Entry information : KflPTOX01 (kfl00205_0040)
Entry ID 13864
Creation 2016-08-23 (Christophe Dunand)
Last sequence changes 2016-08-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-20 (Christophe Dunand)
Peroxidase information: KflPTOX01 (kfl00205_0040)
Name (synonym) KflPTOX01 (kfl00205_0040)
Class Plastid Terminal Oxidase    [Orthogroup: PTOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflPTOX01
start..stop
S start..stop
MpPTOX02 378 5e-131 102..360 96..363
PpaPTOX02 365 2e-125 86..363 86..393
ThasPTOX01 359 2e-123 52..352 46..358
AtPTOX01 353 2e-121 104..351 93..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32613..32725 113 N° 2 31872..32000 129 N° 3 31097..31226 130 N° 4 30576..30669 94
N° 5 29952..30016 65 N° 6 29036..29195 160 N° 7 28536..28676 141 N° 8 27716..27763 48
N° 9 26989..27069 81 N° 10 26241..26380 140  
complement(join(26241..26380,26989..27069,27716..27763,28536..28676,29036..29195 ,29952..30016,30576..30669,31097..31226,31872..32000,32613..32725))


exon

Literature and cross-references KflPTOX01 (kfl00205_0040)
DNA ref. GenBank:   DF237154.1 (32725..26241)
Protein sequence: KflPTOX01 (kfl00205_0040)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367
PWM (Da):   %s   41119.58 Transmb domain:   %s   o206-225i
PI (pH):   %s   7.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSVELQSRTVLPYRQDESAGSSRAAGASGQPVFQARRVCQGSAKRQEQNLRKGVLGRKVGLSKVPGIVPSFDPVCGNSRWSMKAVSAPPAKSKDYLPPPEDSATGWEAGLIGVERRINHALDFVVILLDAFYADRHYARFYVLETIARVPYFSYVSVLHMYESFGWWRRADYIVHFAESWNELHHLLIMESLGGDRRWIDRFLAQHVAVVYYLLCCIIYLVSPRMAYHLMECVETHAYHTYDSFLATFGDKLKTKPAPEVAVKYYTEGDLYMFDEFQTAATPGVRRPKIENLYDVFVNVRDDEGEHCKTMRACQTAGSISSPHQDTPVLPGDLCSGVVECSTTAVSAADRFLKHGVPIDDTL

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCTCAGTAGAGTTGCAAAGCAGAACTGTCTTGCCATATCGGCAAGATGAGTCCGCAGGATCCTCAAGGGCAGCAGGGGCCAGTGGGCAACCCGTCTTTCAAGCAAGGTGGGTG
