Entry information : AtMDAR01 (At1g63940/MDAR6)
Entry ID 13834
Creation 2016-07-11 (Christophe Dunand)
Last sequence changes 2016-07-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-08-25 (Christophe Dunand)
Peroxidase information: AtMDAR01 (At1g63940/MDAR6)
Name (synonym) AtMDAR01 (At1g63940/MDAR6)
Class Monodhydroascorbate Reductase    [Orthogroup: MDAR003]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtMDAR01
start..stop
S start..stop
ThasMDAR01 874 0 1..492 1..492
HaMDAR01 740 0 8..491 1..487
MpMDAR03 613 0 1..491 2..484
KflMDAR01 508 2e-177 20..491 75..539
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117..126 10 N° 2 217..391 175 N° 3 469..568 100 N° 4 661..738 78
N° 5 938..1009 72 N° 6 1160..1278 119 N° 7 1393..1477 85 N° 8 1599..1688 90
N° 9 1849..1950 102 N° 10 2063..2152 90 N° 11 2284..2364 81 N° 12 2495..2566 72
N° 13 2650..2744 95 N° 14 2837..2925 89 N° 15 3013..3075 63 N° 16 3175..3215 41
N° 17 3437..3556 120  
join(117..126,217..391,469..568,661..738,938..1009,1160..1278,1393..1477,1599..1 688,1849..1950,2063..2152,2284..2364,2495..2566,2650..2744,2837..2925,3013..3075 ,3175..3215,3437..3556)


exon

Literature and cross-references AtMDAR01 (At1g63940/MDAR6)
Cluster/Prediction ref. Genebank:   842697
Protein sequence: AtMDAR01 (At1g63940/MDAR6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   53181.52  
PI (pH):   %s   8.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAVRRVMALASTTLPTKSGLSLWCPSSPSLARRFPARFSPIGSRIASRSLVTASFANENREFVIVGGGNAAGYAARTFVENGMADGRLCIVTKAYAPYERPALTKAYLFPPEKKPARLPGFHTCVGGGGERQTPDWYKEKGIEVIYEDPVAGADFEKQTLTTDAGKQLKYGSLIIATGCTASRFPDKIGGHLPGVHYIREVADADSLIASGKAKKIVIVGGGYIGMEVAAAAVAWNLDTTIVFPEDQLLQRLFTPSLAQKYEELYRQNGVKFVKGASINNLEAGSDGRVSAVKLADGSTIEADTVVIGIGAKPAIGPFETLAMNKSIGGIQVDGLFRTSTPGIFAIGDVAAFPLKIYDRMTRVEHVDHARRSAQHCVKSLLTAHTDTYDYLPYFYSRVFEYEGSPRKVWWQFFGDVGETVEVGNFDPKIATFWIESGRLKGVLVESGSPEFQLLPKLARSQPLVDKAKLASASSVEEALEIAQAALQS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCAGGTCTTCTTATCTCTCTCACTCACCACCATCTTCTTCCTCGATTGTCAAAACCCTAGATCGAAATCTTATCTCTCTAATCTGTTGTTACAGTTCGTAGAGTCATGGCGTTA
GCATCAACCACGTTGCCGACGAAGTCCGGATTATCTCTTTGGTGTCCGTCTTCTCCGTCTCTCGCTCGCCGATTTCCCGCTCGTTTTTCTCCGATCGGTTCTAGAATCGCTTCCAGAAGC
CTCGTCACTGCTTCGTTCGCTAACGAGAATCGCGA
GTTCGTATATATAATTCTTCCAATTTTGATTCTGGCGTTGATGAATTTCTATGCGATTGATTGTGTGATTGTGTTAGGTTTGTGA
