Entry information : AtDHAR03 (AT5G16710/DHAR3/CPFC2)
Entry ID 13839
Creation 2016-07-28 (Christophe Dunand)
Last sequence changes 2016-07-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-25 (Christophe Dunand)
Peroxidase information: AtDHAR03 (AT5G16710/DHAR3/CPFC2)
Name (synonym) AtDHAR03 (AT5G16710/DHAR3/CPFC2)
Class Dehydroascorbate Reductase    [Orthogroup: DHAR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtDHAR03
start..stop
S start..stop
ThasDHAR02 422 1e-151 1..258 1..261
HaDHAR15 353 1e-124 1..258 1..254
HaDHAR11 296 1e-102 49..256 3..211
ThasDHAR01 295 3e-102 49..256 3..210
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25..220 196 N° 2 542..632 91 N° 3 746..889 144 N° 4 1056..1173 118
N° 5 1297..1437 141 N° 6 1553..1639 87  
join(25..220,542..632,746..889,1056..1173,1297..1437,1553..1639)


exon

Literature and cross-references AtDHAR03 (AT5G16710/DHAR3/CPFC2)
Cluster/Prediction ref. Genebank:   831532 Phytozome Gene 11:   19668163
Omic ref. AtProteome:   At5g16710 ATTED-II:   At5g16710 e-FP Browser:   At5g16710 TAIR:   At5g16710
Protein sequence: AtDHAR03 (AT5G16710/DHAR3/CPFC2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   259
PWM (Da):   %s   28495.54  
PI (pH):   %s   7.92
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISLRFQPSTTAGVLSASVSRAGFIKRCGSTKPGRVGRFVTMATAASPLEICVKASITTPNKLGDCPFCQKVLLTMEEKNVPYDMKMVDLSNKPEWFLKISPEGKVPVVKFDEKWVPDSDVITQALEEKYPEPPLATPPEKASVGSKIFSTFVGFLKSKDSGDGTEQVLLDELTTFNDYIKDGPFINGEKISAADLSLAPKLYHMKIALGHYKNWSVPDSLPFVKSYMENVFSRESFTNTRAETEDVIAGWRPKVMG*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAAGCCTTAGGTTTCAACCAAGCACCACCGCCGGTGTTTTATCGGCGTCAGTGAGCCGCGCCGGTTTTATCAAGCGGTGCGGTTCGACTAAACCGGGAAGGGTTGGCCGGTTTGTT
ACAATGGCGACGGCGGCGAGTCCTCTTGAAATCTGCGTTAAAGCTTCTATCACCACTCCCAACAAGCTCGGAGACT
GTTAGTTTTCTCTCCGTAAACTTTGAAATGTTGATGATTAGCTG
CAATTTGATCCCTCTTTCACTCAATTTCGAATTGGAGATAGATAATTTGTGTTAGCTCCATTGGTGCAGATAGATACTTAGACTTAAGAATTTGAGGATTTCGTGTCAAACTTAATTGGT
GTTTAGATTGTTTCTTAATTTCGAAAACTGAAACTATTCAAAACATACTTTTAAGGTTTAATAAGCTAACACGATTGCTTCTATGTTTGTGGCGAGTACTGGTTTTGAAGTATATTTTTT
CTCAGTGAGTTGATTATATGCATAATTTTGTTGATAGGCCCTTTTTGCCAAAAGGTGTTACTGACAATGGAGGAGAAGAATGTTCCTTATGACATGAAAATGGTGGATTTGAGTAACAAA
CCAGAATG
GTGAATTCTTGGATTCTTTCCATAACGTGCCTGAAGTAGACATGATTCTTGATTAATGGCAGTGATTTCCTTAGTTTTTTCAATGGGTTGTGTTCTTGTTTATTGTTTATTA
GGTTCTTGAAGATTAGTCCAGAAGGTAAAGTCCCAGTTGTGAAGTTTGATGAGAAATGGGTTCCGGATTCAGATGTTATAACACAGGCTTTAGAAGAGAAGTATCCTGAGCCTCCTCTTG
CTACCCCACCTGAAAAGGCTTCAGT
GTAAGCATTCCTTCTTCTTTTTTTCGGTCTTATGATGCACTTGTTTTTGTGCAATTGACCTTCTAGTGTTCTTTGTTGAAAAAGGGTTCATTTGA
CAACTTGCATACTTCCAGCTAAGAATTTGCGTGTGGACGTTTAATTCTTTAATTTATGTCTGTTTCTGCAGTGGATCGAAGATCTTTTCCACATTTGTCGGTTTTCTGAAGAGCAAAGAT
TCAGGAGATGGAACTGAGCAAGTTTTGTTGGATGAGCTTACTACATTCAACGATTATATCAAGGACAAT
GTAAGCTCTTTTGGTTTTGATCTCTTGTATATCCTTAAGTAATAGTTGTGA
TGATCTTAGAGTAGATTATTCTGGCTGTTGATTGAAACATATATTTACTTCTCTATCTTCCATAATGTGAAGGGCCCTTTCATAAATGGAGAGAAGATCTCGGCAGCAGATTTGTCCTTG
GCACCAAAGTTATACCACATGAAGATTGCATTGGGACATTACAAGAACTGGTCTGTTCCAGATTCACTTCCTTTCGTCAAATCCTACATGGAG
GTAAATAAATGTCAGAAAAACCGAGCT
AGTCCTTTCGATGTTATTCTGAACAACCACATTCTTTTTTGGATTTATTTTCATTCGGTTAAACCAACTGCACCATAATGATTTACAGAATGTTTTCTCGAGGGAATCATTCACGAACAC
ACGGGCGGAAACAGAGGATGTAATTGCTGGTTGGAGACCAAAGGTTATGGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAAGCCTTAGGTTTCAACCAAGCACCACCGCCGGTGTTTTATCGGCGTCAGTGAGCCGCGCCGGTTTTATCAAGCGGTGCGGTTCGACTAAACCGGGAAGGGTTGGCCGGTTTGTT
ACAATGGCGACGGCGGCGAGTCCTCTTGAAATCTGCGTTAAAGCTTCTATCACCACTCCCAACAAGCTCGGAGACT
GCCCTTTTTGCCAAAAGGTGTTACTGACAATGGAGGAGAAGAAT
GTTCCTTATGACATGAAAATGGTGGATTTGAGTAACAAACCAGAATG
GTTCTTGAAGATTAGTCCAGAAGGTAAAGTCCCAGTTGTGAAGTTTGATGAGAAATGGGTTCCGGATTCAGAT
GTTATAACACAGGCTTTAGAAGAGAAGTATCCTGAGCCTCCTCTTGCTACCCCACCTGAAAAGGCTTCAGT
TGGATCGAAGATCTTTTCCACATTTGTCGGTTTTCTGAAGAGCAAAGAT
TCAGGAGATGGAACTGAGCAAGTTTTGTTGGATGAGCTTACTACATTCAACGATTATATCAAGGACAAT
GGCCCTTTCATAAATGGAGAGAAGATCTCGGCAGCAGATTTGTCCTTGGCA
CCAAAGTTATACCACATGAAGATTGCATTGGGACATTACAAGAACTGGTCTGTTCCAGATTCACTTCCTTTCGTCAAATCCTACATGGAG
AATGTTTTCTCGAGGGAATCATTCACGAAC
ACACGGGCGGAAACAGAGGATGTAATTGCTGGTTGGAGACCAAAGGTTATGGGTTAA

Retrieve as FASTA