGCCA GCTCAAACAT GAGCTGTGTT  TCCATTACAA ATGTGTGCAA AACATTGTCA ATTTTCCGCT AATGTCAAAA AAACAATTCC TCTATCGCGG TGTTTCCATT AAATAAGAAA CGCATTCAAA ATCACAAGTT TGTTCACATT  GTAAGTCATT AAAAAATATG CTGCGCCAGG AACCTCCAAC TACTAGGAGT CGCAGCATCA TGGCACAGTC AGTCAAAAAG AGCTGGTTTG CATTTGTTTG GTGCATTTGT CCCACCAGAC  AAATGCAAGA GGTCCCCCAC CACCCAAACA GTGGGGGAGA GTTGAGGAAG TTGGTCAGAC AGTGGATAGT TGAAGAAATG CTGCCCCTAA GCATGGCGAT CAGGTTTATG TTGAAGGGGG  CGGGGCTGCT GAAAGTAACT ATTAGAGAAG CCTAACTTCC ATATTTGTAT AATCAAATAA TCGGTAAAGT AACTGCTTTT TCAGGGTGTA GTCAGAAATC AAGTTACTTT TTCAAGGTAA  CTATGCCATC ACGCAGTCTG GTTAGCTGAC ATTATCTTTT GGACCTAAAG AGGAACGATC CAGAGTCAAC GCACAGCTTC AGTTATTACA GCTCAGAAAC TAGTGATCGG GTCTGAAATC  TGGGTGATGA ACTCAGACCT GAACCTCCAG AGACACTTAA AGACAGTTGC AGCCTTCTAT CACCTTAAGA ACATTTCTAA GATTAGTGAG ATCTAGAGAA AGTCATTCAT GGGTTTATCT  TTAGTTGCAT TGATTCCTGC AACAGTGTTT TCAGAAGTGT GCTTAAAGTA AACAGAACAT TGATCAAAAT ATTTGTTGTA TATGTTGCTT GATAATTTTT ATGATGGCAT TTGACATAAT  GTAATGTTTG TTGCTTATTT CATAATTAGC TATTGTAATG GGTTTTTAAG GTGCAAAGCA CTTTGAACTG CCTTGTTGCC GAAATGTGCT GTACAAATTG ACTTGGCCAG ATTGTAGTAG  GTAGTTCAAT AATGGTGTCC TATAAAAACT AACAATACCT CTCCTACCTT TGCTCAGTTT GCTTATTGTT ATCTCACATT TCAGCATAAA GCCCTAGACT CAACATTTCT CACAGTGATA  GAAAGACCAA GTGTGTTTTG AACAGCTTGT GGTTTCTGGT GATTTGAACT CATCATTGTG GTCGCATCAT CCTACCGCCC CCACACACCC ACCTATCCAG TCACCTCCCC TCGCTGTTTG 
CGCCGTATTT CAGAGGAAGC TTTCCGCCTT CTCTCTGTTT AAAGCCATCT TTCGCAGGCC AACCCACGAC CACGTCCAAC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAACGGGCTT TTCGAGCAAA TCAATGTGAT GAATACAAAA TGTCTTACTG TAAGAAGCAG AGTTACTCTT ATATAACTTG TTTGTAATGG GTTAACATAA GCAAAGAAAA TACATTTTGC  TTTCACCTTA CACATTGTTG TGTATGTTCA AAGGCCAGTG GCACTGCATC CAGTCTGAAC TAATAATAAA ATAACGAATA ATAAAAATTC GTCCATTCTG TTCTACCTTG GTCCTCCTCA  GAAACAACAT CCATGTGTCT TAATGTTGCT AAGCACTCCT TAAATCCCTA TTACGCTCCT ACATTTTGCA GTATAATACA AATAAACACC TCAAAGGGGG TAACTCAATA AATAAAAATA  AAAAATACAA ACAGATGAGT TCAAACTTAT GTGATGTCAA CAGAGGAACT GGTCTACACT GTGGAAGCTT GATTTTAGGA GGCAAGATTA AATACCGATT