Entry information : CsPrx12 (orange1.1g019854m/Cs2g03110)
Entry ID 1386
Creation 2007-09-10 (Christophe Dunand)
Last sequence changes 2015-04-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx12 (orange1.1g019854m/Cs2g03110)
Name (synonym) CsPrx12 (orange1.1g019854m/Cs2g03110)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx12
start..stop
S start..stop
PtriPrx01 692 0 1..335 1..335
CppPrx01 692 0 1..335 1..335
CclPrx01 692 0 1..335 1..335
MePrx05 620 0 1..332 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1783850..1784083 234 N° 2 1783506..1783694 189 N° 3 1783173..1783338 166 N° 4 1782602..1783020 419
complement(join(1782602..1783020,1783173..1783338,1783506..1783694,1783850..1784 083))


exon

Literature and cross-references CsPrx12 (orange1.1g019854m/Cs2g03110)
Literature Bausher,M., et al., An expressed sequence tag (EST) set from Citrus sinensis L. Osbeck whole seedlings and the implications of further perennial source investigations Plant Sci. 165, 415-422 (2003).
DNA ref. Citrus sinensis Annotation Project:   chr2 (1357786..1360813) Phytozome 12:   scaffold00007 (1784083..1782602)
EST ref. GenBank:   CX674813 [5' end]   CK934605 [3' end]
Cluster/Prediction ref. UniGene:   Csi.4819
Protein sequence: CsPrx12 (orange1.1g019854m/Cs2g03110)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (310)
PWM (Da):   %s   37661.35 (35100.9)  
PI (pH):   %s   8.38 (8.02) Peptide Signal:   %s   cut: 26 range:26-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTKAVFLLLALLSFSAVSLRSALAENEEDPGLVMNFYKDTCPQAEDIIREQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRKTLSEKEMDRSFGMRNFRYIENIKEAVERECPGVVSCADILVLSGRDGVVALGGPYIPLKTGRRDGRKSRAEILEQYLPDHNDSMSVVLERFAAIGIDAPGLVALLGSHSVGRTHCVKLVHRLYPEVDPALNPDHVPHMLHKCPDAIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLMMVDHQLATDKRTRPYVKKMAKSQDYFFKEFSRAITLLSENNPLTGTKGEIRKVCNLANKLHDKS