TTGATTGAGCGTTTCATCTGCCAGCCACTGTCAGCACATTCTCTTATCGTAAACTGCCGCATGCACTTACTTTTACACTAACAATCTTTTAGGGTTTGCCCCTGTCGCTCTGAGGTTTGT
AGGTGGATCTTTGCCCTGGGCTTTTCGGGGACCCTGGGCTTGAGCCTGCAGTTTTGTCTTTTGTTGCAAAGTACTTATACTAGCTGTTGTCTATTTGTGATTGCCACTTCATCCGAATTC
TGATGCAAAGTGGGGAAGTCAAAACAAGAGTGATTGTTATGAAACCTAATCTGCTTTTCATCTTTGGCAGAAATGCTCAACGGAGCACTCCAGTCGTGGTCGCTATGCATCCAGGATCTA
TGCAGCTTTGGATTCGTGTGCTGTAAATGCAAATCCTTTTTGAAAGTGGACACATTCAGGATGTGACCTGTTTAGTAAGCACAGTTGAGTGTCGGGCAAGTGACAATCTGATCTGATTCA
ATCTTGAAAACATTCTGTTCTGGGTTGAGAACCTCCGTATTACAACTGGCACAATTGCTGACGTCTCAGATCATGGACACAATTCAGAGCACAACATGTTCTGACTCGCCGCTGTCCTCT
AGCAGGCGTGTGTGCCAGGGTTCTGCAAAACGCCAAGAGCAGAACCTGAGGAAGGGCGTTTTGGGGCGGAAAGTTGGCCTTTCGAAAGTGCCTGGCATTGTTCCGTCCTTCGACCCTGTC
TGTGGAAACAGCAG
GTCCGTAGTGAACACTCCAGCTTACTCAGTAGATGATGTTAGGAGCATCTACGTTCCCGCAGATTAGTACTTGTTACTTTCCTTCGCTAATCAAGTGAACGTGTCT
GTCGCATCCATTGAATGGAAGTTGCTTCGTCTTGGATTGATTACATTGGTCTACCGAAGCTGCAACTATATGGCTTTCCAAGTTTGACACATCCAAAGTGATTAGTGAATTTGGAACTTG
TTTCAAGGCCTTCCAAAGATTCTGCATCCAAAGTGGCCAGTCACATTTGGAACTTGTGAACAGTTGCTGTTTGTGTTCCAAGGGGGCGGAAACATTGAGAGTGGCCTTCTAGCGCCAGTG
AAACAAACAACGAAGGGGTCTCTGTGGCTTGAGCTGACATGAGTTGTTCACTGTACAACTGGGTTTTACTCCGTTCCTGACGGCCACATGGAGTTGAATTGGTACCAGGGCAAAGGTTGG
CCGTCAATCCTTGGGCGGGAAAGCGTCCTTATACGCCCGCTTTTTATGGTGCTTGAGGATCTGTACAGAAGCCAGTGTTTTCATGTGAAGTTGCAAGGCGTGTGGGGCGCCTTCAAAAGA
AGGCTGTCGTACATTGTCCTTCTTTTCAAACTAGAAAGATTCATGTCTGCTTCATGCAGATGGTCAATGAAGGCCGTGTCGGCTCCGCCAGCAAAGAGTAAAGACTACTTGCCTCCTCCA
GAGGACTCTGCAACCGGGTGGGAGGCGGGGTTGATTGGGGTGGAGAGAAGAATAAACCACGCGCTAACG
GTGAGTTGGTCACTTGCCTTGATTGCTTGCAGGACGATTTGATGGCAAACC
AGAAGCGAGGTGCTGATCACTCCAAGGAAAGGGCTTGTTACGCGCCAACCTAGTTGTTATGGAAATGTGAGTGGGGGAGGGCAGGAAGATCGTCCCGGTCTGAGCTAATGAAAGGATTTT
AAGAGGCTGCACGAAAACCGGTACGCTTCATGTGCTACGACAGTTTCACGGGGACACTGGATTTTTCAGCAGCATCTGTACGGTTGGGTCGTTCGCCTCCCGTTGCAAGATTTTCTTCCA
GGCTTGAAGCAGCTTCAATTGAAAAAATGTTCAACATTTGAGAAAAAAACTCGTCTTATGACCGTCAACAAGCTTGTTGACTGGTGATGTCGGTCCATTTCTTTGATACAGCTCACCAGG