TAAAACAAAA CAGCAAAACT  AATAGAAAAC TGACCGTGAT GTGTTGGCTC AATAAAAAGC TTTCAATTAA ATTACATATT TTTCTCTGTG GTGAAACAGA TGAGATTTAA TAACTGCTTC CAACTGGGTT AATAACTGAT  GTTCACCATT GATTCACTTC CACTTCTCAT TCAGGGATAT TGATTAATAA ACTGAGTGAC AAAGTTTTGT GAAGCTGATC TTGATGTAAA AGCACATGCA CCGATCCATT AAAGTCACTG  TACCAGGCTG GCTTAGTTTC AGCAGTCACA GTAGCAAGTT TCTGTTTGAA CTGATGCTTT TTCTTCAGTG ATTCACTTTT TCAAGGGAGC CTTAATAAAT AATTCCTACC GGCGAACGTA  AATTAGCCGG TAGGAATTCA ATTGAGAATC TGTGGCAAGA TTTGAAAACT GCTGTTCAGA GAGTCTCTGT CCGACTGAGG TTTGAATTAC TTTTCTCTAC ACACAACAAA ATTTTAAAAT 
CTTTATTCAG ATTTTCCTTA AAAAAAACCA AACAAGGAAT G 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGGGCTGCTGCTCGGAGACAAGCTTCCTAATTTCGAGGTGGAGACCACTGCTGGGACAATGAAACTCCATGAATATTTTGGTGATTCGTAAGTAAAGATCTGTTGATTATTGACT
GCGGGAAAGCTTCGCAGTAGTTTGATAATTCAGTCAGCATAACAAGTAAGGGTAGGGGAGTTTTACCGAGTGTGTTTCCTGTTATCACCTTTCAGATTTCTGCTTTGTGTGCATCTGAGG
TATACTTGTTCAACAGTGGAGACAGATAAATCTATACATACAACTGAATCCTGTACATCAGGTTAACAGCAACAATGAGCTGAAATATGTCAGGTTTATATGAGTCATATCAAAGATGCT
TCACACTATCACATTGCTGACCTACCGGGAAAAAAAAAAATCCTGTGTCATCAGATTAAAAATTCATTGCAAACCAGGTCACATCCTGTTATTTTTCTGTCAGCAACATAACTCACCAAC
AAAAACGCTTTCATTTAGCACACACTCTCATTTAATTATGTAGCAAAACAGAAGGTAGAACCTCTTTGTGAAGAATTAAGTCAATCAGTGCTTCAAAGTTTAAAAGAACTTCCATGTTCA
CCAACTAACTCAGTTTTGTGTAACCCTATCAGTCTCTTGTGTTTGTGTCATTTGCTTTGATCATAGCTTTATAAATTTATGAGGCAATATCGATTAGTGCCCGTCCAAGACCTAAATTTG
GGCCAGGCAAAATCTGTCGGACATATGGCCTCATTTTCGATTCTAGAAAACTATGGGTATACTGAGGGGTTCATGTAAATTCAATGAGTGCAAAGTTTCCAGATGCTTTGGCGGCCTAAA
CTGAAGTCATCCCCTTTCCTCCTCTGTGATTGACAGTTGATTTGAGATGTACATCATAGCTGAAAGTTTCTACTTTGGTGTCATCTTGTCATAGTAGAAACATTGTTACGGCTTCCATGT
TCCATAAAAAACACTTTGTGATGTTAGCCCCTCCAAAATCGAAACATTTATTTAGTCTTTCCCTATTCTCTCGTGAACTTTAACAATTCAACATGCTAACTAAGGCTTGTACAGTTTGTA
ATGGAGATATTGGTAGCCTAGGAACCAGCTCCTCGTTCTACGTTTTCCGTACAGTGGGTTTGAACTTTGGCTATTGAGAAACAATTGGTGTGGGCTCCGCTTAAGTTTCAAACAATTGGG
TCTGATTTTATACCCAATGGCTAACGTTTAGCATGACATACCTAATGCGTCAGCTCAATAAAGCTTACCAGAAACTGTAAAAATCCAAGTGGGGAGTAGGAACACAAAATCTTTGACAGC
