Entry information : CgFSD01 (CgFeMnSOD1)
Entry ID 13888
Creation 2016-09-06 (Marcel Zamocky)
Last sequence changes 2016-10-10 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-10-21 (Marcel Zamocky)
Peroxidase information: CgFSD01 (CgFeMnSOD1)
Name (synonym) CgFSD01 (CgFeMnSOD1)
Class FeSOD    [Orthogroup: FSD002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Chaetomium
Organism Chaetomium globosum    [TaxId: 38033 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgFSD01
start..stop
S start..stop
CbraFSD01 56 0.000000003 18..167 51..195
ThasFSD03 55 0.000000007 49..166 61..180
HaFSD04 55 0.000000008 49..189 89..228
ThasFSD02 53 0.00000003 49..166 66..184
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..241 241 N° 2 303..1072 770  
join(1..241,303..1072)


exon

Literature and cross-references CgFSD01 (CgFeMnSOD1)
Literature REFERENCE #1 Cuomo CA et al. (2015) Genome Announc. 3:E0002115
REFERENCE #2 Zamocky M et al. (2016) BMC Genomics 17:763
Protein ref. GenBank:   XP_001220211.1 UniProtKB:   Q2HFL4
DNA ref. GenBank:   NT_165976 (3055543..3056614)
mRNA ref. GenBank:   XM_001220210.1
Cluster/Prediction ref. Genebank:   4386400
Protein sequence: CgFSD01 (CgFeMnSOD1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336
PWM (Da):   %s   36419.29  
PI (pH):   %s   8.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLRPGLRIAMRPRVGAPARSTLLPLACQARSMHALAPLSYDLKGEATQNGISDFLSPAAFNISWTQYQTYLLQKLNILTAETDYESHQIKDILLGTARDPGSAPIFNHASMAHNNHFFFKHISPKPVEVPEPLRSRLEQSFGSMDTLRQEMVYTAAGMFGPGFVWLVKTSQPGLPVSFKVLTTYAAGSPYPAAHWRRQEHDMNTAAGSGTEAGIATGRAYLDQTAYGTGSSSRWGSGGPGSATARRVAHAPGGTDLVPVLCINTWEHVWLWDYGFGVGAPDRGKLGYAEKWWKHVDWELVQKEADLQRLEMSANAGAPAPSLSSPSLSSPAPVPRA

Retrieve as FASTA  
Remarks Complete from genomic (scafold 1, 1 intron). Strain=148.51 (CHGG_00990).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCGCCCAGGGTTAAGGATAGCGATGCGCCCGCGAGTCGGTGCGCCCGCGAGGTCGACTTTGCTACCGCTGGCCTGCCAGGCACGATCCATGCACGCCCTCGCCCCTCTCTCTTAC
GACCTGAAGGGCGAGGCTACACAAAATGGCATTTCCGACTTCCTGTCGCCCGCCGCCTTCAACATCTCTTGGACCCAGTACCAGACATATCTGCTGCAGAAACTGAACATCTTGACAGCA
G
GTGTGTTCTTTTCTCCCTCTCCTGTCCTATGTCTCTACAGGCAGACTAACAGACCCTCCAGAAACCGACTACGAATCCCACCAGATCAAGGACATCCTGCTCGGCACCGCCCGCGACCC
GGGCTCGGCACCCATCTTCAACCACGCCAGCATGGCGCACAACAACCACTTCTTCTTCAAGCACATCTCGCCCAAGCCGGTCGAGGTGCCCGAGCCCCTGCGCAGCCGCCTCGAGCAGTC
CTTCGGCTCCATGGACACCCTCCGCCAGGAGATGGTCTACACGGCCGCCGGCATGTTCGGCCCGGGCTTCGTGTGGCTCGTCAAGACCTCGCAGCCGGGCCTGCCCGTATCCTTCAAGGT
CCTCACCACCTACGCCGCGGGGTCCCCCTACCCAGCAGCCCACTGGCGGCGGCAGGAGCACGACATGAACACCGCCGCCGGCAGCGGCACCGAGGCCGGCATCGCCACGGGCCGGGCCTA
CCTCGACCAGACAGCGTACGGAACCGGCAGCAGCAGCCGGTGGGGCAGCGGGGGCCCGGGCAGCGCGACGGCGCGGCGGGTGGCGCACGCGCCGGGCGGCACGGACCTGGTCCCCGTGCT
GTGCATCAACACGTGGGAGCACGTGTGGCTGTGGGACTACGGCTTCGGCGTCGGCGCCCCCGACCGCGGCAAGCTGGGCTACGCCGAGAAGTGGTGGAAGCACGTCGACTGGGAGCTCGT
CCAGAAGGAGGCCGACCTGCAGCGCCTCGAGATGTCGGCCAACGCCGGCGCCCCCGCCCCCTCCCTCTCCTCCCCTTCCCTCTCCTCGCCTGCCCCCGTCCCCCGGGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGCGCCCAGGGTTAAGGATAGCGATGCGCCCGCGAGTCGGTGCGCCCGCGAGGTCGACTTTGCTACCGCTGGCCTGCCAGGCACGATCCATGCACGCCCTCGCCCCTCTCTCTTAC
GACCTGAAGGGCGAGGCTACACAAAATGGCATTTCCGACTTCCTGTCGCCCGCCGCCTTCAACATCTCTTGGACCCAGTACCAGACATATCTGCTGCAGAAACTGAACATCTTGACAGCA
G
AAACCGACTACGAATCCCACCAGATCAAGGACATCCTGCTCGGCACCGCCCGCGACCCGGGCTCGGCACCCATCTTCAACCACGCCAGCATGGCGCACAACAACCACTTCTTCTTCAAG
CACATCTCGCCCAAGCCGGTCGAGGTGCCCGAGCCCCTGCGCAGCCGCCTCGAGCAGTCCTTCGGCTCCATGGACACCCTCCGCCAGGAGATGGTCTACACGGCCGCCGGCATGTTCGGC
CCGGGCTTCGTGTGGCTCGTCAAGACCTCGCAGCCGGGCCTGCCCGTATCCTTCAAGGTCCTCACCACCTACGCCGCGGGGTCCCCCTACCCAGCAGCCCACTGGCGGCGGCAGGAGCAC
GACATGAACACCGCCGCCGGCAGCGGCACCGAGGCCGGCATCGCCACGGGCCGGGCCTACCTCGACCAGACAGCGTACGGAACCGGCAGCAGCAGCCGGTGGGGCAGCGGGGGCCCGGGC
AGCGCGACGGCGCGGCGGGTGGCGCACGCGCCGGGCGGCACGGACCTGGTCCCCGTGCTGTGCATCAACACGTGGGAGCACGTGTGGCTGTGGGACTACGGCTTCGGCGTCGGCGCCCCC
GACCGCGGCAAGCTGGGCTACGCCGAGAAGTGGTGGAAGCACGTCGACTGGGAGCTCGTCCAGAAGGAGGCCGACCTGCAGCGCCTCGAGATGTCGGCCAACGCCGGCGCCCCCGCCCCC
TCCCTCTCCTCCCCTTCCCTCTCCTCGCCTGCCCCCGTCCCCCGGGCATGA

Retrieve as FASTA