TTGTTGGTGGAGGAAATGCTGCTGGTTATGCTGCTAGAACTTTTGTGGAAAATGGAATGGCTGATGGTCGGCTATGCATTGTGACCAAAGAG
GTGATTCAAATCGATCCCTTAGTGTTTT
CTTCATCAGTAACACTATTGGTTTTACTTTGTTTGATTGTTGGATTTGTGGTTGTTATTGTTAGGCTTACGCACCTTATGAGAGACCGGCTTTGACAAAAGCTTACTTGTTCCCACCAGA
GAAGAAGCCAGCTCGTTTACCA
GTAAGCTTTGCCAACTTTAATGTTTTGATTCGATCAATTTGAGTGGTTCTTTTAGTGCTATTGCTCTTAATTGGCTACATGAACATTATGGAATGAGT
ACCGGTAGATTGTTTACAGTGTTACGATTGTTACTGATATGAAGATTTGTATGATTTAGTTTTGTGATCTCTGTTTATATTGAGGGTGGTCGTATATGCAGGGATTTCATACTTGCGTTG
GAGGTGGTGGAGAAAGGCAAACACCAGATTGGTATAAGGAGAAAGGAATTGAG
GTAATTCATCTTCTGATACATAGTTTTGTTTTCTAAAATATATGAATGTAAGTGAAGTGTCTTTGGT
TTGATTAACTGTACAGCTTGGAATGTACGTCGGTGAATTTGTGGTCTTCTCTTGTGTCTTACTAATGCATTTTGTTTGGACAGGTAATATATGAAGATCCAGTGGCTGGAGCTGATTTTG
AAAAGCAAACACTCACCACAGACGCAGGGAAGCAGTTAAAATATGGATCTCTAATTATCGCTACAGGGTGTACAGCCTCAAG
GTGAGTGAAAGTCGCATTTTTTTTGCAATGATTGATAA
ACAACATCAGAGAACCTAGGCCTTTTCAACCATGTATACTGATATTATGAATATTTGCTCTGGATTTTTATTGTAGGTTCCCAGATAAAATCGGTGGGCACTTGCCAGGGGTTCACTATA
TTCGGGAGGTTGCAGATGCTGATTCACTGATAGCATCTCTG
GTAAGCTAAGGGCATTTTTACCAGTTACCAGTTTTGTCATCTTAATGCAATGTTGTAATATGCGTCATCAGAAAAATCC
AAATTTCCTGGCTACAAAATAACCTTCCAATATGTGATACAGGGAAAGGCAAAGAAAATTGTCATTGTTGGTGGTGGCTACATCGGCATGGAGGTTGCTGCTGCAGCTGTTGCGTGGAAT
CTAGATACAACG
GTTATTATCCCTTTCACTTGAATTTTTAAATTGTGCTAGAAATGAAGAATACTTCTAATCATTCGATGAGTTAAACAAATTCCTAGAAACGTTCAGATAAATTGTGGA
ACAGATGTACTAACTTACAGTTGCTTTTGGGCTTTCCCATGTGGAACAATAGATTGTATTCCCTGAAGATCAGCTTTTGCAAAGATTGTTCACTCCATCGCTTGCTCAGAAATATGAAGA
ACTGTACCGTCAAAATGGTGTTAAGTTTGTCAAG
GTAAGATATCAGCACACGATCAACACCTTATACTGAAGCCTTTGCTTTCCTGCAAACCTAAGAATTTCAGAAACACAGTGTGCAAA
CTTGAATTTCTCTTTCTGTTGAACAGGGCGCTTCCATAAATAACTTGGAAGCAGGTTCGGATGGGCGTGTATCAGCTGTTAAGCTTGCTGATGGGTCTACAATTGAGGCAGACACGGTAT
AGTTGTAGCTCAGCTTCACTTTTTTCTTTCTCAAATGATGCAAATTCAACAACTTTGATCAAATGAAAACTGTGAAGGGTCAATGTAATACTGACTTTTGTACGACCTGTGTATCCTTAC
TTTACAGGTTGTAATTGGAATTGGAGCTAAGCCTGCTATTGGCCCCTTTGAAACTTTGGCCATGAACAAATCAATTGGAGGAATTCAGGTATTATTATTACAAAACATCCGGATTTATTT
TCCAAGATAATCGGTTTTCAGAGTTAGAACTTCACAAGAAACTACATCAGTATGTTGATACAATTAAAAGTTTGATAAGAGCTCATCTTCAACCACAGGTCGATGGCTTGTTCAGGACAA
GTACCCCTGGAATTTTTGCTATTGGAGATGTCGCAGCCTTCCCTTTGAAG
GTACTTTGCTGCTAGATAATATATGTTAAGCCATCAATTATCTCGTGAAGTGCAAACTCATCATCTTATT
GTCTGATGACCAGATATATGATAGGATGACTCGAGTTGAACATGTTGATCACGCCCGCCGCTCTGCACAACACTGTGTGAAATCACTACTCACGGCACACACTGACACGTAAGCTTCTTC