AGTAAAATCTCGTACACATTCCTCTCACAATTTGGAAGCATGGCCGATGCGAACTGAATGTCTCTCTTCACCTCCTCTTTGCCAAACCATAGGCAGACAATGAAAACAATACAGAAACAA
AAAGAGTGGAGTCTGCTAAAGAAAACTCTTGGTGCAGAAGGTAACAAATAATTATAGGGTGCATTTCAGAAATAATAGCAATCATTTATCTCAACGTGTAAAATTAGCTCATCAGTGAGA
CGAAAGAACATGTCAAGTGTATGAAACCTCGACCTCATTGATTATGTTCCTGACCTCAACAAAAATAGCTCCTTCATCATATACAGTGCAGCAAAAATCAGGTCACATCCTGTCATTCAA
ATGTCAGATTGTTATCATTCCTACTTCAACCTACTTCAGTACTCATCTTAAACCCCCTACCCTACTGGTCTCTAAAATGTCCATCTTCTCTACAGGTGGGGTATTTTGTTCTCGCATCCC
AGAGACTACACCCCTGTGTGCACCACAGAGCTGGGTCGAGTCGCCAGGCTGAGCGGCGAGTTCAGCAAGCGCGACGTCAAGCTGATCGCTCTGTCCGTCGACAATCTGGAGGATCACCGC
GGCTGGAGCAAG
GTGATACGCAGCGCTGCCTACGTCTTGTACGACGAACCATACAGATAGCTTACCAAAGGACTGTGATTGGAAATAATAAATGGATAAGTAGCTTCAGACAGGGTCACT
CAAAAGAAAAGCTAAAGTTACCAATGGATAGAAAACAATGCCAGGATTGCTTATTTGTTCAGAGCAATTCACATCTGTGGGAATATTTTTCAGTTTCTCAGGGTTAGTTGCAGAACTTTT
GTTTTCAGAACACTATTAAATGCCACCAGCATGCAGATTTAGTTTTGTGCCTGACCTGAGGCTGCAATGTTTACGGTGCTGAGTGCAATATGGCATTGATGAGGCAGTGAGCAGTGGTGC
ACCCATGCTGACCAACTACATCTGTAAATAATAATTTTATTTTAAGTCGTGCTGGAAGAAAACAAAGCTAAGAATCCACACACCTAGTGGTTTTGTTGTGGACAGTCACATTTATAAAAC
AGCACAATTCTTCTCAATAGGATGAACAAAGAAGACAACAATAAGTCTGTTGAGAGACTCATACTTTTATTTCAGGTTGCATATATTAATATGTTGTGACTTCAAGACAGGTGGTCCGTG
AGTTTGTTAAATGGGTTAAATGGTTCTCAGCCTGAAAAAGTTTGAGAAGCAGTGGTTCAGAGCAAGACATGATCATTTGTTAGTGGGTCCTAGTTAAAGTCCAGACCAAAGTCCATTTCA
GAATGACTTACTTTTAGCAGCTTTGAAAAGAAGAAAGAGCATAGAATTCTGTGATCGTGCAAACCACTACTTTGTACTGATCTACTACTCTTAAAGTTTCCAGTTGTAACATAACAAAAT
GTTATTTTAAATAAATGATTAATATAAAGTCTCAATTTTTAATCAATTAAATTCCATGTTTGACTTATATCGGAGACTGAAATAATTGGCCTTGAGGCATTACTGATGCAACATTTCAAA
GACATCTCAAAAATGTTCAATGCAACTATGCCCTTCTTTTTAAAGAACGTGGTTTGGAAATAACTAAATCTGCATACTGCATATGTTACCCTTTTTTCATAAAACCATCTTGAAAATGTG
TTCTTTCAATATTTGGTTTTGCTTCACTATCATGTTGGTGTAGCGCTCCAGCATTAGCTTCCCATAAATACCGTGTTGGTGTAGCGCTTTAGCATTAGCTTCCGCTTGGTGTAGTGCATT
AGTGTTAATGGAACTAATGTTTATGAGCAGTGTTCTAGGGTTAGTGCAACTAGCTTTTTAGATAGCAGTGAAGTGTAAACTCTGTAGTCTTGGCAGCTGCTTTGGTTTAAATGACTCATC
AAGGCCTTGCGTGTCTCCTCTCTGAGTAGGACATCCTGGCTTACAACTGTGAGGAGACTGAGGGCTGCGAGTTGCCCTATCCCATCATTGCAGACAGCAAGCGGAAGCTGGCAGTCGCTC