TTCCGCTTGCTTGCAGGATTTCGTCGTCATTCTTCTGGATGCGTTCTACGCGGACAGGCACTACGCACGCTTTTACGTCCTGGAAACAATCGCTCGGGTTCCTTATTTTTGTAAGTTCGT
CTATCTCACTACTCTCTTGGATACCGCTGCTATCTCAAGCCCTCTCAGGCGTACATGAAAGACTGAATGGCCCTTCAACTTCGAGTGGCTCGGAATTTCGACTTGAAGCAGTCAACTGGA
GTGAACTTCTGAAACCGCCACACAATCGCTGGAAGCTTACAGAAGGCTGCCAGGCAAAGCTGTAGGCAATCCCCGTCGATCTCAGCTATGGTTCATGCGGCTGGTCGGAGGATTGGCCGC
AGTTTGCGAGGAGTCTATGGACGTCATCGAGAAGCCTTGAAACGAGTACTTTGCGGCTTTGAAGCCGCTCACCCGTTTGAAGCTAGCCCAGACAAAAGAGCGGCATGAACGTAGTGGCGC
AAGGCTCTATGCTGCTGAAGTCGGGGCGTGTTTGGTCCTTCTCACTTTGGGAGGCTTTGATTTCAGGTCGGACAGAAGCGCAACGCAGTGCTCTGCGTATCAAGTTCAATGCAAGGCTGC
GGTCATTTTTATGGCGTGGGAAATGGGGTGTATTCCCAAGAATGACAAATTGTTTCTCTCCGTTTGCAGCTTATGTTTCGGTTTTACATATGTATGAGAGCTTTGGGTGGTGGCGGCGAG
CAGACTACATCAAG
GTGAGCACGCACTGCACCAGCTGCGCCCCGAAACTCAAGGGCAAGTTTGGGCTTTGTTATTGATGTGCTGAAAGACGTCGTGTTAGGACGCAACTGCCGAAGCCAA
CCTTTTGTGACCCAGGAGTCATGGACCACTACGAGCCTTGGACTTGATATACTGGAGGCACTACGATTCAGAATGCAGTTGCCGGATTCAACCTGTTGCTCCGGATTGTGAAGCTCGCGG
AGCTCGCATAAGGGCAGAAGCGGCAGGTTGTCGGTCAAATGTCTCTTCGTGGCATCTTGCCAACGGGGCCTTCTCAATGGAATGCTTTACATGTGACGTAGCGTTCTACCTTATGCCATC
GGCTGCGCTTAGTTTGAGATAGGCTTTGTGGGGGTAATTACTGAATGGACCAGTGAAAGCCGGTACACAGCATACATTACCTACTTCTTCAAGCTGAAAACTTCTCCACTGCCCCAGGGA
GGTGACGCCGATTGTGAGCCCAGCAAGTGATCGGCGTCGATTTGCACGTTCCAGAGCCTGTTTGAAAGTGAAAACGCAGAGAAGGACCTCCTTCACTTCCGGCTTTACTGCAAGCGTCGT
TCGCTTCCGGGCACTCCCTTCGCTTTTCTTCCCTTCGGATCTCTCGTTTACCACGTGTGTTCAGCAGAGGCGTCAGACTTCCAGAATCTCATTTCCTGCGCAAGTAAAACCGGATTGTTT
GTGCTTTCTCTCCGCCGCTCAACTCAAAACCCGTTGTTATTTCACCGCAGGTTCACTTTGCTGAATCGTGGAACGAGCTGCATCACCTGCTCATTATGGAGTCGCTGGGAGGCGACCGGC
GGTGGATCGACCGCTTTCTGGCGCAACACGTGGCAGTCGTCTACTACCTCCTGTGTTGCATCATCTACCTGGTCAGCCCGAGAATGGCGT
GTGAGTCACGAAACCCTATCTGAGCTTTCA
GGGTCCATCATGTCGTGCTTCTGTCGTAGGTGACACGATAGGAAGAGTGCTCGCGCGGGGTTGCCGCTTTGTCTCGCACTCTCCGTTTTCATTCTGCGTTTGGGCGATTCCAAAGCGCTC
TCATCCCCCACGGCCCGTGTATGTCCGGCACTCTCGAAACTTATCGTTTTGTCACTTCTTTGCGTGTGCCAACCAGATAAGTGCCTCTTTTTATCTGCTCGTATCTCACACTTCTGAGCC