CCTGGAAAGATCTGTAGACTTTGCCTGTATCCCTTAACGGATATTCACCTATTAGTTCTTGTCTTGCTCAATATTTGCAGGTACGATTATCTTCCATATTTCTACTCAAGAGTATTCGAG
TATGAAGGAAGCCCAAGAAAAGTGTGGTGGCAGTTTTTCGGAGATAATG
GTAAATCTATTTGACCTAAATATGACGCCATCCAATTACTCAAACAATATTTCCACTGTAGCTAAACCACT
GATTCATACTGGCCAGTGGGAGAAACAGTGGAGGTTGGGAACTTTGACCCGAAAATCGCTACCTTCTGGATTGAATCTGGTAAATAATTCCTTCAGCCTTTTCTCACTTCAGTTAACCTT
GCACAAATACACAGCTTAGCAAATTAACTAACTTTGATGAGTAATTATCGTAACACAGGCAGGTTGAAAGGTGTTCTAGTAGAAAGCGGATCGCCTGAGGTAAGAGTCTTTCTTAGCATC
TCCCTCGTTAACATTCTGAATTAGCCAATCTTTAGAGCATCATGCTTCTTTAGATCTGCGAGACTAAAATTAGAATATTTTGGAACGGTCATTGAAACTTGACAATAGCAATTACATCAG
CATGGGTTTTGTTTTCATGTAAATATGTTAACTATATGGATTTTAATTGCTTCCATTGTTATGTATATCTCTTGAAACAGGAGTTCCAGCTTCTACCAAAGCTAGCAAGAAGCCAACCAC
TTGTCGATAAGGCTAAACTCGCAAGCGCATCTTCAGTCGAAGAAGCTCTCGAGATTGCTCAAGCCGCTCTACAGAGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCAGTTCGTAGAGTCATGGCGTTAGCATCAACCACGTTGCCGACGAAGTCCGGATTATCTCTTTGGTGTCCGTCTTCTCCGTCTCTCGCTCGCCGATTTCCCGCTCGTTTTTCT
CCGATCGGTTCTAGAATCGCTTCCAGAAGCCTCGTCACTGCTTCGTTCGCTAACGAGAATCGCGA
GTTTGTGATTGTTGGTGGAGGAAATGCTGCTGGTTATGCTGCTAGAACTTTTGTG
GAAAATGGAATGGCTGATGGTCGGCTATGCATTGTGACCAAAGAG
GCTTACGCACCTTATGAGAGACCGGCTTTGACAAAAGCTTACTTGTTCCCACCAGAGAAGAAGCCAGCTCGTTTA
CCA
GGATTTCATACTTGCGTTGGAGGTGGTGGAGAAAGGCAAACACCAGATTGGTATAAGGAGAAAGGAATTGAGGTAATATATGAAGATCCAGTGGCTGGAGCTGATTTTGAAAAGCAA
ACACTCACCACAGACGCAGGGAAGCAGTTAAAATATGGATCTCTAATTATCGCTACAGGGTGTACAGCCTCAAG
GTTCCCAGATAAAATCGGTGGGCACTTGCCAGGGGTTCACTATATT
CGGGAGGTTGCAGATGCTGATTCACTGATAGCATCTCTG
GGAAAGGCAAAGAAAATTGTCATTGTTGGTGGTGGCTACATCGGCATGGAGGTTGCTGCTGCAGCTGTTGCGTGGAATCTA
GATACAACG
ATTGTATTCCCTGAAGATCAGCTTTTGCAAAGATTGTTCACTCCATCGCTTGCTCAGAAATATGAAGAACTGTACCGTCAAAATGGTGTTAAGTTTGTCAAGGGCGCTTCC
ATAAATAACTTGGAAGCAGGTTCGGATGGGCGTGTATCAGCTGTTAAGCTTGCTGATGGGTCTACAATTGAGGCAGACACG
GTTGTAATTGGAATTGGAGCTAAGCCTGCTATTGGCCCC
TTTGAAACTTTGGCCATGAACAAATCAATTGGAGGAATTCAG
GTCGATGGCTTGTTCAGGACAAGTACCCCTGGAATTTTTGCTATTGGAGATGTCGCAGCCTTCCCTTTGAAGATATAT
GATAGGATGACTCGAGTTGAACATGTTGATCACGCCCGCCGCTCTGCACAACACTGTGTGAAATCACTACTCACGGCACACACTGACAC
GTACGATTATCTTCCATATTTCTACTCAAGA
GTATTCGAGTATGAAGGAAGCCCAAGAAAAGTGTGGTGGCAGTTTTTCGGAGATAATG
TGGGAGAAACAGTGGAGGTTGGGAACTTTGACCCGAAAATCGCTACCTTCTGGATTGAATCT
G
GCAGGTTGAAAGGTGTTCTAGTAGAAAGCGGATCGCCTGAGGAGTTCCAGCTTCTACCAAAGCTAGCAAGAAGCCAACCACTTGTCGATAAGGCTAAACTCGCAAGCGCATCTTCAGTC
GAAGAAGCTCTCGAGATTGCTCAAGCCGCTCTACAGAGTTAG

Retrieve as FASTA