TGGGCATGCTGGACCCCGTCGAGAGGGACAAAGATGGCATCCCGGTCACTGCTCGCTGC
GTGAGCATCAAAACCACATGTTGTTTTCAACCATGCCAGGGTTTTTGAAGTGAAGTTGCGG
CTCACTTCGAAAACCCTGAATCTGCGACCTGAGTTGAGGATTTGAGACCCACTTTAACCTTCCACTCTGATTTCCCCTGTTTTGTACAGGTTTTTATTATTGGGCCTGACAAAACGCTGA
AACTGTCCCTGCTCTACCCCAACACCACGGGACGCAGCTTCGATGAGATCCTGCGCGTGGTCGACAGCCTCCAGCTCACAGCTCACAAACGAGTGGCCACGCCCACCGAGTGGATG
GTGT
GTGGTACCTTTTAAAAAAAAAACCTCAACAGGAGCCCAACACACAGCAATAAGAATGGACCTTATGAATTTTTGTGGGATATTATGTGATAACCAAAGTACAGCATTAAAGAGAGAGAGG
GAAAAAAAAGTTAAAATCTGAAAACCTGGCCTGCGTTTGTACTCGATACAGTCTGCTTTTTTGTGAAAGGTGCTTAAAAAGGCATTTAATGAGATAACAACTGCAGATTTTTGGAGTCTG
CTGTAGCTTTGAGCTTCTAGAGGTCACTCCCCACAGCATGTTTCATCAGGGTGATACAAACATGTTCAATTTGGGCATAATCTGACATGTCTGTTTTCATATGGTGGCTTGTTGGCTACC
ACCTTGTTTAAGATGCAGATAGATTTTTACTCACGGATATCCGATTAAAAAATAATTAAACACCTAAGCATGCCACACTTTTTGATTTTTTTACCATTTCCTTCCACTTGAGCTACGTGC
GCTACTTTGAGTTGCTCCATCACATGAAATCTCTGAAAATAACTTAAAGGTTGTGGTAGAAAAAAAAAGAAGAAAAAAGTAGAAAAACCTTGATTCCACATTTTGCATTTCTTCCGTCCA
GCCCGGAGGCTGTGTGATGGTGCCTCCCAACATGCCCGAGGAGGAAGCCGCCGCTTTGTTCCCAATCGGCGTCTTCAGCAAGGCGCTGCCGTCTGGGAGGAAGTACCTGCGCTACACTCC
AGATCCACTGGATAGGAAAGGCTGTGAACCGCCACCGGCTGAACCCGAATTACCCACGACTCTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGGGCTGCTGCTCGGAGACAAGCTTCCTAATTTCGAGGTGGAGACCACTGCTGGGACAATGAAACTCCATGAATATTTTGGTGATTCGTGGGGTATTTTGTTCTCGCATCCCAGA
GACTACACCCCTGTGTGCACCACAGAGCTGGGTCGAGTCGCCAGGCTGAGCGGCGAGTTCAGCAAGCGCGACGTCAAGCTGATCGCTCTGTCCGTCGACAATCTGGAGGATCACCGCGGC
TGGAGCAAG
GACATCCTGGCTTACAACTGTGAGGAGACTGAGGGCTGCGAGTTGCCCTATCCCATCATTGCAGACAGCAAGCGGAAGCTGGCAGTCGCTCTGGGCATGCTGGACCCCGTC
GAGAGGGACAAAGATGGCATCCCGGTCACTGCTCGCTGC
GTTTTTATTATTGGGCCTGACAAAACGCTGAAACTGTCCCTGCTCTACCCCAACACCACGGGACGCAGCTTCGATGAGATC
CTGCGCGTGGTCGACAGCCTCCAGCTCACAGCTCACAAACGAGTGGCCACGCCCACCGAGTGGATG
CCCGGAGGCTGTGTGATGGTGCCTCCCAACATGCCCGAGGAGGAAGCCGCCGCT
TTGTTCCCAATCGGCGTCTTCAGCAAGGCGCTGCCGTCTGGGAGGAAGTACCTGCGCTACACTCCAGATCCACTGGATAGGAAAGGCTGTGAACCGCCACCGGCTGAACCCGAATTACCC
ACGACTCTGTAA

Retrieve as FASTA