AAGTGACCGTTGATCCCTGTTTACCTGCTTCTTTCCAGTATTCGCACGTTAGAGCACTTCTTTCTGACGAGCTTGTTGCCACCGTGCAGATCACTTGATGGAGTGCGTCGAGACGCACGC
GTACCACACGTACGACTCGTTCCTGGCAACTTTCGGCGACAAGCTTAAGACGAAGCCGGCCCCGGAGGTCGCCGTCAAGTATTACACCGAGGGAGACCTGTACATGTTTG
GTGAGCGTGC
TTGTAAAGGGCTTTAGCAGCCTCCCTCGCTGGAAAATTCGGCGGCGTTTTCGCAGAGGCGCCGCCTAAGATTCGCCGGACGATTTCTCGGGTGGCAGCAATTTTCGGTGCTGTCACGGGC
TTGGGCCCGTTTGGGCAGATTCTTGAGTGCGCGAGCAACGGTTGGAACGTTTGCATCAAGTGAGATCCAAAGAGCGAGCTTGAGGGCATCTCGTAGTGTGGTTCCACCATCGAGCCCCCG
TTCTAAAAGGAAAACCCAGTTGGAGGTGTTGAACTGTTAAAAGACAAGCCAACGCCGCAGTCTCGAATGTCGTCGGGTCTGTTCCGGATCGTGATTGATCTGACCGGAATCTTAATCGAC
CTTTTTTCTGGGGGCAAGCGTTGGTTGTCAATTTAAGGCATCACAGTGAAATCACTGGACGTCTAGACTGCTGCTCGATATGCATTCCTCCTGTTCCGACACCGGTCTGCGACCCTGGTT
CTCGCAATGAAGGGCGTTACATCCTTTAGATCCACGTGCAGGGGGAGAGCGTCACAGCTTTTTACGAATCTCAAGAAAGAGCTTAAAAAGCCAAGATAATATCAAATTCCGACTCACTCC
AAAAACCCTAACCCAAAAAGGTACCTGCTCCGCACGATCACCCACCTTAACCACCAAAGTTAACCTTACCCGTCCCAGTGCGGTTACCTTAGTATTATTTCGGCTCATTATTAGTTTTTC
TTCAGTTCGACACAGAGTCTCACCAGGTCTCTTTCTCTGCAGACGAGTTTCAGACGGCCGCCACACCGGGCGTCCGGCGACCCAAAATAGGTAAGCCGCTCATGCCGCCGGTTGGTCAGT
TGATAAATCGGGAGGAATTCATAGGCGGCCGTTTCTATAACCTGGCAGGCGTGCATTGGACCAATCCCGATAAGCCTGCTCTGCTTGTGAACCGTCTTTGTCAAAGACTTGAGATTCGCC
TTCGTCTGACTTGATTCAGACGAGACGAGCGAACCAGAAAGGAAGGCTCTGTTGTTGCCGGAACCCCGACAATGTCATATCTGAACTTTCTGTACTTTTGCTTTTGCCAAATCCGGTGCG
TTCTGCCAATCATGTACTTTTCTGGTGAACTCGAGTGTTCGTCTATAAGAGCGACCTTCTCTGAATTGTTAATATTTCGGTCCTTGTCAGTTGGACGTTGTACAAACTTCGCCTGCTCTG
GCCGGCTGACTAACTTTTGAGGAAAAGTTAAAAAGACAGGCGACGCTGCGAGTACCTGACACCGAACGTCCCTCTCGTTACCGACCCCAGATTAAAGCTCTTGAGGAGATGCTTCAAGAC
ACATTTGGCCTCGTTTTCCCAGCTTTCCAAATCCGTTGATGGTCTGCTCCTCAGCACTCCTGTGCGCAAAGTCAATGTCCCGACTCGACTCAAAGTTTCTTCCAACTTTGCTGACGCCCG
TTCTCCGTATCCGCAGAGAACTTGTACGATGTGTTTGTAAACGTGAGGGATGACGAGGGAGAGCACTGCAAAACGATGCGGGCCTGCCAAACCGCAGGTGGGCTTTTAAAGATTGAGTTG
ATTCGCTTCTGCCACTCTGCGTTTTTGCTTCGGCAATGGTAGCTTTTTGCAGTGGTTCTGTTGGCGCTCTTCGTCCGTTCTTTATCATGCCTCTGATCAGGCCTCTTCCCTTCCAAATTT