Retrieve as FASTA  
Remarks Complete sequence from genomic and 194 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACGAAAGCTGTCTTCTTGCTTTTAGCTTTGCTATCCTTCTCAGCTGTGTCTCTGAGGTCTGCTTTGGCAGAAAATGAAGAGGACCCAGGTCTTGTTATGAATTTTTACAAGGAT
ACATGCCCTCAGGCCGAGGACATTATCAGGGAACAAGTTAAGCTTCTGTACAAGCGCCACAAGAACACTGCATTTTCTTGGCTTAGAAACATTTTCCATGACTGTGCTGTCCAG
GTAATT
AATTTATCATAAATCATATATATTACTAATTATAATACATGCACTCTTTTTAATATTTATTACATTATTTTACGTGCTCTGGAGATATATGCTGCTAATTAATTGCTTGCTTCCCACCCA
CCCTTCCTTTTCTTTGCATGTTTGCATAGTCTTGTGATGCTTCACTGCTTCTGGACTCGACAAGAAAGACCTTGTCTGAGAAGGAGATGGACAGGAGCTTTGGTATGAGGAACTTCAGGT
ACATTGAGAACATCAAAGAAGCTGTTGAAAGAGAGTGCCCTGGTGTTGTTTCCTGTGCTGATATCCTTGTCCTGTCCGGTAGAGATGGCGTTGTTGCG
GTACACTTTTTTTTCTTTAATT
AACCACCATTTCATCACTCAAATTTTTGTATTTTATTTTTTATTTAAAGAAAAAAAAAACACATTTTTTTTTTTTAAATTTCACTAGATCTCCAAATGGACAATGGGTATGAGATTTTTC
TGATGGTGTCTGAAACTTGTTTCAGCTTGGAGGCCCTTACATTCCTCTCAAGACAGGAAGAAGAGATGGTAGAAAAAGCAGAGCAGAGATACTTGAGCAGTATCTCCCAGATCACAATGA
CAGCATGTCTGTTGTTCTTGAGAGGTTTGCAGCCATTGGCATTGACGCCCCTGGACTTGTTGCTCTGCTAG
GTAATTTTTTTTTTCCCCCTTAATCTATGCTTCAATTACGACTATTAAG
CATACAACGACTGAGTTTCTTAAACTTTAAAAAGAAGTAATTTAANNNNNNNNNNNNNNNNNNNNNNNNNNTCTTAGTTACTACTATTGGTCTATTTCATCAGGATCTCACAGTGTTGGC
AGAACTCATTGTGTGAAGCTGGTGCACCGTCTGTACCCAGAAGTTGACCCTGCACTGAACCCTGACCATGTTCCGCATATGCTCCATAAGTGTCCTGATGCAATCCCAGACCCCAAGGCT
GTTCAGTATGTGAGGAATGACCGTGGCACACCCATGGTGCTGGACAACAACTACTATAGGAACATATTGGACAACAAGGGCTTGATGATGGTTGATCATCAGCTAGCCACCGACAAGAGG
ACAAGACCTTATGTTAAGAAGATGGCCAAGAGTCAAGACTACTTCTTCAAGGAATTTTCAAGAGCCATTACTCTCCTTTCTGAGAACAACCCTCTCACAGGTACAAAGGGTGAGATCCGA
AAGGTTTGCAATCTTGCCAACAAGCTCCACGACAAGTCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACGAAAGCTGTCTTCTTGCTTTTAGCTTTGCTATCCTTCTCAGCTGTGTCTCTGAGGTCTGCTTTGGCAGAAAATGAAGAGGACCCAGGTCTTGTTATGAATTTTTACAAGGAT
ACATGCCCTCAGGCCGAGGACATTATCAGGGAACAAGTTAAGCTTCTGTACAAGCGCCACAAGAACACTGCATTTTCTTGGCTTAGAAACATTTTCCATGACTGTGCTGTCCAG
TCTTGT
GATGCTTCACTGCTTCTGGACTCGACAAGAAAGACCTTGTCTGAGAAGGAGATGGACAGGAGCTTTGGTATGAGGAACTTCAGGTACATTGAGAACATCAAAGAAGCTGTTGAAAGAGAG
TGCCCTGGTGTTGTTTCCTGTGCTGATATCCTTGTCCTGTCCGGTAGAGATGGCGTTGTTGCG
CTTGGAGGCCCTTACATTCCTCTCAAGACAGGAAGAAGAGATGGTAGAAAAAGCAGA
GCAGAGATACTTGAGCAGTATCTCCCAGATCACAATGACAGCATGTCTGTTGTTCTTGAGAGGTTTGCAGCCATTGGCATTGACGCCCCTGGACTTGTTGCTCTGCTAG
GATCTCACAGT
GTTGGCAGAACTCATTGTGTGAAGCTGGTGCACCGTCTGTACCCAGAAGTTGACCCTGCACTGAACCCTGACCATGTTCCGCATATGCTCCATAAGTGTCCTGATGCAATCCCAGACCCC
AAGGCTGTTCAGTATGTGAGGAATGACCGTGGCACACCCATGGTGCTGGACAACAACTACTATAGGAACATATTGGACAACAAGGGCTTGATGATGGTTGATCATCAGCTAGCCACCGAC
AAGAGGACAAGACCTTATGTTAAGAAGATGGCCAAGAGTCAAGACTACTTCTTCAAGGAATTTTCAAGAGCCATTACTCTCCTTTCTGAGAACAACCCTCTCACAGGTACAAAGGGTGAG
ATCCGAAAGGTTTGCAATCTTGCCAACAAGCTCCACGACAAGTCCTAG

Retrieve as FASTA