CGGTCGACTCAAGCTGCGAGTAAAGGTCAGCCCTCAACGCTGAACGGAACGCTTTATTTTTGGAAGGATGAAAGTAGCTGGGCGAGAATTCGGATTGGTGCCGGTCAATCTCGCTTCCGC
CGGCGACACTTGTTCTCTCGCTCTCAGTTGGTATGAAAGGTCCTCCATCGATTTCAGCCGCAGAATTGGAAAGGAAGTAAAGCGTCAGACACCGTGCGCTCAATTGTCGGCCAACGACAG
CTCCTGAGAGATGAACGTACACGCTTGACAAACCTTTTTTCAGCGTTCTGGCTGTGCCTTGGTTTCGCGTGTCTTGCTACCGCCGTCGGCTGGCATTTGCTGCCCTCCTTCCTGCGGGAG
TTTTGAAACGTTTTCTCAAGGCGGCAGCTTAAAAATTTTCAGGTGTGAATCTTGTGATCAACCAAACTCGGTTCTTACATGATTAGCGTCTGCCATTGTTTGCAGGTTCCATATCGTCTC
CCCATCAGGACACGCCCGTCCTGCCTGGCGATCTTTGTAGCGGCGTTGTCGAATGCAGCACCACTGCGGTGTCGGCTGCTGATAGGTTCTTGAAACACGGCGTCCCTATCGATGATACCC
TTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCTCAGTAGAGTTGCAAAGCAGAACTGTCTTGCCATATCGGCAAGATGAGTCCGCAGGATCCTCAAGGGCAGCAGGGGCCAGTGGGCAACCCGTCTTTCAAGCAAGGCGTGTG
TGCCAGGGTTCTGCAAAACGCCAAGAGCAGAACCTGAGGAAGGGCGTTTTGGGGCGGAAAGTTGGCCTTTCGAAAGTGCCTGGCATTGTTCCGTCCTTCGACCCTGTCTGTGGAAACAGC
AG
ATGGTCAATGAAGGCCGTGTCGGCTCCGCCAGCAAAGAGTAAAGACTACTTGCCTCCTCCAGAGGACTCTGCAACCGGGTGGGAGGCGGGGTTGATTGGGGTGGAGAGAAGAATAAAC
CACGCGCTAACG
GATTTCGTCGTCATTCTTCTGGATGCGTTCTACGCGGACAGGCACTACGCACGCTTTTACGTCCTGGAAACAATCGCTCGGGTTCCTTATTTTTCTTATGTTTCGGTT
TTACATATGTATGAGAGCTTTGGGTGGTGGCGGCGAGCAGACTACATCAAG
GTTCACTTTGCTGAATCGTGGAACGAGCTGCATCACCTGCTCATTATGGAGTCGCTGGGAGGCGACCGG
CGGTGGATCGACCGCTTTCTGGCGCAACACGTGGCAGTCGTCTACTACCTCCTGTGTTGCATCATCTACCTGGTCAGCCCGAGAATGGCGT
ATCACTTGATGGAGTGCGTCGAGACGCAC
GCGTACCACACGTACGACTCGTTCCTGGCAACTTTCGGCGACAAGCTTAAGACGAAGCCGGCCCCGGAGGTCGCCGTCAAGTATTACACCGAGGGAGACCTGTACATGTTTG
ACGAGTTT
CAGACGGCCGCCACACCGGGCGTCCGGCGACCCAAAATAG
AGAACTTGTACGATGTGTTTGTAAACGTGAGGGATGACGAGGGAGAGCACTGCAAAACGATGCGGGCCTGCCAAACCGCA
G
GTTCCATATCGTCTCCCCATCAGGACACGCCCGTCCTGCCTGGCGATCTTTGTAGCGGCGTTGTCGAATGCAGCACCACTGCGGTGTCGGCTGCTGATAGGTTCTTGAAACACGGCGTC
CCTATCGATGATACCCTTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGCTTCTCTA GAATTCTGAG CTTCTTGTCT CTTTGTATAA CTAATAGTCC AGTGAAGACG CCCATTTTCA ACCTTTCTTG TTCCAGTTGC TGCCTTCTCG GAGTAAGCGG CACTACAGCG  GCCAAGCTTT CCGGTTTTCT GACTCAGCTG GGCCTCACAA TTGAGTCAAG AGTTCTTGTA GAATCGAGTA AGCCGTTTAG CGCGGGCAAT CGACGCTGTC CTTTGATGAG CTAATCTGGA  TCAGAGACTC AATCGCAGAG AATTCTTGCA GTTTAAGAGG GTTTAGCGTC TGAATTTAGC TGGGTGCAAT CACACCTGCT TTCAAGAGCA AGCTTACCGC AGCGTTGGAG CCGGGTAGAG  GAACCCGAGA TGGCTCTCTC AGTAGAGTTG CAAAGCAGAA CTGTCTTGCC ATATCGGCAA GATGAGTCCG CAGGATCCTC AAGGGCAGCA GGGGCCAGTG GGCAACCCGT CTTTCAAGCA  AGGCGTGTGT GCCAGGGTTC TGCAAAACGC CAAGAGCAGA ACCTGAGGAA GGGCGTTTTG GGGCGGAAAG TTGGCCTTTC GAAAGTGCCT GGCATTGTTC CGTCCTTCGA CCCTGTCTGT  GGAAACAGCA GATGGTCAAT GAAGGCCGTG TCGGCTCCGC CAGCAAAGAG TAAAGACTAC TTGCCTCCTC CAGAGGACTC TGCAACCGGG TGGGAGGCGG GGTTGATTGG GGTGGAGAGA  AGAATAAACC ACGCGCTAAC GGATTTCGTC GTCATTCTTC TGGATGCGTT CTACGCGGAC AGGCACTACG CACGCTTTTA CGTCCTGGAA ACAATCGCTC GGGTTCCTTA TTTTTCTTAT  GTTTCGGTTT TACATATGTA TGAGAGCTTT GGGTGGTGGC GGCGAGCAGA CTACATCAAG GTTCACTTTG CTGAATCGTG GAACGAGCTG CATCACCTGC TCATTATGGA GTCGCTGGGA  GGCGACCGGC GGTGGATCGA CCGCTTTCTG GCGCAACACG TGGCAGTCGT CTACTACCTC CTGTGTTGCA TCATCTACCT GGTCAGCCCG AGAATGGCGT ATCACTTGAT GGAGTGCGTC  GAGACGCACG CGTACCACAC GTACGACTCG TTCCTGGCAA CTTTCGGCGA CAAGCTTAAG ACGAAGCCGG CCCCGGAGGT CGCCGTCAAG TATTACACCG AGGGAGACCT GTACATGTTT  GACGAGTTTC AGACGGCCGC CACACCGGGC GTCCGGCGAC CCAAAATAGA GAACTTGTAC GATGTGTTTG TAAACGTGAG GGATGACGAG GGAGAGCACT GCAAAACGAT GCGGGCCTGC  CAAACCGCAG GTTCCATATC GTCTCCCCAT CAGGACACGC CCGTCCTGCC TGGCGATCTT TGTAGCGGCG TTGTCGAATG CAGCACCACT GCGGTGTCGG CTGCTGATAG GTTCTTGAAA  CACGGCGTCC CTATCGATGA TACCCTTTAG CTGCGCGTTC GGAAATGTAC TGCGCTGCTT TAGGTAAAAG TTTGTGATAA GAAGAGACAA TGAGGAACTC ACGGTCAGCG CTGGGGTAAG  CGCGGTATTG AGGTTGTACA GTAGTGGTAT GTGGAAGTTA GTTGGGTTAG TGAAGCGATC TGTTCGGTGC AGGCGGCCAT TGCCGCGTCG TCTGGAACTG AAAGGTTCAT GCATGACCCG 
TACCTTTATC TGTGACGAAG ATTGTTTCTG TGCTTGGGCA CAGGATGGGA TTGTCAAACT GCACGAACTT AGGATTGTTC CCGCATGCTA TGATTGGATT 

Retrieve as FASTA